|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 10 October 2007
doi: 10.1242/dev.009290
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Carolina Cardiovascular Biology Center, University of North Carolina, Chapel
Hill, NC 27599, USA.
2 Department of Biology, Fordham Hall, University of North Carolina, Chapel
Hill, NC 27599, USA.
3 Department of Genetics, Fordham Hall, University of North Carolina, Chapel
Hill, NC 27599, USA.
Author for correspondence (e-mail:
frank_conlon{at}med.unc.edu)
Accepted 31 August 2007
| SUMMARY |
|---|
|
|
|---|
Key words: SHP-2, Cardiac, Xenopus, Cell cycle, Survival, FGF
| INTRODUCTION |
|---|
|
|
|---|
The isolation and culturing of cardiac progenitor cells has strongly
implied the requirement for growth factor function to maintain cardiac cell
survival. Collectively these studies have shown that survival and
proliferation of cardiac progenitor populations requires either the
aggregation of clonal colonies, that the cells be co-cultured with heart
tissue, or that the cultures be supplemented with a mixture of growth factors
and cytokines (Goetz and Conlon,
2007
; Kattman et al.,
2006
; Kouskoff et al.,
2005
; Moretti et al.,
2006
; Parmacek and Epstein,
2005
; Srivastava,
2006
; Wu et al.,
2006
). However, the precise nature of the endogenous growth
factors and the downstream signaling pathways required for cardiac survival or
proliferation remain unidentified.
SHP-2, also known as SH-PTP2, Ptpn11, PTP1D or PTP2C, is the vertebrate
homolog of the Drosophila gene corkscrew (csw), a
widely expressed non-receptor protein tyrosine phosphatase (PTP) known to
function genetically and biochemically downstream of a number of growth
factors including epidermal growth factors (EGFs), platelet derived growth
factor (PDGF), insulin and fibroblast growth factors (FGFs)
(Delahaye et al., 2000
;
Feng, 1999
;
Pawson, 1994
;
Qu, 2000
;
Van Vactor et al., 1998
;
Zhang et al., 2000
). The
sequence, expression pattern and function of SHP-2 are highly conserved
throughout evolution, with genetic studies in a number of animal models all
suggestive of a crucial role for SHP-2 in early development. For example, mice
homozygous for a null mutation in Shp-2 (Ptpn11) die at
implantation, owing to a failure in the development of the extra-embryonic
trophectodermal lineage, while introduction of a dominant-negative form of
SHP-2 in Xenopus can completely block mesoderm formation in response
to the FGF/MAPK pathway and leads to gastrulation arrest
(Tang et al., 1995
;
Yang et al., 2006
).
Studies have also suggested a role for SHP-2 in heart development. Noonan
syndrome, a relatively common autosomal dominant disorder that leads to a
number of cardiac abnormalities, including atrial septal defects, ventricular
septal defects, pulmonary stenosus and hypertrophic cardiomyopathy, is
associated with mutations in SHP-2 (PTPN11) in approximately
half of affected individuals (Noonan and
O'Connor, 1996
; Tartaglia et
al., 2001
). All SHP-2-associated Noonan syndrome mutations are
mis-sense mutations and occur within one of the two SRC-homology 2 (SH2)
domains, regions required for protein-protein interactions, or within the
phosphatase domain. These mutations are thought to be involved in switching
SHP-2 between its inactive and active states, and to act in a constitutively
active fashion (Allanson, 2002
;
Maheshwari et al., 2002
;
Schollen et al., 2003
;
Tartaglia et al., 2002
;
Tartaglia et al., 2001
).
However, the precise requirement for SHP-2 in heart development remains to be
established.
In this study, we have bypassed the early embryonic requirements for SHP-2 by means of a cardiac explant assay. Using this assay, we define a requirement for SHP-2 in maintaining cardiac precursor populations in vivo. In the absence of SHP-2 signaling, all early cardiac makers are downregulated and cardiac cells fail to initiate cardiac differentiation. We further show that SHP-2 is required for cardiac progenitor populations that are actively proliferating, but not those that have exited the cell cycle. We show that SHP-2 functions directly downstream of FGF in this process and that inhibiting FGF phenocopies SHP-2 inhibition. Furthermore, SHP-2 is directly phosphorylated on specific residues in vivo in response to FGF signaling, and co-immunoprecipitates with FRS, a component of the FGF pathway. Most crucially, we can rescue the cardiac lineage and the downstream signaling pathways in FGF-inhibited tissues by the expression of a constitutively active/Noonan syndrome version of SHP-2.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Embryo injections
Xenopus embryos were obtained by in vitro fertilization
(Smith and Slack, 1983
),
cultured in 0.1x modified Barth's saline (MBS) and staged according to
the Normal Table of Xenopus laevis
(Nieuwkoop and Faber, 1975
).
RNA for injection was synthesized using the mMessage in vitro transcription
kit (Ambion) according to the manufacturer's instructions. Embryos were
injected at the one-cell stage with 2 ng RNA dissolved in 10 nl water unless
otherwise stated.
Cardiac explants
Tissue posterior to the cement gland and including the heart field was
excised at stage 22 in a manner similar to that described by Raffin et al.
(Raffin et al., 2000
). The
explants include overlying pharyngeal endoderm and some foregut endoderm.
Explants were cultured at 23°C in either 2.5 mM DMSO, 500 µM NSC-87877
(Sigma), 50 µM SU5402 (Pfizer), 150 µM aphidicolin (Sigma), 20 mM
hydroxyurea (Sigma), or 50 µM colchicine (Sigma) in 1x MBS (Chemicon)
(Chen et al., 2006
;
Dasso and Newport, 1990
;
Harris and Hartenstein, 1991
;
Mason et al., 2002
). Explants
were cultured until specified stages and fixed for 2 hours in MEMFA at room
temperature.
Immunoblotting
To detect endogenous SHP-2, five embryos per condition were homogenized in
lysis buffer (100 mM NaCl, 20 mM NaF, 50 mM Tris pH 7.5, 10 mM sodium
pyrophosphate, 5 mM EDTA, 1% NP40 and 1% sodium deoxycholate) with the
addition of complete protease inhibitor cocktail (Roche) and PMSF (Sigma) and
processed according to standard protocols. In vitro translation of SHP-2 was
performed using wheatgerm TNT coupled transcription/translation (Promega)
according to the manufacturer's instructions.
Western blots were probed with anti-mouse total SHP-2 antibody PTP1D/SHP-2 (BD Transductions Laboratories) at 1:2500. Heart explant western blots were probed with antibodies against phospho-ERK1/2 and total ERK1/2, each used at 1:1000 (Cell Signaling). Whole heart immunoblots were prepared from 70 dissected hearts as described and probed with antibodies against total SHP-2. Calf intestinal phosphatase (CIP) treatment was carried out by incubating whole embryo lysate or heart lysate with 5 U of CIP, CIP buffer, and EDTA-free complete protease inhibitors at 37°C for 1.5 hours before western blot analysis. Loading levels of tissue were standardized in pilot runs of western blots assayed by densitometry.
Whole-mount antibody staining and in situ hybridization
Whole-mount antibody staining of whole embryos and explants were performed
as described (Kolker et al.,
2000
) with anti-tropomyosin (1:50; Developmental Studies Hybridoma
Bank), anti-myosin heavy chain (1:500 Abcam), and phosphohistone H3 (1:200
Upstate) to mark cells in M phase (Goetz
et al., 2006
) and visualized on a Leica MZFLIII microscope.
Immunostaining of histological sections was performed according to protocols
and procedures described previously (Goetz
et al., 2006
). For these studies, phospho-SHP-2 (Tyr542; Cell
Signaling) and phospho-SHP-2 (Tyr580; Cell Signaling) were used at 1:1000.
Whole-mount in situ hybridizations were performed with Nkx2.5
(Tonissen et al., 1994
),
Tbx5 (Brown et al.,
2003
; Horb and Thomsen,
1999
), Tbx20 (Brown et
al., 2003
), Gata4
(Jiang and Evans, 1996
),
Gata5 (Jiang and Evans,
1996
), Gata6 (Gove et
al., 1997
), MLC1v' (IMAGE clone 4408657, GenBank
accession no. BG884964), Sox2 (Lu
et al., 2004
), Endocut
(Costa et al., 2003
),
Ami (Inui and Asashima,
2006
), Xmsr [Xenopus EST clone XL327k24ex
(Mills et al., 1999
)] and
Shp-1 (IMAGE clone 5513271, GenBank accession no. BC09538), using
protocols as previously described
(Harland, 1991
). In situ
hybridization of sectioned Xenopus hearts was performed on 14 µm
cryostat sections using DIG-labeled antisense RNA probes followed by enzymatic
detection according to the manufacturer's protocols (Roche). The following
probes were used: Shp-2 (cloned from stage 19-26 X. laevis
pCS2+ cDNA library) using a forward Shp-2 primer sequence of
CGCCCTAAAGAATCGCAC and a reverse Shp-2 primer sequence of
ACACTGTAGAGATGAAGATGCCTC resulting in a 1.8 kb insert, Shp-1 (IMAGE
clone 5513271, GenBank accession no. BC09538) and Tbx20
(Brown et al., 2003
). Embryos
were cleared using 2:1 benzyl benzoate:benzyl alcohol.
Whole-mount TUNEL staining
Apoptotic cells were detected by TUNEL staining as previously described
(Hensey and Gautier, 1998
),
with the chromogenic detection of DIG-dUTP incorporation carried out with BCIP
(175 µg/ml, Roche) and nitro blue tetrazolium (337 µg/ml, Roche).
Immunoprecipitation
For immunoprecipitations from hearts, embryos were injected, as described
above, with 2 ng HA-tagged full-length Shp-2 RNA. One thousand four
hundred hearts were dissected at stage 35 and homogenized in lysis buffer [50
mM Tris 7.6, 150 mM NaCl, 10 mM EDTA, 1% Surfact-Amps Triton-100, 25 mM PMSF
supplemented with complete protease inhibitor mini tablet (Roche)].
Supernatants were pre-cleared with protein A/G beads for 2 hours at 4°C.
HA beads (20 µl; Covance) or Shp-2 agarose beads (30 µl; Santa
Cruz Biotechnology) was added to the supernatant and rotated overnight at
4°C. Immunoblotting was performed using anti-HA (Covance) at 1:1000,
anti-FRS-2 (Santa Cruz) at 1:200, anti-SHP-2 (BD Transduction Labs) at 1:2500
and anti-phospho Y-542 SHP-2 (Cell Signaling) at 1:1000. For
immunoprecipitations from explants, endogenous SHP-2 was immunoprecipitated
from 100 explants per condition, and immunoprecipitations were carried out as
described above.
| RESULTS |
|---|
|
|
|---|
Having established that SHP-2 is expressed in early embryos, we next tested
the requirement for SHP-2 in early heart development. To bypass the early
embryonic requirement for SHP-2, we used a cardiac explant assay. Based on
anatomical and gene expression studies in Xenopus, at late
neurulation (stage 22) the cardiac precursors exist in two cell populations,
which lie directly posterior to the cement gland along the anterior-ventral
aspects of the embryo (Dale and Slack,
1987
; Moody, 1987
;
Raffin et al., 2000
;
Sater and Jacobson, 1989
).
When dissected and cultured in isolation, this tissue forms a ridge of cardiac
tissue on top of developing endoderm (stages 22-33) and will eventually form a
beating heart (stage 33/34), whereas the donor embryo completely lacks any
cardiac tissue (Xenopus can develop to late tadpole stage in the
absence of a functioning heart or circulation). We have carried out an
extensive analysis of these explants using early, mid- and late molecular
markers of heart tissue and show that the explants display a temporal and
spatial expression of cardiac genes that faithfully recapitulates that of
control (unmanipulated) embryos (Fig.
1A,B). Therefore, the use of explants for studying the requirement
for SHP-2 allows us to bypass secondary morphogenesis and tissue interactions
that may complicate the analysis of the role of SHP-2 in early heart
development. To determine the requirement for SHP-2 in developing heart
tissue, explants were treated with DMSO or the SHP-2-specific inhibitor
NSC-87877 (Chen et al., 2006
).
We observed a dramatic downregulation of myosin heavy chain (MHC) expression
in NSC-87877-treated explants compared with controls, suggesting that SHP-2 is
required for the maintenance of MHC expression
(Fig. 1C).
|
SHP-2 signaling is required for the maintenance of cardiac progenitors
As we observed that SHP-2 is required for MHC expression in cardiac tissue,
we addressed whether this effect is specific for MHC or reflects a general
requirement for SHP-2 signaling in heart development. To establish the role of
SHP-2 in heart development and to determine how rapidly SHP-2 inhibition
effects cardiac gene expression, we assayed cardiac explants for expression of
Nkx2.5, Tbx5, Tbx20 and the cardiac differentiation marker
MLC1v' at time points corresponding to: stage 22, the stage
when the cardiac precursors are two distinct lateral populations of cells;
stage 26, the period when the two cardiac precursors populations are
positioned at the anterior, ventral region of embryo flanking the midline;
stage 29, when the cardiac fields fuse across the ventral midline; and stage
33, when the bilaminar heart tube initiates cardiac looping. These studies
show that there is a progressive loss of all three early markers with
increasing length of SHP-2 inhibition. We observed that controls and tissue
treated for 1 hour were indistinguishable at stage 22
(Fig. 2A-C); however, by early
tailbud stage (St. 26), cardiac precursors in treated explants remained in two
bilateral populations, whereas the cardiac precursors in controls had migrated
toward the midline (Fig. 2A-C).
At stage 29, when the hearts in control explants had formed a linear heart
tube, the cardiac fields in SHP-2 inhibited explants remained unfused and
displayed reduced expression of Nkx2.5, Tbx5 and Tbx20.
Similarly, at stage 33, Nkx2.5, Tbx5 and Tbx20 expression
appeared to continue to be restricted to a subset of tissue at the leading
edge of the cardiac field or was absent entirely. The expression of the
cardiac differentiation marker MLC1v' was never initiated in
SHP-2-inhibited explants (Fig.
2D). Thus overall there appears to be a progressive and rapid loss
of early cardiac marker expression in SHP-2-inhibited explants and markers of
cardiac differentiation fail to be expressed
(Fig. 2A-D). We did note,
however, that cardiac cells at the leading edge continued to express
Tbx5 until at least stage 33 (Fig.
2B, arrows), suggesting that in these cells Tbx5
expression is regulated in an SHP-2-independent fashion.
|
As NSC-87877 cannot be absorbed by whole Xenopus embryos, to determine whether the effects we observe with our tissue culture explants is reflective of a requirement for SHP-2 in developing embryos we cultured the anterior third of stage 22 embryos in media containing NSC-87877 at the same dose used in our explant studies. Identical to the cardiac explants, treatment with NSC-87877 specifically inhibited expression of Nkx2.5 in the developing heart but had no effects on its expression in the developing pharyngeal endoderm (Fig. 2F). Collectively, these results suggest that SHP-2 is required to maintain the expression of early cardiac markers in most of the cardiac field and for the onset of cardiac differentiation.
|
Inhibition of SHP-2 results in a progressive increase in cardiac cell death
To determine whether the loss of cardiac tissue in response to SHP-2
inhibition is due to defects in cardiac cell survival or proliferation, we
repeated our analysis examining programmed cell death in control explants and
explants in which SHP-2 signaling was inhibited. Explants were again treated
with the SHP-2 inhibitor beginning at stage 22, and then analyzed at stages
22, 26, 29 and 33. TUNEL staining of cardiac explants revealed that at stage
22 there is no apparent difference in cardiac cell death in the ridge of
mesodermal tissue, which contained the cardiac tissue in both control and
SHP-2-inhibited explants (Fig.
4); however, by stage 26 we began to detect an increase in
TUNEL-positive cells in SHP-2-inhibited cardiac tissue
(Fig. 4). By stages 29 and 33,
the number of apoptotic cells in the SHP-2-inhibited explants had further
expanded in the more lateral regions of the cardiac ridge
(Fig. 4). To further ensure
that the cells undergoing programmed cell death were cardiac cells, we
performed double in situ-TUNEL staining on cardiac explants in which SHP-2 was
inhibited. Results from these studies show that the cells undergoing
programmed cell death were adjacent to those expressing TBX5, which was only
expressed in the cardiac tissue in the explants
(Fig. 4). Therefore, in the
absence of SHP-2 signaling, cardiac cells cease development and undergo
programmed cell death initiated by stage 26.
|
|
|
Our results demonstrate that SHP-2 signaling is required during late
neurula stages, a period when increasing numbers of cardiomyocytes begin to
exit the cell cycle and undergo terminal differentiation
(Goetz et al., 2006
). To
further examine the correlation between the requirement for SHP-2 and cell
cycle exit, we analyzed cardiac cell proliferation and terminal
differentiation between stages 33 and adult. Taken together with our past
studies (Goetz et al., 2006
),
these results demonstrate that there is a gradual reduction in cycling
cardiomyocytes during early and mid-tadpole stages and that proliferation
persists in terminally differentiated cardiomyocytes until late tadpole stage
(Fig. 6B).
To directly determine whether SHP-2 signaling is required for the maintenance of proliferating cardiac cells, we inhibited SHP-2 signaling, beginning at a stage when there are two populations of cardiomyocytes [one that is undergoing active division and a second that has exited the cycle and undergone terminal differentiation (stage 29)] and allowed the explants to mature to stage 37. Results from these studies show that SHP-2 is required at this later stage; inhibited explants had a mitotic index that was approximately half that of control explants (Fig. 6C,D), suggesting that SHP-2 signaling is required for the maintenance and survival of proliferating cardiac cells.
SHP-2 functions downstream of the FGF pathway to regulate cardiac cell survival
The phosphorylation state of SHP-2 has been demonstrated to be reflective
of its function within a specific receptor tyrosine kinase (RTK) pathway (e.g.
Bjorbaek et al., 2001
). For
example, SHP-2 has been shown to be phosphorylated on tyrosine residues 542
and 580 in response to FGF or PDGF stimulation but not EGF stimulation
(Araki et al., 2004
). To
determine the phosphorylation state of SHP-2 in heart tissue in vivo, we
immunoprecipitated SHP-2 from embryonic and adult hearts and performed western
blots with a phospho-Y542 SHP-2 antibody. Results show that SHP-2 was
phosphorylated at residue Y542 in cardiac tissue during the same period when
SHP-2 functions to maintain cardiac cell survival
(Fig. 7B;
Fig. 6). Consistent with these
results, immunohistochemistry shows that both phospho-Y542 SHP-2 and
phospho-Y580 SHP-2 were expressed in the developing myocardium
(Fig. 7A). Collectively these
results demonstrate that SHP-2 is present in its phosphorylated state in
developing myocardial tissue, and therefore most likely acting within the FGF
and/or PDGF pathways.
|
As the decrease in Nkx2.5 expression in SHP-2-inhibited explants
is similar to that reported in embryos that genetically lack Fgf8
(Ilagan et al., 2006
) or those
in which the endoderm adjacent to the cardiac mesoderm has been surgically
removed (Alsan and Schultheiss,
2002
), and as we observe phosphorylation of SHP-2 on tyrosine
residues 542 and 580 and direct association of SHP-2 with FRS in embryonic
heart tissue, we reasoned that FGF acts through SHP-2 to maintain the cardiac
lineage. To investigate this possibility, we tested the effects of inhibiting
FGF signaling in cardiac explants. Results from these assays show that similar
to SHP-2 inhibition, treatment of cardiac explants with the FGFR inhibitor
SU5402 led to a decrease in expression of early and late cardiac markers
(Fig. 8A). However, we note
that in contrast to SHP-2 inhibition, FGF inhibition led to a reduction but
not loss of Tbx5 (Fig.
8A,B). Consistent with the weaker Tbx5 phenotype, we
observed the persistence of the SHP-2-FRS interaction and a reduction but not
loss of phospho-Y542 SHP-2 in FGF-inhibited explants
(Fig. 8E). Taken together,
these results imply that SHP-2 functions in both the FGF pathway and an
additional unidentified SHP-2-FRS pathway in the developing heart.
To determine if SHP-2 functions within the FGF pathway to maintain survival of proliferating cardiomyocytes, we first determined whether the alteration in cardiac gene in response to FGF inhibition expression temporally mimics that seen with SHP-2 inhibition. As observed with SHP-2 inhibition, the cardiac explants responded to FGF inhibition between stages 22 and 26 (data not shown) and western blots of cardiac explants lacking SHP-2 activity or FGF signaling showed a dramatic decrease in phospho-ERK (threefold or more in response to inhibition as assayed by densitometry; Fig. 8C,D). Consistent with SHP-2 acting downstream of FGF, injection of a constitutively active SHP-2 (N308D) in FGFR-inhibited explants rescued expression of the early heart markers Nkx2.5 and resulted in full expression of Tbx5 (Fig. 8B). Taken together these studies demonstrate that SHP-2 functions in the FGF pathway to regulate cardiac progenitor survival.
| DISCUSSION |
|---|
|
|
|---|
SHP-2 and cardiac cell cycle
The time at which SHP-2 is required for the maintenance of cardiac
progenitor cells corresponds with a period of rapid cardiac proliferation
(Fishman and Chien, 1997
;
Goetz and Conlon, 2007
;
Goetz et al., 2006
;
Pasumarthi and Field, 2002
).
In many tissues, such as muscle and nerves, the withdrawal of cells from the
cell cycle is tightly associated with the onset of terminal differentiation
(Alexiades and Cepko, 1996
;
Dyer and Cepko, 2001
;
Lathrop et al., 1985
;
Li and Vaessin, 2000
;
Walsh and Perlman, 1997
). By
contrast, relatively little is known about the relationship between the cell
cycle progression and terminal differentiation in the heart.
|
Coinciding with programmed cell death, we also observe that blocking SHP-2
activity leads to a failure of early cardiac cells to fuse at the ventral
midline. At present we cannot distinguish between a role for SHP-2 mediating a
trophic factor response and/or a role for SHP-2 in cell adhesion. However,
genetic studies in zebrafish and mouse strongly imply that the inability of
the cardiac fields to fuse is not the primary cause of the downregulation of
early cardiac markers or the failure of SHP-2 inhibited explants to initiate
cardiac differentiation. For example, genetic mutations resulting in cardiac
bifida, such as gata5, hand2, casanova (sox32 - ZFIN),
bonnie and clyde and miles apart (edg5 - ZFIN) in
zebrafish (Alexander et al.,
1999
; Kupperman et al.,
2000
; Reiter et al.,
1999
) or Gata4 and Mesp1
(Molkentin et al., 1997
;
Saga et al., 1999
) in mouse,
as well as genetic mutations in cardiac cell adhesion proteins
(Trinh and Stainier, 2004
),
show no alteration in the expression of early cardiac markers such as
Nkx2.5 or of markers associated with terminal differentiation.
Therefore, it is most likely that the failure of cardiac cells to migrate is a
secondary consequence of cell survival or it may be that SHP-2 has two
temporally distinct roles in heart development, in regulating cell adhesion
and in cell survival.
SHP-2 and the FGF pathway
In this study we show that SHP-2 is phosphorylated on tyrosines 542 and 580
in the embryonic heart and that it co-immunoprecipitates with FRS-2,
demonstrating an in vivo interaction between SHP-2 and FRS-2 for the first
time. Given that we have shown inhibitors of both SHP-2 and FGFR to cause
comparable cardiac phenotypes, and that a constitutively active form of SHP-2
can rescue formation of cardiac tissue in FGF-inhibited explants, we conclude
that SHP-2 participates in the FGF signal transduction pathway in
Xenopus embryonic hearts.
Recent work examining the role of FGFs in response to cardiac damage or
injury lends further support for the direct role of SHP-2 in cardiac cell
survival. The overexpression of both FGF-1 and FGF-2 have been shown to
promote the survival of adult cardiomyocytes in response to ischemic injury in
vivo (House et al., 2005
;
Jiang et al., 2002
;
Jiang et al., 2004
;
Palmen et al., 2004
), and the
cardioprotective effects of FGF-2 in the adult myocardium are mediated through
the MAPK pathway (House et al.,
2005
), the same branch of the FGFR signaling cascade that we have
shown in cardiac tissue functions through SHP-2. Interestingly, the specific
function of FGF-2 in preventing programmed cell death in response to ischemic
insult was shown to be independent of its mitogenic or angiogenic functions,
suggesting that FGF-2 is functioning specifically to promote cardiomyocyte
cell survival (Jiang et al.,
2004
). Together with our data showing that SHP-2 activity
downstream of FGFR is required for the maintenance of proliferating cardiac
progenitor cells, these data suggest that the FGF/MAPK pathway functions in
promoting cardiac progenitor cell survival during development and further
suggests that the FGF/SHP-2/MAPK pathway must be maintained to promote
survival of cardiac progenitor cells in vitro. Intriguingly, the FGF/SHP-2
pathway has also recently been shown to be required for the survival of
trophectoderm stem cells and for the ability of hematopoitetic stem cells to
self-renew (Chan et al., 2006
;
Yang et al., 2006
), thus
raising the possibility that the FGF/SHP-2 pathway is a common pathway for
progenitor cell survival.
What are the mechanisms by which SHP-2 acts to activate the MAPK pathway
and promote cell survival? Studies have shown that SHP-2 acts as a positive
regulator in the FGF pathway in at least two ways, the first by acting as a
scaffold to recruit GRB2, which in turn recruits SOS, the guanine nucleotide
exchange factor for RAS, this leads to the activation of the ERK cascade,
potentially resulting in the destabilization of the pro-apoptotic protein BIM
(Yang et al., 2006
).
Alternatively, or concomitantly, SHP-2 may act as a positive regulator in RAS
signaling by inhibiting Sprouty, a key FGF/RTK inhibitor
(Christofori, 2003
;
Kim and Bar-Sagi, 2004
;
Tsang and Dawid, 2004
).
Consistent with the later possibility, Sprouty has recently been shown to be a
direct substrate of SHP-2, and studies have shown that one of the four
mammalian sproutys, Sprouty 1, is expressed in the heart and is upregulated
upon cardiac insult (Hanafusa et al.,
2004
; Huebert et al.,
2004
; Jarvis et al.,
2006
). However, it remains unknown if any of the Sprouty family
has an endogenous role in early heart development or, if like in
Drosophila, Sprouty acts as an endogenous substrate of SHP-2 in vivo
(Jarvis et al., 2006
).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/22/4119/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D. Y. (1999). casanova plays an early and essential role in endoderm formation in zebrafish. Dev. Biol. 215,343 -357.[CrossRef][Medline]
Alexiades, M. R. and Cepko, C. (1996). Quantitative analysis of proliferation and cell cycle length during development of the rat retina. Dev. Dyn. 205,293 -307.[CrossRef][Medline]
Allanson, J. (2002). The first Noonan syndrome gene: PTPN11, which encodes the protein tyrosine phosphatase SHP-2. Pediatr. Res. 52,471 .[Medline]
Alsan, B. H. and Schultheiss, T. M. (2002). Regulation of avian cardiogenesis by Fgf8 signaling. Development 129,1935 -1943.[Medline]
Araki, T., Mohi, M. G., Ismat, F. A., Bronson, R. T., Williams, I. R., Kutok, J. L., Yang, W., Pao, L. I., Gilliland, D. G., Epstein, J. A. et al. (2004). Mouse model of Noonan syndrome reveals cell type- and gene dosage-dependent effects of Ptpn11 mutation. Nat. Med. 10,849 -857.[CrossRef][Medline]
Bjorbaek, C., Buchholz, R. M., Davis, S. M., Bates, S. H.,
Pierroz, D. D., Gu, H., Neel, B. G., Myers, M. G., Jr and Flier, J. S.
(2001). Divergent roles of SHP-2 in ERK activation by leptin
receptors. J. Biol. Chem.
276,4747
-4755.
Brown, D. D., Binder, O., Pagratis, M., Parr, B. A. and Conlon, F. L. (2003). Developmental expression of the Xenopus laevis Tbx20 orthologue. Dev. Genes Evol. 212,604 -607.[Medline]
Brown, D. D., Martz, S. N., Binder, O., Goetz, S. C., Price, B.
M. J., Smith, J. C. and Conlon, F. L. (2005). Tbx5 and Tbx20
act synergistically to control vertebrate heart morphogenesis.
Development 132,553
-563.
Brown, D. D., Christine, K. S., Showell, C. and Conlon, F. L. (2007). The small heat shock protein Hsp27 is required for proper heart tube formation. Genesis (in press).
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F., Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C. E. et al. (2001). A murine model of holt-oram syndrome defines roles of the T-Box transcription factor Tbx5 in cardiogenesis and disease. Cell 106,709 -721.[CrossRef][Medline]
Cai, C. L., Zhou, W., Yang, L., Bu, L., Qyang, Y., Zhang, X.,
Li, X., Rosenfeld, M. G., Chen, J. and Evans, S. (2005).
T-box genes coordinate regional rates of proliferation and regional
specification during cardiogenesis. Development
132,2475
-2487.
Chan, R. J., Li, Y., Hass, M. N., Walter, A., Voorhorst, C. S., Shelley, W. C., Yang, Z., Orschell, C. M. and Yoder, M. C. (2006). Shp-2 heterozygous hematopoietic stem cells have deficient repopulating ability due to diminished self-renewal. Exp. Hematol. 34,1230 -1239.[Medline]
Chen, L., Sung, S. S., Yip, M. L., Lawrence, H. R., Ren, Y.,
Guida, W. C., Sebti, S. M., Lawrence, N. J. and Wu, J.
(2006). Discovery of a novel shp2 protein tyrosine phosphatase
inhibitor. Mol. Pharmacol.
70,562
-570.
Christofori, G. (2003). Split personalities: the agonistic antagonist Sprouty. Nat. Cell Biol. 5, 377-379.[CrossRef][Medline]
Costa, R. M., Mason, J., Lee, M., Amaya, E. and Zorn, A. M. (2003). Novel gene expression domains reveal early patterning of the Xenopus endoderm. Gene Expr. Patterns 3, 509-519.[CrossRef][Medline]
Dale, L. and Slack, J. M. (1987). Fate map for
the 32-cell stage of Xenopus laevis. Development
99,527
-551.
Dasso, M. and Newport, J. W. (1990). Completion of DNA replication is monitored by a feedback system that controls the initiation of mitosis in vitro: studies in Xenopus. Cell 61,811 -823.[CrossRef][Medline]
Dehaan, R. L. (1963). Migration patterns of the precardiac mesoderm in the early chick embryo. Exp. Cell Res. 29,544 -560.[CrossRef][Medline]
Delahaye, L., Rocchi, S. and Van Obberghen, E.
(2000). Potential involvement of FRS2 in insulin signaling.
Endocrinology 141,621
-628.
Dyer, M. A. and Cepko, C. L. (2001). Regulating proliferation during retinal development. Nat. Rev. Neurosci. 2,333 -342.[Medline]
Feng, G. S. (1999). Shp-2 tyrosine phosphatase: signaling one cell or many. Exp. Cell Res. 253, 47-54.[CrossRef][Medline]
Fishman, M. C. and Chien, K. R. (1997). Fashioning the vertebrate heart: earliest embryonic decisions. Development 124,2099 -2117.[Abstract]
Georgescu, M. M., Kirsch, K. H., Kaloudis, P., Yang, H.,
Pavletich, N. P. and Hanafusa, H. (2000). Stabilization and
productive positioning roles of the C2 domain of PTEN tumor suppressor.
Cancer Res. 60,7033
-7038.
Goetz, S. and Conlon, F. L. (2007). Cardiac progenitors and the embryonic cell cycle. Cell Cycle 6,1974 -1981.[Medline]
Goetz, S. C., Brown, D. D. and Conlon, F. L.
(2006). TBX5 is required for embryonic cardiac cell cycle
progression. Development
133,2575
-2584.
Gove, C., Walmsley, M., Nijjar, S., Bertwistle, D., Guille, M., Partington, G., Bomford, A. and Patient, R. (1997). Over-expression of GATA-6 in Xenopus embryos blocks differentiation of heart precursors. EMBO J. 16,355 -368.[CrossRef][Medline]
Grossel, M. J. and Hinds, P. W. (2006). From cell cycle to differentiation: an expanding role for cdk6. Cell Cycle 5,266 -270.[Medline]
Guillemot, L., Levy, A., Zhao, Z. J., Bereziat, G. and Rothhut,
B. (2000). The protein-tyrosine phosphatase SHP-2 is required
during angiotensin II-mediated activation of cyclin D1 promoter in CHO-AT1A
cells. J. Biol. Chem.
275,26349
-26358.
Hanafusa, H., Torii, S., Yasunaga, T., Matsumoto, K. and
Nishida, E. (2004). Shp2, an SH2-containing protein-tyrosine
phosphatase, positively regulates receptor tyrosine kinase signaling by
dephosphorylating and inactivating the inhibitor Sprouty. J. Biol.
Chem. 279,22992
-22995.
Harland, R. M. (1991). In situ hybridization: an improved whole mount method for Xenopus embryos. Methods Cell Biol. 36,675 -685.[Medline]
Harris, W. A. and Hartenstein, V. (1991). Neuronal determination without cell division in Xenopus embryos. Neuron 6,499 -515.[CrossRef][Medline]
Harvey, R. P., Lai, D., Elliott, D., Biben, C., Solloway, M., Prall, O., Stennard, F., Schindeler, A., Groves, N., Lavulo, L. et al. (2002). Homeodomain factor Nkx2-5 in heart development and disease. Cold Spring Harb. Symp. Quant. Biol. 67,107 -114.[CrossRef][Medline]
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Horb, M. E. and Thomsen, G. H. (1999). Tbx5 is essential for heart development. Development 126,1739 -1751.[Abstract]
House, S. L., Branch, K., Newman, G., Doetschman, T. and
Schultz, J. E. J. (2005). Cardioprotection induced by
cardiac-specific overexpression of fibroblast growth factor-2 is mediated by
the MAPK cascade. Am. J. Physiol. Heart Circ. Physiol.
289,H2167
-H2175.
Huebert, R. C., Li, Q., Adhikari, N., Charles, N. J., Han, X.,
Ezzat, M. K., Grindle, S., Park, S., Ormaza, S., Fermin, D. et al.
(2004). Identification and regulation of Sprouty1, a negative
inhibitor of the ERK cascade, in the human heart. Physiol.
Genomics 18,284
-289.
Ilagan, R., Abu-Issa, R., Brown, D., Yang, Y. P., Jiao, K.,
Schwartz, R. J., Klingensmith, J. and Meyers, E. N. (2006).
Fgf8 is required for anterior heart field development.
Development 133,2435
-2445.
Inui, M. and Asashima, M. (2006). A novel gene, Ami is expressed in vascular tissue in Xenopus laevis. Gene Expr. Patterns 6,613 -619.[CrossRef][Medline]
Jarvis, L. A., Toering, S. J., Simon, M. A., Krasnow, M. A. and
Smith-Bolton, R. K. (2006). Sprouty proteins are in vivo
targets of Corkscrew/SHP-2 tyrosine phosphatases.
Development 133,1133
-1142.
Jiang, Y. and Evans, T. (1996). The Xenopus GATA-4/5/6 genes are associated with cardiac specification and can regulate cardiac-specific transcription during embryogenesis. Dev. Biol. 174,258 -270.[CrossRef][Medline]
Jiang, Z. S., Padua, R. R., Ju, H., Doble, B. W., Jin, Y., Hao,
J., Cattini, P. A., Dixon, I. M. and Kardami, E. (2002).
Acute protection of ischemic heart by FGF-2: involvement of FGF-2 receptors
and protein kinase C. Am. J. Physiol. Heart Circ.
Physiol. 282,H1071
-H1080.
Jiang, Z. S., Srisakuldee, W., Soulet, F., Bouche, G. and
Kardami, E. (2004). Non-angiogenic FGF-2 protects the
ischemic heart from injury, in the presence or absence of reperfusion.
Cardiovasc. Res. 62,154
-166.
Kattman, S. J., Huber, T. L. and Keller, G. M. (2006). Multipotent flk-1+ cardiovascular progenitor cells give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages. Dev. Cell 11,723 -732.[CrossRef][Medline]
Kim, H. J. and Bar-Sagi, D. (2004). Modulation of signalling by Sprouty: a developing story. Nat. Rev. Mol. Cell Biol. 5,441 -450.[CrossRef][Medline]
Kolker, S., Tajchman, U. and Weeks, D. L. (2000). Confocal Imaging of early heat development in Xenopus laevis. Dev. Biol. 218,64 -73.[CrossRef][Medline]
Kouhara, H., Hadari, Y. R., Spivak-Kroizman, T., Schilling, J., Bar-Sagi, D., Lax, I. and Schlessinger, J. (1997). A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89,693 -702.[CrossRef][Medline]
Kouskoff, V., Lacaud, G., Schwantz, S., Fehling, H. J. and
Keller, G. (2005). Sequential development of hematopoietic
and cardiac mesoderm during embryonic stem cell differentiation.
Proc. Natl. Acad. Sci. USA
102,13170
-13175.
Kupperman, E., An, S., Osborne, N., Waldron, S. and Stainier, D. Y. (2000). A sphingosine-1-phosphate receptor regulates cell migration during vertebrate heart development. Nature 406,192 -195.[CrossRef][Medline]
Lathrop, B., Thomas, K. and Glaser, L. (1985).
Control of myogenic differentiation by fibroblast growth factor is mediated by
position in the G1 phase of the cell cycle. J. Cell
Biol. 101,2194
-2198.
Li, L. and Vaessin, H. (2000). Pan-neural
Prospero terminates cell proliferation during Drosophila neurogenesis.
Genes Dev. 14,147
-151.
Lu, X., Borchers, A. G., Jolicoeur, C., Rayburn, H., Baker, J. C. and Tessier-Lavigne, M. (2004). PTK7/CCK-4 is a novel regulator of planar cell polarity in vertebrates. Nature 430,93 -98.[CrossRef][Medline]
Lyons, I., Parsons, L. M., Hartley, L., Li, R., Andrews, J. E.,
Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenic
defects in the heart tubes of murine embryos lacking the homeo box gene
Nkx-2.5. Genes Dev. 9,1654
-1666.
Maheshwari, M., Belmont, J., Fernbach, S., Ho, T., Molinari, L., Yakub, I., Yu, F., Combes, A., Towbin, J., Craigen, W. J. et al. (2002). PTPN11 mutations in Noonan syndrome type I: detection of recurrent mutations in exons 3 and 13. Hum. Mutat. 20,298 -304.[CrossRef][Medline]
Mason, H. S., Latten, M. J., Godoy, L. D., Horowitz, B. and
Kenyon, J. L. (2002). Modulation of Kv1.5 currents by protein
kinase A, tyrosine kinase, and protein tyrosine phosphatase requires an intact
cytoskeleton. Mol. Pharmacol.
61,285
-293.
Mills, K. R., Kruep, D. and Saha, M. S. (1999). Elucidating the origins of the vascular system: a fate map of the vascular endothelial and red blood cell lineages in Xenopus laevis. Dev. Biol. 209,352 -368.[CrossRef][Medline]
Molkentin, J. D., Lin, Q., Duncan, S. A. and Olson, E. N.
(1997). Requirement of the transcription factor GATA4 for heart
tube formation and ventral morphogenesis. Genes Dev.
11,1061
-1072.
Moody, S. A. (1987). Fates of the blastomeres of the 32-cell-stage Xenopus embryo. Dev. Biol. 122,300 -319.[CrossRef][Medline]
Moretti, A., Caron, L., Nakano, A., Lam, J. T., Bernshausen, A., Chen, Y., Qyang, Y., Bu, L., Sasaki, M., Martin-Puig, S. et al. (2006). Multipotent embryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial cell diversification. Cell 127,1151 -1165.[CrossRef][Medline]
Nguyen, L., Besson, A., Roberts, J. M. and Guillemot, F. (2006). Coupling cell cycle exit, neuronal differentiation and migration in cortical neurogenesis. Cell Cycle 5,2314 -2318.[Medline]
Nieuwkoop, P. D. and Faber, J. (1975). Normal Table of Xenopus laevis (Daudin). Amsterdam: North Holland.
Noonan, J. and O'Connor, W. (1996). Noonan syndrome: a clinical description emphasizing the cardiac findings. Acta Paediatr. Jpn. 38,76 -83.[Medline]
Palmen, M., Daemen, M. J., De Windt, L. J., Willems, J., Dassen,
W. R., Heeneman, S., Zimmermann, R., Van Bilsen, M. and Doevendans, P. A.
(2004). Fibroblast growth factor-1 improves cardiac functional
recovery and enhances cell survival after ischemia and reperfusion: a
fibroblast growth factor receptor, protein kinase C, and tyrosine
kinase-dependent mechanism. J. Am. Coll. Cardiol.
44,1113
-1123.
Parmacek, M. S. and Epstein, J. A. (2005). Pursuing cardiac progenitors: regeneration redux. Cell 120,295 -298.[CrossRef][Medline]
Pasumarthi, K. B. and Field, L. J. (2002).
Cardiomyocyte cell cycle regulation. Circ. Res.
90,1044
-1054.
Pawson, T. (1994). Tyrosine kinase signalling pathways. Princess Takamatsu Symp. 24,303 -322.[Medline]
Qu, C. K. (2000). The SHP-2 tyrosine phosphatase: signaling mechanisms and biological functions. Cell Res. 10,279 -288.[CrossRef][Medline]
Raffin, M., Leong, L. M., Rones, M. S., Sparrow, D., Mohun, T. and Mercola, M. (2000). Subdivision of the cardiac Nkx2.5 expression domain into myogenic and nonmyogenic compartments. Dev. Biol. 218,326 -340.[CrossRef][Medline]
Reiter, J. F., Alexander, J., Rodaway, A., Yelon, D., Patient,
R., Holder, N. and Stainier, D. Y. (1999). Gata5 is required
for the development of the heart and endoderm in zebrafish. Genes
Dev. 13,2983
-2995.
Saga, Y., Miyagawa-Tomita, S., Takagi, A., Kitajima, S., Miyazaki, J. and Inoue, T. (1999). MesP1 is expressed in the heart precursor cells and required for the formation of a single heart tube. Development 126,3437 -3447.[Abstract]
Sater, A. K. and Jacobson, A. G. (1989). The
specification of heart mesoderm occurs during gastrulation in Xenopus laevis.
Development 105,821
-830.
Schollen, E., Matthijs, G., Gewillig, M., Fryns, J. P. and Legius, E. (2003). PTPN11 mutation in a large family with Noonan syndrome and dizygous twinning. Eur. J. Hum. Genet. 11,85 -88.[CrossRef][Medline]
Singh, M. K., Christoffels, V. M., Dias, J. M., Trowe, M. O.,
Petry, M., Schuster-Gossler, K., Burger, A., Ericson, J. and Kispert, A.
(2005). Tbx20 is essential for cardiac chamber differentiation
and repression of Tbx2. Development
132,2697
-2707.
Smith, J. C. and Slack, J. M. W. (1983). Dorsalization and neural induction: properties of the organizer in Xenopus laevis. J. Embryol. Exp. Morphol. 78,299 -317.
Srivastava, D. (2006). Making or breaking the heart: from lineage determination to morphogenesis. Cell 126,1037 -1048.[CrossRef][Medline]
Stennard, F. A., Costa, M. W., Lai, D., Biben, C., Furtado, M.
B., Solloway, M. J., McCulley, D. J., Leimena, C., Preis, J. I., Dunwoodie, S.
L. et al. (2005). Murine T-box transcription factor Tbx20
acts as a repressor during heart development, and is essential for adult heart
integrity, function and adaptation. Development
132,2451
-2462.
Takeuchi, J. K., Mileikovskaia, M., Koshiba-Takeuchi, K., Heidt,
A. B., Mori, A. D., Arruda, E. P., Gertsenstein, M., Georges, R., Davidson,
L., Mo, R. et al. (2005). Tbx20 dose-dependently regulates
transcription factor networks required for mouse heart and motoneuron
development. Development
132,2463
-2474.
Tang, T. L., Freeman, R. M., Jr, O'Reilly, A. M., Neel, B. G. and Sokol, S. Y. (1995). The SH2-containing protein-tyrosine phosphatase SH-PTP2 is required upstream of MAP kinase for early Xenopus development. Cell 80,473 -483.[CrossRef][Medline]
Tartaglia, M., Mehler, E. L., Goldberg, R., Zampino, G., Brunner, H. G., Kremer, H., van der Burgt, I., Crosby, A. H., Ion, A., Jeffery, S. et al. (2001). Mutations in PTPN11, encoding the protein tyrosine phosphatase SHP-2, cause Noonan syndrome. Nat. Genet. 29,465 -468.[CrossRef][Medline]
Tartaglia, M., Kalidas, K., Shaw, A., Song, X., Musat, D. L., van der Burgt, I., Brunner, H. G., Bertola, D. R., Crosby, A., Ion, A. et al. (2002). PTPN11 mutations in Noonan syndrome: molecular spectrum, genotype-phenotype correlation, and phenotypic heterogeneity. Am. J. Hum. Genet. 70,1555 -1563.[CrossRef][Medline]
Tonissen, K. F., Drysdale, T. A., Lints, T. J., Harvey, R. P. and Krieg, P. A. (1994). XNkx-2.5, a Xenopus gene related to Nkx-2.5 and tinman: evidence for a conserved role in cardiac development. Dev. Biol. 162,325 -328.[CrossRef][Medline]
Trinh, L. A. and Stainier, D. Y. (2004). Fibronectin regulates epithelial organization during myocardial migration in zebrafish. Dev. Cell 6,371 -382.[CrossRef][Medline]
Tsang, M. and Dawid, I. B. (2004). Promotion
and attenuation of FGF signaling through the Ras-MAPK pathway. Sci.
STKE 2004,pe17
.
van den Hoff, M. J., Kruithof, B. P. and Moorman, A. F. (2004). Making more heart muscle. BioEssays 26,248 -261.[CrossRef][Medline]
Van Vactor, D., O'Reilly, A. M. and Neel, B. G. (1998). Genetic analysis of protein tyrosine phosphatases. Curr. Opin. Genet. Dev. 8, 112-126.[CrossRef][Medline]
Vernon, A. E. and Philpott, A. (2003). A single
cdk inhibitor, p27Xic1, functions beyond cell cycle regulation to promote
muscle differentiation in Xenopus. Development
130, 71-83.
Walsh, K. and Perlman, H. (1997). Cell cycle exit upon myogenic differentiation. Curr. Opin. Genet. Dev. 7,597 -602.[CrossRef][Medline]
Warkman, A. S. and Krieg, P. A. (2007). Xenopus as a model system for vertebrate heart development. Semin. Cell Dev. Biol. 18,46 -53.[CrossRef][Medline]
Wu, S. M., Fujiwara, Y., Cibulsky, S. M., Clapham, D. E., Lien, C. L., Schultheiss, T. M. and Orkin, S. H. (2006). Developmental origin of a bipotential myocardial and smooth muscle cell precursor in the mammalian heart. Cell 127,1137 -1150.[CrossRef][Medline]
Yang, W., Klaman, L. D., Chen, B., Araki, T., Harada, H., Thomas, S. M., George, E. L. and Neel, B. G. (2006). An Shp2/SFK/Ras/Erk signaling pathway controls trophoblast stem cell survival. Dev. Cell 10,317 -327.[CrossRef][Medline]
Yuan, L., Yu, W. M. and Qu, C. K. (2003). DNA
damage-induced G2/M checkpoint in SV40 large T antigen-immortalized embryonic
fibroblast cells requires SHP-2 tyrosine phosphatase. J. Biol.
Chem. 278,42812
-42820.
Yuan, L., Yu, W. M., Xu, M. and Qu, C. K.
(2005). SHP-2 phosphatase regulates DNA damage-induced apoptosis
and G2/M arrest in catalytically dependent and independent manners,
respectively. J. Biol. Chem.
280,42701
-42706.
Zhang, J., Somani, A. K. and Siminovitch, K. A. (2000). Roles of the SHP-1 tyrosine phosphatase in the negative regulation of cell signalling. Semin. Immunol. 12,361 -378.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||