|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 October 2007
doi: 10.1242/dev.008722
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The Rockefeller University, 1230 York Avenue, New York, NY 10021, USA.
* Author for correspondence (e-mail: peter{at}rockefeller.edu)
Accepted 28 August 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Guanylate cyclase, Semaphorin, Neuropilin, Olfactory bulb, VNO, Necklace glomeruli
| INTRODUCTION |
|---|
|
|
|---|
In the past decade, many studies have concentrated on the elucidation of
the mechanisms of sensory neuron differentiation and axonal wiring in the
mouse. Most of the efforts have been on the two major cell types of the
olfactory system, olfactory sensory neurons (OSNs), expressing odorant
receptor (OR) genes, and vomeronasal sensory neurons (VSNs), expressing
vomeronasal receptor (VR) genes. Axons of OSNs expressing the same OR project
to a small subset of glomeruli at reproducible positions, and ORs are
intimately involved in axonal wiring of OSNs
(Mombaerts, 2006
).
There are several other olfactory subsystems, which have received much less
attention. The first of these is an island of olfactory nature, the septal
organ, which is located within the respiratory epithelium on the ventral
aspect of the posterior septum
(Rodolfo-Masera, 1943
). This
structure contains neurons that express a subset of ORs shared with OSNs that
reside in the ventral regions of the main olfactory epithelium (MOE) and that
project their axons to the ventral parts of the main olfactory bulb (MOB). The
OR expression profile of the septal organ has similarities and differences
with the MOE (Tian and Ma,
2004
). The specific function of the septal organ has not been
established; its neurons may also have mechanosensory abilities
(Grosmaitre et al., 2007
).
Second, the Grueneberg ganglion, located at the tip of the nose
(Grueneberg, 1973
), is now
regarded as an olfactory subsystem (Fuss
et al., 2005
; Koos and Fraser,
2005
; Fleischer et al.,
2006
; Roppolo et al.,
2006
). Its function is not known. Third, a family of
G-protein-coupled receptors, the TAARs, is expressed in a subset of sensory
neurons of the MOE (Liberles and Buck,
2006
). Fourth, several types of neurons in the MOE project their
axons to the necklace area, which demarcates the main from the accessory
olfactory bulb. Several markers distinguishes these neurons from OR-expressing
OSNs or VR-expressing VSNs: placental antigen X-P2
(Shinoda et al., 1989
;
Shinoda et al., 1993
),
antigens to antibodies 2C6 and mAb213
(Ring et al., 1997
), and
guanylate cyclase-D (GC-D) (Fülle et
al., 1995
; Juilfs et al.,
1997
). Neurons from the Grueneberg ganglion also project to the
necklace area (Fuss et al.,
2005
). Thus, the necklace area is heterogeneous in axonal input.
Little is known about the function, morphology and development of the necklace
area, or about the various types of cells that project their axons to it.
We have demonstrated a major role for neuropilin 2 (Nrp2) in VSN axonal
wiring and glomerular formation in the accessory olfactory bulb (AOB), and a
minor role in OSN axonal projections to the MOB
(Walz et al., 2002
). The
necklace area is also disorganized in our Nrp2 mutant mice. Several
of these phenotypes were observed in another strain of Nrp2 mutant
mice (Cloutier et al., 2002
).
Neuropilins are co-receptors for class III semaphorins, and Nrp2 binds Sema3b,
Sema3c and Sema3f (Chen et al.,
1997
; Kolodkin et al.,
1997
; Takahashi et al.,
1998
).
Here, we assess the contributions of individual semaphorin ligands to the phenotypes that are observed in the necklace area of Nrp2 mutant mice. We labeled a subset of necklace glomeruli by generating two mouse strains with targeted mutations in the GC-D (Gucy2d) locus that produce bicistronic messages resulting in co-translation of GC-D with an axonal marker, tau-ß-galactosidase or tauGFP (tau is also known as Mapt). A striking phenotype of Nrp2 or Sema3f knockout mice is that axons of GC-D-positive (GC-D+) neurons, which are not known to express ORs, coalesce into homogeneous glomeruli that are scattered widely at ectopic locations within the glomerular layer of the MOB, in addition to glomeruli in normal positions. Our findings provide genetic evidence for a Nrp2-Sema3f interaction as a determinant of axonal wiring of GC-D+ neurons, and also for axons of some VSNs.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Targeting of the Sema3b and Sema3f loci
To construct targeting vectors, the left and right arms were amplified
using the GeneAmp XL PCR kit (Applied Biosystems, Alameda, CA) with genomic
DNA of E14 cells as template. The following oligos were used: Sema3b
right arm forward: GCGCGTTAATTAAGGACCACGTAGTGCAGCTCACTGGTGA, reverse:
ATATAGGCGCGCCTAGAGCCCAGCAGTACAACATGGCCACC; Sema3b left arm forward:
GGCCGTTTAAACGCCTTACCACCCCCTGGCACTAAGCTC, reverse:
TATAAGCGGCCGCTAAAGGAGAGCCGAAGGCGGGGAAGGTT; Sema3f right arm forward:
GCGCGCTTAATTAACAGTGATCGGCGCCGTGAGGTGAGTT, reverse:
ATATAGGCGCGCCAGGGGCTGGAGAGATGGTCAGTGG; Sema3f left arm forward:
GGCCGTTTAAACGGCAGTGGTTCTCAACCTTCTTAGCTGCCAC, reverse:
TATAAGCGGCCGCGGTACCGGTGGCCTTAAGTTCTGTGG. The arms, which were between 3.8 kb
and 4.4 kb, were subcloned into a modified pBS-SKII vector and sequenced for
PCR errors. A PmeI site was generated at the 5' end of the
targeting vector for linearization of the construct. ACNF was placed in an
XbaI site between the left and right arms.
Gene targeting
Genomic DNA from G418-resistant ES colonies of E14 was digested with
BamHI for Gucy2d, HindIII for Sema3b and
BamHI for Sema3f and analyzed by Southern blot hybridization
with a 5' external probe for Gucy2d, and 3' external
probes for Sema3b and Sema3f. DNA of positive clones was
digested with HindIII or EcoRI for Sema3b and
Sema3f, respectively, and probed with 5' external probes to
verify that no large-scale genomic reorganizations had occurred. ES cells were
injected into C57BL/6J blastocysts. Mice were in a mixed 129 x C57BL/6J
background. The strains will be available from The Jackson Laboratory, as
follows: strain name B6;129P2-Gucy2dtm1Mom/MomJ and #6703
for GCD-ITL; strain name B6;129P2-Gucy2dtm2Mom/MomJ and
#6704 for GCD-ITG; strain name B6;129P2-Sema3btm1Mom/MomJ
and #6705 for
B; strain name
B6;129P2-Sema3ftm1Mom/MomJ and #6710 for
F. The
GCD-ITG mice have been described, in part, previously
(Hu et al., 2007
).
The Sema3c gene has previously been mutated by us
(Feiner et al., 2001
). We have
here studied the Sema3ctm1.1Jra strain in a genetic
background that allows for postnatal survival.
Experiments were conducted according to guidelines and with approval from the Institutional Animal Care and Use Committee of The Rockefeller University.
Fluorescent immunohistochemistry, ß-galactosidase and GFP visualization
For immunohistochemistry, mice were deeply anaesthetized and intracardially
perfused with 4% paraformaldehyde (pH 7.4), postfixed on ice for 3 hours and
finally sunk in 30% sucrose overnight. They were then frozen in OCT and 16-18
µm sections were cut on a cryostat. Sections were blocked in 10% normal
donkey serum (NDS) for 1 hour at room temperature followed by incubation with
primary antibodies in blocking solution at 4°C overnight, except for MAP2
stainings which were incubated for 2 days. The following day the sections were
washed in 0.1% Triton X-100 in PBS and incubated with secondary antibody for 1
hour at room temperature. After final washes in 0.1% Triton X-100 in PBS,
sections were stored in PBS until viewed. Primary antibodies used are as
follows: rabbit polyclonal anti-PDE2A at 1:100 (FabGennix, Frisco, TX, USA),
rabbit polyclonal anti-ß-galactosidase at 1:500 (MP Cappel, Solon, OH,
USA) and chicken polyclonal anti-ß-galactosidase at 1:500 (Abcam,
Cambridge, MA, USA), donkey polyclonal anti-OMP at 1:5000 (Wako Chemicals USA,
Richmond, VA, USA), and rabbit polyclonal anti-MAP2 at 1:1000 (Abcam).
Secondary antibodies were: Alexa Fluor 488-conjugated donkey anti-rabbit,
Alexa Fluor 546-conjugated donkey anti-rabbit, donkey anti-goat and donkey
anti-chicken (Invitrogen, Carlsbad, CA, USA), and Cy5 donkey anti-rabbit
(Jackson ImmunoResearch Laboratories, West Grove, PA, USA) all at 1:500.
For ß-galactosidase whole-mount analysis, tissues were processed as
described before (Mombaerts et al.,
1996
), except that the fixation was carried out on ice for 5
minutes. X-Gal-stained whole-mount specimens were examined with a Zeiss SV11
stereomicroscope, and images were taken with a Zeiss AxioCam CCD camera. For
tauGFP/taulacZ whole-mounts, mice were sacrificed by CO2
asphyxiation and the olfactory epithelium exposed. Staining procedures were
performed as described before (Feinstein
and Mombaerts, 2004
). Whole-mounts of tauGFP, GFP
sections and immunostained sections were examined with a Zeiss LSM 510
confocal microscope. Image files were processed with Adobe Photoshop 8.0.
Glomerular measurements
Measurements of GC-D+ glomeruli were performed on whole-mount
bulbs of GCD-ITL homozygous mice that were lightly stained (<1 hour
exposure to X-Gal at room temperature). The short staining period was
necessary to avoid staining in axons that could obscure smaller glomeruli.
Counting of glomeruli was performed with a Zeiss SV11 stereomicroscope, and
size measurements were done on images taken with a Zeiss AxioCam CCD camera.
The longest axis of individual glomeruli were measured with Adobe Photoshop
8.0 and Canvas 6.0. Student's t-tests were used to determine the
significance of changes between glomerular counts and sizes.
| RESULTS |
|---|
|
|
|---|
35 kb, and contains at least 22 exons in its
open reading frame (ORF) and 5' untranslated region
(Fig. 1A). By homologous
recombination in embryonic stem (ES) cells, we created targeted mutations in
the Gucy2d locus that leave the coding region intact and produce
bicistronic messages (Fig. 1B).
The mouse strains are referred to as GCD-ITL and GCD-ITG.
In GCD-ITL mice, cell bodies that express ß-galactosidase activity,
and therefore can be stained blue with X-Gal, reside in a punctate pattern
within the MOE, at a higher density towards the ventral aspects of the MOE
(Fig. 2A)
(Fülle et al., 1995
).
X-Gal+ cells are also present in the septum, including the septal
organ (Fig. 2B), in which a
small number of neurons are known to express GC-D
(Ma et al., 2003
). As
described previously for GC-D+ neurons
(Juilfs et al., 1997
), most
X-Gal+ cells reside within the recesses of the ectoturbinates as
opposed to the endoturbinates.
GC-D+ cells display the typical morphology of neurons
(Fig. 2C,D) with the exception
of somewhat shorter cilia. All GFP+ axons in GCD-ITG mice are
immunoreactive for PDE2A (Fig.
6A), consistent with the expression of PDE2A by GC-D+
cells in the MOE (Juilfs et al.,
1997
). In mice that are doubly heterozygous for GCD-ITL and
GCD-ITG, GC-D+ neurons co-express ß-galactosidase and GFP,
demonstrating bi-allelic expression at the Gucy2d locus
(Fig. 2E).
|
|
Morphology and development of GC-D+ glomeruli
Axons of GC-D+ neurons course through the lamina propria along
with OSN axons, penetrate the skull through the cribriform plate, and turn
towards the caudal aspect of the MOB along a ventral trajectory
(Fig. 3A-D). GC-D+
axons spread out to form several glomeruli, which are located superficially.
Often, clustering occurs in arrangements of several tightly packed glomeruli
(Fig. 3E,F). GC-D+
glomeruli form a complete ring around the stalk of the MOB and around the
anterior part of the AOB (Fig.
3A-D), thus placing them in the necklace area. GC-D+
axons interconnect these glomeruli to form the typical necklace appearance of
beads on a string. None of the GC-D+ glomeruli could be identified
unequivocally as belonging to the modified glomerular complex, a structure
that is poorly defined. Overall, no stereotyped pattern in the positions of
GC-D+ glomeruli was apparent among bulbs
(Fig. 3E) except that a greater
number and the larger glomeruli are located in the ventrolateral aspects of
the caudal MOB (Fig. 3B). One
exception is the conserved location of a glomerular cluster at the
ventral-most position on the lateral side of the MOB
(Fig. 3E).
|
Targeted mutagenesis of the Sema3b and Sema3f genes
What are the mechanisms that underlie the wiring of axons of
GC-D+ neurons into this unusual arrangement of necklace glomeruli?
We have reported that a mutation in the neuropilin 2 gene (strain NP2-
)
perturbs the projection of some VSN axons to the AOB, and also produces a
general disorganization of the necklace area
(Walz et al., 2002
). Most
GC-D+ neurons express neuropilin 2 (Nrp2;
Fig. 6B). Nrp2 has been
proposed as a co-receptor for several class III semaphorins, most notably
Sema3b, Sema3c and Sema3f (Chen et al.,
1997
; Kolodkin et al.,
1997
; Takahashi et al.,
1998
). To investigate the individual contributions of semaphorins
in the wiring defects of GC-D+ axons seen in Nrp2 mutant
mice, we generated Sema3b and Sema3f knockout mice by gene
targeting.
The Sema3f and Sema3b genes are located on chromosome 9F2
within 80 kb of each other (Fig.
1C). We created individual null mutations for both Sema3f
(henceforth called
F) and Sema3b (henceforth called
B)
by deleting 85% (
F) or 100% (
B) of the ORF
(Fig. 1D). Compared with other
targeted mutations of Sema3f
(Sahay et al., 2003
) and
Sema3b (Julien et al.,
2005
),
F and
B are null mutations.
The
F and
B mouse strains are viable as homozygotes.
F
homozygous mice display many of the gross defects we observed in NP2-
homozygous mice (Walz et al.,
2002
), including reduced size of the mice during the first few
weeks after birth and a smaller number of homozygous mice than expected from a
Mendelian distribution (n=34 for wild type, n=51 for
heterozygous, n=14 for homozygous).
B homozygous mice appear
normal and are born at Mendelian frequencies (n=28 for wild type,
n=47 for heterozygous, n=21 for homozygous).
B/
F double mutants could not be generated because of the linkage
of these genes in the genome.
Axonal wiring of GC-D+ neurons in Nrp2- and Sema3f-deficient backgrounds
To evaluate a role for neuropilin-semaphorin signaling in axonal wiring of
GC-D+ neurons, GCD-ITL mice were crossed with NP2-
,
B, and
F mice. GC-D+ axons fan out over a far greater
territory of the MOB in a NP2-
homozygous background than in wild-type
mice, and glomeruli form in inappropriate locations
(Fig. 5). In addition to
GC-D+ glomeruli that are located in the necklace area, many
GC-D+ glomeruli are scattered ectopically across the MOB up to the
rostral tip. There are fewer GC-D+ glomeruli in the necklace area
compared to controls, but the combined number of necklace and ectopic
GC-D+ glomeruli in the NP2-
homozygous background is
significantly greater compared to wild-type mice
(Fig. 4C). Large glomeruli form
almost exclusively in the necklace area and are equally frequent in mutant and
wild-type mice. Similar numbers of medium-sized glomeruli are found in mutant
and wild-type mice, but some glomeruli are ectopic in mutant mice.
Significantly more small glomeruli form ectopically in mutant mice, accounting
for most of the increase of total number of glomeruli in mutant mice.
|
homozygous background are phenocopied in the
F homozygous background (Fig.
5). By contrast,
B homozygous mice
(Fig. 5) and Sema3c
homozygous mutant mice (data not shown) have a normal GC-D innervation pattern
among the necklace glomeruli.
To further investigate the composition of ectopic GC-D+
glomeruli in NP2-
homozygous mice, we tested whether the ectopic
glomeruli receive axonal input solely from GC-D+ neurons, or
whether they may have heterogeneous innervation by neurons from the MOE. By
double labeling ectopic GC-D+ glomeruli in the MOB with antibodies
against OMP, no GC-D-/OMP+ areas were detected within
these glomeruli, indicating that axons of other types of OMP+
neurons do not contribute to these glomeruli, at least not in substantial
numbers (Fig. 6C). Ectopic
GC-D+ glomeruli were found to reside at appropriate, deeper,
locations within the glomerular layer of the MOB, instead of at the
superficial locations in the necklace area
(Fig. 6A,C). Furthermore, when
ectopic GC-D+ glomeruli were counterstained with antibodies against
MAP-2 to visualize mitral and tufted cell dendrites projecting to glomeruli,
these glomeruli were doubly labeled (Fig.
6D). Thus, the homogeneous innervation of ectopic glomeruli by
axons of GC-D+ neurons and the projections of dendrites of mitral
and tufted cells into these ectopic glomeruli, suggest that these glomeruli
may represent new functional units.
Axonal wiring of VSNs in Nrp2- and Sema-deficient backgrounds
The NP2-
mutation also perturbs the projection of VSN axons
to the AOB (Walz et al.,
2002
). To evaluate a role of Sema3b, Sema3c and Sema3f in axonal
wiring of VSNs, the targeted mutations in the corresponding genes were
introduced into NP2-
(Walz et al.,
2002
) heterozygous, or V1rb2-IRES-taulacZ
(Rodriguez et al., 1999
)
homozygous backgrounds to visualize, respectively, the Nrpn2+
axonal population emanating from apical VSNs (expressing the entire repertoire
of V1r genes), and the axonal population of V1rb2+ VSNs
(expressing the V1r gene V1rb2). The NP2-
mutation is
used in the heterozygous state merely as a marker for apical VSNs, and in the
homozygous state both as a marker for apical VSNs and to assess the
consequences of loss of Nrp2.
In the
F homozygous background, the cell bodies of Nrp2+
VSNs were still located within the apical layer of the VNO, and the numbers
and distribution of V1rb2+ VSNs were normal (data not shown).
However, the axonal projections of Nrp2+ and V1rb2+ VSNs
exhibited defasciculation across the medial surface of the MOB
(Fig. 7D), as we reported for
NP2-
homozygous mice (Fig.
7C) (Walz et al.,
2002
). By contrast, axonal projection patterns appeared normal in
B and Sema3c homozygous mutant backgrounds
(Fig. 7A,B, and data not
shown).
|
F homozygous mice
(Fig. 7D) or in sections (data
not shown). Most Nrp2+ axons and all V1rb2+ axons
eventually reached the AOB (Fig.
7C,D). Within the anterior AOB (aAOB), Nrp2+ axons
erroneously project into the posterior AOB (pAOB) in a
F homozygous
background (Fig. 7H),
comparable to the phenotype of NP2-
homozygous mice
(Fig. 7G). Likewise,
V1rb2+ axons form glomeruli within the pAOB in a
F
homozygous background (Fig.
7I-L). Interestingly, misprojections can be observed in some mice
with a
F heterozygous background (18.2%, n=11;
Fig. 7L). By contrast,
B
homozygous and Sema3c homozygous mutant mice do not show abnormal
innervation patterns for Nrp2+ and V1rb2+ axons into the
pAOB (Fig. 7A,F, and data not
shown). Axonal overshooting of OSNs observed for NP2-
homozygous mice
(Walz et al., 2002
F homozygous mice, but not in
B or Sema3c homozygous
mutant mice (data not shown). Thus, as for GC-D+ neurons, the defects in VSN axonal wiring caused by a deficiency in Nrp2 can be phenocopied by loss of one of its ligands, Sema3f, but not of Sema3b or Sema3c.
| DISCUSSION |
|---|
|
|
|---|
Necklace glomeruli
Much of the focus of research on the olfactory system of the mouse has been
on OSNs and VSNs. There has been relatively little progress in our knowledge
of other subsystems such as the necklace area, a ring of interconnected
glomeruli that surrounds the caudal end of the MOB and the aAOB in mouse and
rat (Juilfs et al., 1997
;
Ring et al., 1997
;
Shinoda et al., 1989
;
Shinoda et al., 1993
;
Walz et al., 2002
;
Zheng et al., 1987
). Several
markers can be used to distinguish the necklace glomeruli from MOB glomeruli,
including the high intensity cholinesterase glomeruli also known as atypical
glomeruli (Le Jeune and Jourdan,
1993
; Zheng et al.,
1987
), the placental antigen X-P2 immunoreactive glomeruli
(Shinoda et al., 1989
;
Shinoda et al., 1993
), the 2C6
and mAb213-positive glomeruli (Ring et
al., 1997
) and GC-D and PDE2-expressing glomeruli
(Fülle et al., 1995
;
Juilfs et al., 1997
).
Glomeruli can be positive for one or more of these markers, as well as for the
presence or absence of NCAM or OMP (Ring
et al., 1997
), thus defining multiple classes. They aggregate into
9-16 larger glomerular complexes of differently labeled glomeruli
(Ring et al., 1997
;
Shinoda et al., 1993
). The
Grueneberg ganglion projects to the necklace area
(Fuss et al., 2005
), adding to
the heterogeneity.
|
40 per bulb) was higher than other types such as mAb213- and
2C6-positive glomeruli [
20 per bulb and
3 per rat bulb, respectively
(Ring et al., 1997
15-20 per mouse bulb
(Weruaga et al., 2001
9 per rat bulb
(Shinoda et al., 1989
Signaling in GC-D expressing neurons
GC-D belongs to a class of receptor GCs that contains at least seven
members, GC-A to GC-G (Kuhn,
2003
). All neurons in the MOE express some membrane GCs
(Moon et al., 1998
), but GC-D
is unique to a small subset of neurons. GC-D+ neurons lack
components of the signal transducing mechanism found in conventional OSNs,
such as Golf, high affinity cAMP-specific phosphodiesterase,
adenylyl cyclase III and the cyclic nucleotidegated channel subunit CNGA2
(Juilfs et al., 1997
;
Meyer et al., 2000
).
GC-D+ neurons may rely on cGMP as a second messenger
(Fülle et al., 1995
;
Juilfs et al., 1997
). It is
possible that GC-D+ neurons do not use an OR for detection of
chemosensory stimuli; they are not known to express ORs. GC-D itself may
function as the primary mechanism for stimulus reception in these neurons;
alternatively, another class of chemosensory receptor(s) is expressed in
GC-D+ neurons.
We have recently shown that GC-D+ neurons respond specifically
to carbon dioxide (Hu et al.,
2007
), but GC-D itself has not yet been implicated in this
response. It is possible that these neurons also respond to other
chemicals.
|
Mechanisms of axonal wiring defects
The most probable explanation for the miswiring of many GC-D+
axons into ectopic glomeruli across the MOB may lie in the expression of
Sema3f over most of the surface of the MOB
(Cloutier et al., 2002
;
Cloutier et al., 2004
;
Walz et al., 2002
). In
wild-type mice, Sema3f would deflect the ventrally arriving axons away from
dorsal areas such that these axons coalesce into glomeruli in ventral areas;
this effect would occur on Nrp2+, OR-expressing OSNs and the
Nrp2+ GC-D+ neurons. In the absence of Nrp2 or Sema3f,
GC-D+ axons would be free to navigate across ectopic areas of the
MOB, and conventional OSNs show an overshooting phenotype
(Walz et al., 2002
). It cannot
be ruled out that Sema3f induces Nrp2+ axons to undergo specific
differential adhesion. It is more likely that Sema3f exerts its function as a
repellent, causing Nrp2+ growth cones to steer towards areas with
lowest possible Sema3f concentration via a localized collapsing activity
similar to the one shown for collapsin
(Fan and Raper, 1995
).
Many glomeruli still form within the necklace area in Nrp2 and
Sema3f mutant mice. It is not clear whether the same GC-D+
glomeruli are affected in Nrp2 and Sema3f mutant mice.
Moreover, it is not known whether a single GC-D+ neuron sends a
single unbranched axon to one glomerulus in wild-type and mutant mice, or
whether it has projections to several glomeruli. Some cells in the septal
organ also express GC-D, and they may behave differently than GC-D+
neurons of the MOE in the absence of Nrp2 or Sema3f. Neurons from the
Grueneberg ganglion project axons to the necklace area but do not express
GC-D, yet they are Nrp2+ (Fuss
et al., 2005
). These axons are unlikely to contribute to the
GC-D+ necklace glomeruli, but could be affected in Nrp2- or
Sema3f-deficient mice.
Further studies will address the in vitro effects of Sema3f on
GC-D+ axons. It will also be interesting to cross the NP2-
and
F mutations, to determine if the phenotype of the double mutants is
the same as that of the single mutants.
Different classes of V1r-expressing vomeronasal sensory neurons
Our Sema3f knockout phenocopies our Nrp2 knockout for
both necklace and vomeronasal glomeruli, whereas mutants in Sema3b
and Sema3c do not show obvious changes. Comparing our findings with a
previous study investigating the role of Sema3f in the innervation of apical
VSNs to the aAOB (Cloutier et al.,
2004
), there are some discrepancies. Whereas Cloutier et al. also
reported the defasciculation of VSN axons along the medial surface in
Nrp2 or Sema3f mutant backgrounds, they could see misplaced
axonal growth and glomerular formation within the pAOB only in Nrp2
mutants but not in Sema3f mutants
(Cloutier et al., 2004
).
Moreover, the misplaced glomerular innervation of VSN axons into the MOB
(Cloutier et al., 2004
) was not
detected by us.
One explanation is a difference in the nature of the targeted mutation in
Sema3f: the mutation used by Cloutier et al.
(Cloutier et al., 2004
) removes
exon 1 and 4 kb of presumptive promoter sequence, whereas our Sema3f
mutation removes exons 2-15, or 85% of the ORF. Another, more interesting,
explanation may lie in the vomeronasal receptor type 1 gene (V1r)
that is expressed by the VSNs studied: V1rb2 in our case, and
V1ra1 in the case of Cloutier et al.
(Cloutier et al., 2004
). There
may be heterogeneity among populations of VSNs that express a given V1r from
the repertoire of >100 V1r genes in mouse
(Zhang et al., 2007
).
V1ra1+ VSNs may respond to other Nrp2 ligands such as Sema3b or
Sema3c instead of Sema3f. Since neuropilins need other partners to transduce
ligand binding, such as plexins (Tamagnone
et al., 2001
), cell adhesion molecules
(Castellani et al., 2000
;
Julien et al., 2005
), MICALs
(Terman et al., 2002
) or NIP
(Cai and Reed, 1999
),
V1ra1+ VSNs could express a different receptor complex than
V1rb2+ VSNs and respond differently to various semaphorin ligands.
The misprojections of V1ra1+ but not V1rb2+ axons into
the MOB could be explained by such molecular differences. It is less clear why
V1ra1+ axons do not misroute into the pAOB of Sema3f
mutant mice. Other explanations involve untested members of the class III
semaphorin family, such as Sema3e
(Miyazaki et al., 1999
), or
the unknown negative regulation of one class III semaphorin on the action of
another to render it an attractant, as is the case for Sema3b or Sema3c acting
to reverse the repulsive action of Sema3a on Nrp1-expressing growth cones
(Takahashi et al., 1998
).
Other semaphorins
A role for Sema3b and Sema3c cannot be ruled out completely. In the case of
the anterior commissure (AC), Sema3f first appeared to be the sole ligand
responsible for the absence of an AC in Nrp2 mutant mice
(Sahay et al., 2003
). In a
later study, however, it became clear that Sema3b has a somewhat overlapping
yet mostly complementary role in establishing the positioning of the AC as
well as causing the attraction or repulsion of various axonal tracts
contributing to the AC; the loss of Sema3b induced the defasciculation of
parts of the AC (Julien et al.,
2005
). By contrast, no real function has been established for
Sema3c in the nervous system. Some studies suggest that Sema3c can influence
hippocampal (Steup et al.,
1999
), cortical (Gonthier et al., 2006) and cerebellar
(Moreno-Flores et al., 2003
)
neurites in vitro but no investigations in vivo have been reported. Also, the
expression of the various plexins can profoundly affect the ability of any
member of class III semaphorins to act as either an attractant or repellant
(Yaron et al., 2005
). Thus a
change in the plexin expressed in either Nrp2 or semaphorin mutant
background may have occurred and consequently altered axon behavior.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Axel, R. (2005). Scents and sensibility: a molecular logic of olfactory perception. Angew. Chem. Int. Ed. Engl. 38,6110 -6127.
Belluscio, L., Koentges, G., Axel, R. and Dulac, C. (1999). A map of pheromone receptor activation in the mammalian brain. Cell 97,209 -220.[CrossRef][Medline]
Bozza, T., Feinstein, P., Zheng, C. and Mombaerts, P.
(2002). Odorant receptor expression defines functional units in
the mouse olfactory system. J. Neurosci.
22,3033
-3043.
Buck, L. B. (2005). Unraveling the sense of smell. Angew. Chem. Int. Ed. Engl. 38,6128 -6140.
Cai, H. and Reed, R. R. (1999). Cloning and
characterization of neuropilin-1-interacting protein: a PSD-95/Dlg/ZO-1
domain-containing protein that interacts with the cytoplasmic domain of
neuropilin-1. J. Neurosci.
19,6519
-6527.
Castellani, V., Chedotal, A., Schachner, M., Faivre-Sarrailh, C. and Rougon, G. (2000). Analysis of the L1-deficient mouse phenotype reveals cross-talk between Sema3A and L1 signaling pathways in axonal guidance. Neuron 27,237 -249.[CrossRef][Medline]
Chen, H., Chedotal, A., He, Z., Goodman, C. S. and Tessier-Lavigne, M. (1997). Neuropilin-2, a novel member of the neuropilin family, is a high affinity receptor for the semaphorins Sema E and Sema IV but not Sema III. Neuron 19,547 -559.[CrossRef][Medline]
Cloutier, J. F., Giger, R. J., Koentges, G., Dulac, C., Kolodkin, A. L. and Ginty, D. D. (2002). Neuropilin-2 mediates axonal fasciculation, zonal segregation, but not axonal convergence, of primary accessory olfactory neurons. Neuron 33,877 -892.[CrossRef][Medline]
Cloutier, J. F., Sahay, A., Chang, E. C., Tessier-Lavigne, M.,
Dulac, C., Kolodkin, A. L. and Ginty, D. D. (2004).
Differential requirements for semaphorin 3F and Slit-1 in axonal targeting,
fasciculation, and segregation of olfactory sensory neuron projections.
J. Neurosci. 24,9087
-9096.
Fan, J. and Raper, J. A. (1995). Localized collapsing cues can steer growth cones without inducing their full collapse. Neuron 14,263 -274.[CrossRef][Medline]
Feiner, L., Webber, A. L., Brown, C. B., Lu, M. M., Jia, L., Feinstein, P., Mombaerts, P., Epstein, J. A. and Raper, J. A. (2001). Targeted disruption of semaphorin 3C leads to persistent truncus arteriosus and aortic arch interruption. Development 128,3061 -3070.[Medline]
Feinstein, P. and Mombaerts, P. (2004). A contextual model for axonal sorting into glomeruli in the mouse olfactory system. Cell 117,817 -831.[CrossRef][Medline]
Fleischer, J., Schwarzenbacher, K., Besser, S., Hass, N. and Breer, H. (2006). Olfactory receptors and signaling elements in the Grueneberg ganglion. J. Neurochem. 98,543 -554.[CrossRef][Medline]
Fülle, H. J., Vassar, R., Foster, D. C., Yang, R. B., Axel,
R. and Garbers, D. L. (1995). A receptor guanylate cyclase
expressed specifically in olfactory sensory neurons. Proc. Natl.
Acad. Sci. USA 92,3571
-3575.
Fuss, S. H., Omura, M. and Mombaerts, P. (2005). The Grueneberg ganglion of the mouse projects axons to glomeruli in the olfactory bulb. Eur. J. Neurosci. 22,2649 -2654.[Medline]
Gonthier, B., Nasarre, C., Roth, L., Perraut, M., Thomasset, N.,
Roussel, G., Aunis, D. and Bagnard, D. (2007). Functional
interaction between matrix metalloproteinase-3 and semaphorin-3C during
cortical axonal growth and guidance. Cereb. Cortex
17,1712
-1721.
Greer, C. A., Stewart, W. B., Teicher, M. H. and Shepherd, G. M. (1982). Functional development of the olfactory bulb and a unique glomerular complex in the neonatal rat. J. Neurosci. 2,1744 -1759.[Medline]
Grosmaitre, X., Santarelli, L. C., Tan, J., Luo, M. and Ma, M. (2007). Dual functions of mammalian olfactory sensory neurons as odor detectors and mechanical sensors. Nat. Neurosci. 10,348 -354.[CrossRef][Medline]
Grueneberg, H. (1973). A ganglion probably belonging to the N. terminalis system in the nasal mucosa of the mouse. Z. Anat. Entwicklungsgesch. 140, 39-52.[CrossRef][Medline]
Hu, J., Zhong, C., Ding, C., Chi, Q., Walz, A., Mombaerts, P.,
Matsunami, H. and Luo, M. (2007). Detection of
near-atmospheric concentrations of CO2 by an olfactory subsystem in the mouse.
Science 317,953
-957.
Juilfs, D. M., Fülle, H. J., Zhao, A. Z., Houslay, M. D.,
Garbers, D. L. and Beavo, J. A. (1997). A subset of olfactory
neurons that selectively express cGMP-stimulated phosphodiesterase (PDE2) and
guanylate cyclase-D define a unique olfactory signal transduction pathway.
Proc. Natl. Acad. Sci. USA
94,3388
-3395.
Julien, F., Bechara, A., Fiore, R., Nawabi, H., Zhou, H., Hoyo-Becerra, C., Bozon, M., Rougon, G., Grumet, M., Püschel, A. W. et al. (2005). Dual functional activity of semaphorin 3B is required for positioning the anterior commissure. Neuron 48,63 -75.[CrossRef][Medline]
Kolodkin, A. L., Levengood, D. V., Rowe, E. G., Tai, Y. T., Giger, R. J. and Ginty, D. D. (1997). Neuropilin is a semaphorin III receptor. Cell 90,753 -762.[CrossRef][Medline]
Koos, D. S. and Fraser, S. E. (2005). The Grueneberg ganglion projects to the olfactory bulb. Neuroreport 16,1929 -1932.[CrossRef][Medline]
Kuhn, M. (2003). Structure, regulation, and
function of mammalian membrane guanylate cyclase receptors, with a focus on
guanylate cyclase-A. Circ. Res.
93,700
-709.
Le Jeune, H. and Jourdan, F. (1991). Postnatal development of cholinergic markers in the rat olfactory bulb: a histochemical and immunocytochemical study. J. Comp. Neurol. 314,383 -395.[CrossRef][Medline]
Le Jeune, H. and Jourdan, F. (1993). Cholinergic innervation of olfactory glomeruli in the rat: an ultrastructural immunocytochemical study. J. Comp. Neurol. 336,279 -292.[CrossRef][Medline]
Liberles, S. D. and Buck, L. B. (2006). A second class of chemosensory receptors in the olfactory epithelium. Nature 442,645 -650.[CrossRef][Medline]
Ma, M., Grosmaitre, X., Iwema, C. L., Baker, H., Greer, C. A.
and Shepherd, G. M. (2003). Olfactory signal transduction in
the mouse septal organ. J. Neurosci.
23,317
-324.
Meyer, M. R., Angele, A., Kremmer, E., Kaupp, U. B. and Muller,
F. (2000). A cGMP-signaling pathway in a subset of olfactory
sensory neurons. Proc. Natl. Acad. Sci. USA
97,10595
-10600.
Miyazaki, N., Furuyama, T., Sakai, T., Fujioka, S., Mori, T., Ohoka, Y., Takeda, N., Kubo, T. and Inagaki, S. (1999). Developmental localization of semaphorin H messenger RNA acting as a collapsing factor on sensory axons in the mouse brain. Neuroscience 93,401 -408.[CrossRef][Medline]
Mombaerts, P. (2004). Genes and ligands for odorant, vomeronasal and taste receptors. Nat. Rev. Neurosci. 5,263 -278.[CrossRef][Medline]
Mombaerts, P. (2006). Axonal wiring in the mouse olfactory system. Annu. Rev. Cell Dev. Biol. 22,713 -737.[CrossRef][Medline]
Mombaerts, P., Wang, F., Dulac, C., Chao, S. K., Nemes, A., Mendelsohn, M., Edmondson, J. and Axel, R. (1996). Visualizing an olfactory sensory map. Cell 87,675 -686.[CrossRef][Medline]
Moon, C., Jaberi, P., Otto-Bruc, A., Baehr, W., Palczewski, K.
and Ronnett, G. V. (1998). Calcium-sensitive particulate
guanylate cyclase as a modulator of cAMP in olfactory receptor
neurons. J. Neurosci.
18,3195
-3205.
Moreno-Flores, M. T., Martin-Aparicio, E., Martin-Bermejo, M. J., Agudo, M., McMahon, S., Avila, J., Diaz-Nido, J. and Wandosell, F. (2003). Semaphorin 3C preserves survival and induces neuritogenesis of cerebellar granule neurons in culture. J. Neurochem. 87,879 -890.[CrossRef][Medline]
Ring, G., Mezza, R. C. and Schwob, J. E. (1997). Immunohistochemical identification of discrete subsets of rat olfactory neurons and the glomeruli that they innervate. J. Comp. Neurol. 388,415 -434.[CrossRef][Medline]
Risser, J. M. and Slotnick, B. M. (1987). Suckling behavior in rat pups with lesions which destroy the modified glomerular complex. Brain Res. Bull. 19,275 -281.[CrossRef][Medline]
Rodolfo-Masera, T. (1943). Su l'esistenza di un particolare organo olfacttivo nel setto nasale della cavia e di altri roditori. Arch. Ital. Anat. Embryol. 48,157 -212.
Rodriguez, I., Feinstein, P. and Mombaerts, P. (1999). Variable patterns of axonal projections of sensory neurons in the mouse vomeronasal system. Cell 97,199 -208.[CrossRef][Medline]
Roppolo, D., Ribaud, V., Jungo, V. P., Luscher, C. and Rodriguez, I. (2006). Projection of the Grueneberg ganglion to the mouse olfactory bulb. Eur. J. Neurosci. 23,2887 -2894.[CrossRef][Medline]
Sahay, A., Molliver, M. E., Ginty, D. D. and Kolodkin, A. L.
(2003). Semaphorin 3F is critical for development of limbic
system circuitry and is required in neurons for selective CNS axon guidance
events. J. Neurosci. 23,6671
-6680.
Shinoda, K., Shiotani, Y. and Osawa, Y. (1989). "Necklace olfactory glomeruli" form unique components of the rat primary olfactory system. J. Comp. Neurol. 284,362 -373.[CrossRef][Medline]
Shinoda, K., Ohtsuki, T., Nagano, M. and Okumura, T. (1993). A possible functional necklace formed by placental antigen X-P2-immunoreactive and intensely acetylcholinesterase-reactive (PAX/IAE) glomerular complexes in the rat olfactory bulb. Brain Res. 618,160 -166.[CrossRef][Medline]
Steup, A., Ninnemann, O., Savaskan, N. E., Nitsch, R., Püschel, A. W. and Skutella, T. (1999). Semaphorin D acts as a repulsive factor for entorhinal and hippocampal neurons. Eur. J. Neurosci. 11,729 -734.[CrossRef][Medline]
Takahashi, T., Nakamura, F., Jin, Z., Kalb, R. G. and Strittmatter, S. M. (1998). Semaphorins A and E act as antagonists of neuropilin-1 and agonists of neuropilin-2 receptors. Nat. Neurosci. 1,487 -493.[CrossRef][Medline]
Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G. I., Song, H., Chedotal, A., Winberg, M. L., Goodman, C. S., Poo, M. et al. (2001). Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99,71 -80.[CrossRef]
Terman, J. R., Mao, T., Pasterkamp, R. J., Yu, H. H. and Kolodkin, A. L. (2002). MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell 109,887 -900.[CrossRef][Medline]
Tian, H. and Ma, M. (2004). Molecular
organization of the olfactory septal organ. J.
Neurosci. 24,8383
-8390.
Walz, A., Rodriguez, I. and Mombaerts, P.
(2002). Aberrant sensory innervation of the olfactory bulb in
neuropilin-2 mutant mice. J. Neurosci.
22,4025
-4035.
Walz, A., Omura, M. and Mombaerts, P. (2006). Development and topography of the lateral olfactory tract in the mouse: imaging by genetically encoded and injected fluorescent markers. J. Neurobiol. 66,835 -846.[CrossRef][Medline]
Weruaga, E., Brinon, J. G., Porteros, A., Arevalo, R., Aijon, J.
and Alonso, J. R. (2001). A sexually dimorphic group of
atypical glomeruli in the mouse olfactory bulb. Chem.
Senses 26,7
-15.
Yang, R. B., Fülle, H. J. and Garbers, D. L. (1996). Chromosomal localization and genomic organization of genes encoding guanylate cyclase receptors expressed in olfactory sensory neurons and retina. Genomics 31,367 -372.[CrossRef][Medline]
Yaron, A., Huang, P. H., Cheng, H. J. and Tessier-Lavigne, M. (2005). Differential requirement for Plexin-A3 and -A4 in mediating responses of sensory and sympathetic neurons to distinct class 3 Semaphorins. Neuron 45,513 -523.[CrossRef][Medline]
Zhang, X., Zhang, Z. and Firestein, S. (2007). Comparative genomics of odorant and pheromone receptor genes in rodents. Genomics 89,441 -450.[CrossRef][Medline]
Zheng, L. M., Ravel, N. and Jourdan, F. (1987). Topography of centrifugal acetylcholinesterase-positive fibres in the olfactory bulb of the rat: evidence for original projections in atypical glomeruli. Neuroscience 23,1083 -1093.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
K. Yamauchi, S. Mizushima, A. Tamada, N. Yamamoto, S. Takashima, and F. Murakami FGF8 Signaling Regulates Growth of Midbrain Dopaminergic Axons by Inducing Semaphorin 3F J. Neurosci., April 1, 2009; 29(13): 4044 - 4055. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Larrivee, C. Freitas, S. Suchting, I. Brunet, and A. Eichmann Guidance of Vascular Development: Lessons From the Nervous System Circ. Res., February 27, 2009; 104(4): 428 - 441. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sun, H. Wang, J. Hu, J. Han, H. Matsunami, and M. Luo Guanylyl cyclase-D in the olfactory CO2 neurons is activated by bicarbonate PNAS, February 10, 2009; 106(6): 2041 - 2046. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||