|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 31 October 2007
doi: 10.1242/dev.010934
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular Biology, University of Copenhagen, Ole Maaløes
Vej 5, DK-2200 Copenhagen N, Denmark.
2 Department of Molecular Biology and Biochemistry, Rutgers University, Waksman
Institute, 190 Frelinghuysen Rd, Piscataway, NJ 08854-8020, USA.
3 Cell Biology and Metabolism Branch, NICHD, NIH, Bldg. 1, 8T, 18 Library Drive,
Bethesda, MD 20892, USA.
* Author for correspondence (e-mail: rdelotto{at}my.molbio.ku.dk)
Accepted 5 September 2007
| SUMMARY |
|---|
|
|
|---|
B/REL family transcription factor,
Dorsal, redistributes from the cytoplasm to nuclei, forming a concentration
gradient across the dorsoventral axis of the embryo. Using live imaging
techniques in conjunction with embryos expressing a chimeric Dorsal-GFP, we
demonstrate that the redistribution of Dorsal from cytoplasm to nucleus is an
extremely dynamic process. Nuclear Dorsal concentration changes continuously
over time in all nuclei during interphase. While Dorsal appears to be
nuclearly localized primarily in ventral nuclei, it is actively shuttling into
and out of all nuclei, including nuclei on the dorsal side. Nuclear export is
blocked by leptomycin B, a potent inhibitor of Exportin 1 (CRM1)-mediated
nuclear export. We have developed a novel in vivo assay revealing the presence
of a functional leucine-rich nuclear export signal within the carboxyterminal
44 amino acids of Dorsal. We also find that diffusion of Dorsal is partially
constrained to cytoplasmic islands surrounding individual syncitial nuclei. A
model is proposed in which the generation and maintenance of the Dorsal
gradient is a consequence of an active process involving both restricted
long-range diffusion and the balancing of nuclear import with nuclear
export.
Key words: NF-
B, Gradient formation, Transcription factor dynamics, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
B plays a pivotal regulatory role in an
ever increasing number of important biological processes, including adaptive
and innate immunity, apoptosis, inflammation, cell fate determination during
development and cancer (Li and Stark,
2002
B is
typically found in the cytoplasm in a 2:1 complex with its binding partner
I-
B. The paradigm for NF-
B nuclear translocation argues that
signal-dependent phosphorylation, ubiquitination and proteosome-mediated
degradation of I-
B frees NF-
B from cytoplasmic anchoring,
allowing it to translocate to the nucleus
(Baeuerle and Baltimore, 1988
B binding sites and either upregulate or
downregulate appropriate sets of target genes
(Pierce et al., 1988
B is thought to be the rate-limiting event
determining nuclear uptake, one would expect that NF-
B nuclear
translocation should be a relatively irreversible process. Indeed, most of the
published biochemical and immunohistochemical data have been interpreted in
accordance with this conventional view
(Rothwarf and Karin, 1999
A classical model system mediated by NF-
B is dorsoventral (DV)
patterning in the early D. melanogaster embryo
(Moussian and Roth, 2005
). In
syncytial blastoderm embryos, in response to an extracellular signal, the
NF-
B transcriptional regulator, Dorsal, forms a ventral-to-dorsal
concentration gradient, with high levels in ventral nuclei and progressively
lower levels in more dorsolateral nuclei
(Roth et al., 1989
;
Rushlow et al., 1989
;
Steward, 1989
;
Steward et al., 1988
).
Globally, nuclear Dorsal concentrations determine dorsal/ventral cell fates by
either upregulating or downregulating the transcription of the zygotic target
genes twist, snail, rhomboid and zerknullt, thus specifying
relative DV position (Stathopoulos and
Levine, 2002
). The graded distribution of Dorsal among nuclei is
most readily observed at nuclear cycle 14, during the period of time in which
cellularization occurs. However, Dorsal already functions as a transcriptional
regulator earlier at the syncytial blastoderm stage. For example, Dorsal
transcriptionally regulates the expression of snail at nuclear cycle
11 and later (Alberga et al.,
1991
). Immunohistochemical staining shows that as early as nuclear
cycle 10, when nuclei arrive at the surface of the embryo, Dorsal is
distributed in a characteristic gradient, with high concentrations in ventral
nuclei and an apparent absence from dorsal nuclei
(Roth et al., 1989
;
Steward, 1989
). From nuclear
cycle 10 to 14, syncytial blastoderm nuclei undergo four complete mitotic
divisions within a shared cytoplasm before cellularization occurs
(Foe and Alberts, 1983
).
We wished to study the dynamics of Dorsal redistribution and gradient formation within the early embryo. To do so, we utilized real-time live imaging of embryos expressing a fully functional form of Dorsal fused to the green fluorescent protein (GFP). We find that nuclear Dorsal concentrations are almost constantly changing and that the gradient completely breaks down and reforms with each mitotic division. Before reappearance of the gradient, we observe a transient accumulation of Dorsal in particles near the ventral, but not the dorsal, plasma membrane. Surprisingly, during interphase, when the Dorsal gradient appears to be relatively stable, Dorsal is dynamically shuttling into and out of nuclei. We demonstrate that Dorsal nuclear export is blocked by leptomycin B (LMB), a potent inhibitor of CRM1-mediated nuclear export and identify a region containing a leucine-rich nuclear export signal (LRNES). Lastly, we show that Dorsal is not distributed uniformly within the cytoplasm as previously thought from antibody stainings of fixed embryos but instead is partially compartmentalized into cytoplasmic domains associated with individual syncitial nuclei. We propose a model for Dorsal redistribution between the cytoplasm and nucleus in which the redistribution of Dorsal is an active process and the function of the ventralizing signal is to alter the balance between nuclear import and nuclear export.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Microscopy and imaging
Confocal microscopy was conducted on a Zeiss 510 Confocor 2 microscope
using the 488 nm Argon laser line with a Zeiss 63x and 40x
C-Apochromat water immersion objectives as previously described
(Frescas et al., 2006
). Data
for Fig. 3 were quantified on
Zeiss Confocor microscopy software release 2.8, while data for
Fig. 1C were quantified using
NIH Image. Files were converted to TIFF format and Quicktime movies generated
using Adobe ImageReady 7.0. The high-resolution Quicktime movies are available
at
http://www.imbf.ku.dk/DeLotto_Lab/.
Cell culture and nuclear export assays
For leptomycin B treatment, two protocols were used interchangeably.
Embryos were dechorionized, permeabilized by rinsing in Isopropanol for 3
seconds and Hexane for 5 seconds. Residual heptane was allowed to evaporate
off and embryos were immediately immersed in phosphate-buffered saline (PBS).
Under these conditions development proceeded normally for at least 4 hours in
PBS. Leptomycin B (LMB) (a kind gift of Mary Dasso, NIH, Bethesda, MD) was
added to the PBS at a final concentration of 10 µg/ml by dilution from a 10
mg/ml stock in Ethanol. Alternatively LMB was microinjected as a 1 mg/ml stock
in 90% DMSO/10% ethanol. Anti-Twist stainings were conducted as previously
described (Smith and DeLotto,
1994
).
In vivo nuclear export assays were conducted as follows. Tandem GFP
constructs were generated using the following oligonucleotides: DG1,
AGTCATATAAGCGGCCGCTAACCACCATGGTGAGCAAGGGCGAG GAG; DG2,
GATCCATAGCGAATTCTCCACCACCTCCCTTGTACAGCTCGTCCATGCC; DG3,
CGATCGCTGGAATTCAATAATGGGCCAACGCTCAGC; DG4,
GTACAGCTCTCTAGATTACGTGGATATGGACAGGTTCGATATCTGCAGATCTTCCGAATTGAGGCGCAG; and
DG7, GTACAGCTCTCTAGATTACTTGTACAGCTCGTC CATGCC. Two GFP constructs were made by
digesting pUASP with NotI and XbaI and inserting the
NotI + XbaI-digested product of a PCR reaction using DG1 and
DG7 on pMTNES+ (a gift of Janny L. Sørensen, Department of Molecular
Biology, University of Copenhagen, Denmark) DG1 and DG2 were used in PCR with
pMTNES+ to generate a dual GFP fragment, which was digested with NotI
and EcoRI. DG3 and DG4 were used in PCR with embryonic
dorsal cDNA and cut with EcoRI and XbaI. The two
fragments were ligated into NotI + XbaI-digested pUASP
(Rorth, 1998
).
w1118 flies were transformed by P-element-mediated
germline transformation using standard methods
(Rubin and Spradling,
1982
).
| RESULTS |
|---|
|
|
|---|
Wide-field fluorescence quantification over successive nuclear cycles
indicated that the total Dorsal-GFP fluorescence in embryos did not
dramatically change between interphase and mitosis (data not shown). This
observation was inconsistent with the idea that the cyclic appearance of the
gradient was caused by cycles of protein degradation and re-synthesis. Rather,
it is more consistent with the idea that the gradient is generated by cycles
of redistribution of Dorsal between the nuclear and cytoplasmic compartments.
The timing of the loss of Dorsal from nuclei just before mitosis suggested
that the integrity of the nuclear envelope is essential to maintenance of
differential nuclear concentrations, as nuclear envelopes are known to become
leaky at the beginning of mitosis due to nuclear pore breakdown
(Kiseleva et al., 2001
).
|
Dorsal redistributes between cytoplasmic, plasma membrane and nuclear pools during nuclear division cycles
To examine local changes in the Dorsal distribution surrounding nuclei, we
imaged a lateral section of the embryo at a zone of intermediate nuclear
Dorsal concentration. As shown in Fig.
2A, during interphase, Dorsal-GFP was depleted from dorsolateral
nuclei and enriched in ventrolateral nuclei, with a middle transition zone
where nuclear levels match cytoplasmic levels
(Fig. 2A, interphase). Loss of
the gradient occurred in two stages. First, Dorsal-GFP levels dropped in
ventral nuclei and levels increased in dorsal nuclei, giving rise to an
equivalent, low level of Dorsal within all nuclei
(Fig. 2A, early prophase).
Then, Dorsal-GFP equilibrated between the dividing nuclei and the cytoplasm,
resulting in a near uniform distribution late in mitosis
(Fig. 2B, late mitosis).
Because the level of nuclear fluorescence in both dorsal and ventral nuclei
became equivalent at the start of mitosis and lowered in dorsal nuclei during
interphase, the data suggested that during interphase an export mechanism
might be necessary to reduce nuclear Dorsal levels in dorsal nuclei to levels
below that of the surrounding cytoplasm.
To study the reappearance of the gradient, we viewed the cytoplasm just
beneath the plasma membrane on the ventral side of the embryo. The diffuse
cytoplasmic distribution of Dorsal-GFP observed in mitosis
(Fig. 2B, late mitosis) changed
as soon as cells entered interphase. In ventral nuclei, Dorsal-GFP first
accumulated throughout the nucleoplasm
(Fig. 2B, mid-interphase), but
later could be seen highlighting condensed chromosomes
(Fig. 2D). In control
experiments in which recombinant tetrameric dsRED was microinjected into
embryos, dsRED was excluded from the condensed chromosomes (data not shown).
This suggests a form of interaction between Dorsal and the chromatin. More
interestingly, before reappearing in ventral nuclei, Dorsal-GFP was
transiently observed in a particulate distribution at or near the plasma
membrane (Fig. 2B, see arrow),
which in a confocal surface view could be seen at the hexagonal borders of
cytoplasmic domains defined by dividing nuclei
(Fig. 2C, VENTRAL).
Significantly, this particulate distribution was observed only on ventral and
ventrolateral plasma membrane, where substantial levels of Dorsal accumulate
in nuclei, and was never observed on the dorsal side of the embryo
(Fig. 2C, DORSAL). Given that
Dorsal has been demonstrated to form a biochemical complex with Cactus, Tube
and Pelle, and this complex is likely to be recruited to activated Toll
receptors present only on the ventral and ventrolateral plasma membrane
(Towb et al., 1998
;
Yang and Steward, 1997
), the
particulate distribution of Dorsal-GFP could correspond to Dorsal transiently
binding to activated Toll receptor complexes.
Dorsal is highly mobile within nuclei and is shuttling into and out of syncitial nuclei throughout the embryo
We performed quantitative photobleaching experiments to study the binding,
diffusion and transport properties of Dorsal during syncytial and cellular
blastoderm stages. Photobleaching of a small spot considerably less than the
diameter of a ventral nucleus for 3 seconds, caused all nuclear Dorsal-GFP
fluorescence to drop to cytoplasmic background level (see
Fig. 3A,B). This indicated that
most of the Dorsal protein within nuclei is not avidly bound to DNA, as a pool
of unbleached molecules outside the bleached spot would otherwise have been
observed. The highly structured appearance of Dorsal-GFP observed in high
resolution images of ventral nuclei (Fig.
2D), therefore, represents a dynamic state of Dorsal binding to
and dissociating from chromatin, as has been reported for other nuclear
proteins (Handwerger et al.,
2003
; Phair and Misteli,
2001
).
|
Based upon numerous antibody stainings of fixed embryos, it has been
generally argued that Dorsal is excluded from nuclei on the dorsal side of the
embryo (Roth et al., 1989
;
Rushlow et al., 1989
;
Steward, 1989
). To test
whether Dorsal is excluded from dorsal nuclei, we performed photobleaching
experiments. If Dorsal is present within dorsal nuclei, fluorescence intensity
within the nucleus would be expected to be measurably reduced after
photobleaching. As shown in Fig.
3B, upon photobleaching a small spot within a nucleus on the
extreme dorsal side for 3 seconds, the fluorescence intensity of Dorsal-GFP
within the nucleus was reduced, indicating that Dorsal is present within
dorsal nuclei. Over time, normalized fluorescence in the bleached nucleus
recovered to about 80% of the level observed in surrounding nuclei before
entry into mitosis (Fig. 3D).
This indicated that Dorsal was also shuttling into and out of dorsal nuclei,
as we have previously shown for ventral nuclei. Similar photobleachings of
many ventral (n=14), dorsal (n=12) and lateral
(n=6) nuclei revealed that Dorsal shuttles into and out of nuclei at
all positions within the embryo (data not shown).
To confirm that Dorsal is being exported from nuclei, we selectively
inhibited nuclear export using LMB (Fukuda
et al., 1997
). Embryos at the beginning of nuclear cycle 14 were
treated with LMB and Dorsal-GFP was imaged up until gastrulation. During
cellularization in untreated control embryos, Dorsal-GFP fluorescence never
accumulated to high levels within dorsal and dorsolateral nuclei
(Fig. 4A). By contrast, upon
treatment with LMB, fluorescence dramatically increased in dorsal and lateral
nuclei (Fig. 4B), and persisted
well into the start of gastrulation (Fig.
4D), a time when wild-type Dorsal protein begins to disappear
(Fig. 4C). These results
provide independent evidence for nucleocytoplasmic shuttling and indicate that
the export process is CRM1-mediated.
|
Dorsal contains a functional LRNES near its carboxyterminus
As CRM1-mediated nuclear export is conducted via an LRNES, we examined the
amino acid sequence of Dorsal for matches to the LRNES consensus
(la Cour et al., 2004
). We
found several potential LRNESs clustered between amino acids 644 and 678 near
the carboxyterminus. Because of the loose concensus for LRNESs, a number of
alignments were possible. In Fig.
4F, we have illustrated two of several possible alignments within
this region. To determine whether this region contains a functional nuclear
export signal, we developed a native in vivo assay. We constructed
P-element-mediated transformed fly lines expressing either tandem GFP
(2xGFP) or tandem GFP with amino acids 635-678 of Dorsal
(2xGFP-DLC) under the control of the GAL4 UAS
(Fig. 4G). These transgenic
lines were crossed to a nanos-GAL4 driver line and embryos were imaged to
determine the localization of 2xGFP and 2xGFP-DLC. While the
molecular weight of tandem GFP (58 kD) should not permit it to enter nuclei
during interphase, it does enter nuclei and become trapped during each
mitosis. In the absence of an export signal, 2xGFP remains within nuclei
at levels slightly higher than in the surrounding cytoplasm
(Fig. 4H). The distribution
mirrors that observed for microinjected recombinant GFP in embryos (data not
shown). By contrast, 2xGFP-DLC also enters and is trapped within nuclei
after mitosis; however, it is cleared from nuclei during interphase
(Fig. 4I). This indicates that
the carboxyterminal 44 amino acids of Dorsal are sufficient to mediate
selective nuclear export in embryos during cellular blastoderm. A further
characterization of the precise structure of the LRNES is currently
underway.
Dorsal does not freely diffuse throughout the cytoplasm but partitions into cytoplasmic domains surrounding individual syncitial nuclei
It has been commonly argued that Dorsal is distributed uniformly within the
cytoplasm of the syncitial and blastoderm embryo
(Roth et al., 1989
;
Rushlow et al., 1989
;
Steward et al., 1988
). Our
observation of nucleocytoplasmic shuttling prompted us to address the question
of how freely Dorsal moves within the cytoplasm surrounding syncytial nuclei.
If Dorsal diffuses freely within the cytoplasm, because of nucleocytoplasmic
shuttling, repetitive photobleaching of a small spot in the cytoplasm should
cause neighboring nuclei to be relatively equally reduced in their nuclear
fluorescence intensities. Surprisingly, when we performed FLIP (fluorescence
loss in photobleaching) upon a small spot of ventral cytoplasm
(Fig. 5A), we found that
several adjacent nuclei underwent only modest reductions in nuclear
fluorescence, whereas one nearby nucleus showed a particularly dramatic
reduction in fluorescence. This suggested that the cytoplasm surrounding
individual nuclei may be partially compartmentalized with respect to the
diffusion of Dorsal. We therefore more closely examined the dorsal side of the
embryo and observed a structure to the distribution of Dorsal-GFP in regions
surrounding each nucleus (Fig.
5B-D). While part of this structure may be trivially explained by
infoldings of the plasma membrane, the pseudocleavage furrows, Dorsal-free
areas often extended somewhat deeper than the pseudocleavage furrows, as shown
by larger gaps (see Fig. 5B,C).
To determine whether the diffusion of Dorsal is constrained by these domains,
we photobleached a spot overlapping both the nucleus and the cytoplasm of one
of these domains during mitosis (Fig.
5E). We observed that the cytoplasmic domain surrounding one
nucleus was selectively darkened, indicating a form of cytoplasmic
compartmentalization that persisted even throughout mitosis. However, as a
substantial amount of the fluorescence rapidly recovered within 37.5 seconds,
significant exchange between these domains and some other pool of Dorsal must
also occur.
|
|
| DISCUSSION |
|---|
|
|
|---|
Before the reappearance of Dorsal within ventral nuclei, Dorsal transiently
appears in a particulate distribution at the plasma membrane surface. This
distribution is similar to that observed for the Toll receptor
(Hashimoto et al., 1991
) (and
our unpublished observations). It has been previously demonstrated that Dorsal
and Cactus form a biochemical complex with Toll
(Yang and Steward, 1997
). The
transient appearance of Dorsal near the plasma membrane might result from
stalling at activated Toll receptor due to a delay in the re-establishment of
functional nuclear pore complexes at the completion of mitosis.
Data from a number of published studies suggest that the regulation of
Dorsal is a more complex process than release from cytoplasmic anchoring via
its I-
B partner, Cactus. For example, Dorsal still differentially
translocates from cytoplasm to nuclei and can form a gradient in embryos that
are completely lacking its I-
B partner, Cactus
(Bergmann et al., 1996
;
Reach et al., 1996
;
Roth et al., 1991
). This
result has been explained by postulating the existence of another, as yet
unidentified, I-
B partner that partially complements Cactus function
(Reach et al., 1996
). An
alternative explanation is that Cactus is not the sole determinant of Dorsal
nuclear translocation and at least another parallel input is required. Several
studies have shown that the phosphorylation of Dorsal is required for Dorsal
to appear within the nucleus (Drier et
al., 2000
; Drier et al.,
1999
; Gillespie and Wasserman,
1994
). Two parallel intracellular signals have been suggested to
direct nuclear translocation; the first, Cactus phosphorylation and
degradation, and the second, Dorsal phosphorylation. Interestingly, Dorsal
phosphorylation is absolutely required for redistribution from cytoplasm to
nucleus, while the Cactus-dependent part of the pathway is not essential to
nuclear entry (Bergmann et al.,
1996
; Drier et al.,
2000
; Drier et al.,
1999
).
Our data reveal that Dorsal is in a dynamic equilibrium continuously
shuttling between the cytoplasm and the nucleus during syncitial and cellular
blastoderm stages whenever a graded distribution is observed. In light of our
data and the studies cited above, we propose a dynamic model for Dorsal
nuclear redistribution (see Fig.
6). In the model, Dorsal bound to Cactus is recruited to a
signaling complex at the plasma membrane by activated Toll receptors
(Yang and Steward, 1997
).
There, both Dorsal and Cactus are phosphorylated
(Drier et al., 1999
).
Phosphorylated Dorsal is released from the complex and enters the nucleus,
where it moves between the nucleoplasm and binds nonspecifically to chromatin.
Within the nucleus, Dorsal is dephosphorylated and then exported back to the
cytoplasm by the CRM1-dependent nuclear export pathway. Once in the cytoplasm
Dorsal associates with de novo synthesized Cactus, again forming a complex,
repeating the cycle. Our model is similar to one that has been proposed for
the SMADs, which mediate TGF-ß signaling
(Nicolas et al., 2004
). In the
case of the SMADs, a nuclear phosphatase has been demonstrated to exist;
however, the specific enzyme has not yet been identified.
Our model departs from previous ones in that it places Dorsal in an active
exchange between cytoplasm and nucleus. It also puts greater emphasis on
phosphorylation of Dorsal with Cactus phosphorylation and degradation,
providing a modulating effect upon the equilibrium. Interaction of Dorsal with
Cactus might reduce the efficiency of Dorsal phosphorylation or locally slow
the movement of Dorsal within the cytoplasm. In ventral regions of the
cytoplasm more Cactus is phosphorylated and ultimately degraded, resulting in
an inverse cytoplasmic gradient of Cactus
(Bergmann et al., 1996
;
Reach et al., 1996
).
The accumulation of Dorsal in dorsal nuclei upon LMB treatment indicates
that CRM1-mediated nuclear export plays an important role in determining
nuclear Dorsal concentration. It has been generally accepted that it is the
nuclear import of Dorsal that is regulated
(Morisato and Anderson, 1995
).
Our results raise the question of whether import alone, export alone or both
import and export are regulated. The independent measurement of nuclear import
and export rates will be necessary to answer this question. It will be
interesting to determine whether some components of the pathway specifically
alter the dynamic equilibrium via the export process. For example, although it
has been argued that Tamo downregulates nuclear import, Tamo may alternatively
function by increasing the nuclear export rate
(Minakhina et al., 2003
).
The partial compartmentalization of the cytoplasm surrounding each nucleus provides an interesting mechanism for isolation of the signaling environment between each individual nucleus within the common cytoplasm of the syncitial embryo. Dorsal protein would be expected to cycle primarily in the vicinity of each nucleus and only exchange more slowly with pools associated with neighboring nuclei. In this way, different nuclei could sample the ventralizing signal and maintain unique nuclear Dorsal levels independently of one another. This compartmentalization property might be common to components of other signalling pathways in the embryo and contribute to the transcriptional isolation of each nucleus, something that has been observed but for which no mechanism is known to exist.
Our results demonstrate that the redistribution of Dorsal from the
cytoplasm to the nucleus is a dynamic process rather than a singular
unidirectional event. While nucleocytoplasmic shuttling has been described for
a number of transcription factors, our results extend the process to the
formation of a developmental gradient during embryogenesis. Dynamic shuttling
provides for exquisite control to the regulation of nuclear levels of
transcription factors, allowing nuclei to rapidly adapt to changing levels of
signal input or to integrate the effects of other signaling pathways, which
crosstalk with the primary one. In the case of Dorsal, shuttling provides a
mechanism for maintenance of the gradient through four mitotic divisions and
may provide a mechanism for the terminal pathway to downregulate nuclear
Dorsal levels in the anterior and posterior of the embryo
(Rusch and Levine, 1994
).
Nucleocytoplasmic shuttling may be a general property of all NF-
B
transcription factors, as our data are consistent with reports of
nucleocytoplasmic shuttling of NF-
B in mammalian cells
(Birbach et al., 2004
;
Birbach et al., 2002
;
Carlotti et al., 2000
). In
mammalian cells, nucleocytoplasmic shuttling could provide the ability to
rapidly modulate NF-
B levels with fluctuations in cytokine levels. In
Drosophila embryogenesis it may be central to the mechanism by which
the Dorsal gradient is formed and maintained.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alberga, A., Boulay, J. L., Kempe, E., Dennefeld, C. and
Haenlin, M. (1991). The snail gene required for mesoderm
formation in Drosophila is expressed dynamically in derivatives of all three
germ layers. Development
111,983
-992.
Baeuerle, P. A. and Baltimore, D. (1988). Activation of DNA-binding activity in an apparently cytoplasmic precursor of the NF-kappa B transcription factor. Cell 53,211 -217.[CrossRef][Medline]
Baeuerle, P. A. and Baltimore, D. (1989). A
65-kappaD subunit of active NF-kappaB is required for inhibition of NF-kappaB
by I kappaB. Genes Dev.
3,1689
-1698.
Bergmann, A., Stein, D., Geisler, R., Hagenmaier, S., Schmid, B., Fernandez, N., Schnell, B. and Nusslein-Volhard, C. (1996). A gradient of cytoplasmic Cactus degradation establishes the nuclear localization gradient of the dorsal morphogen in Drosophila. Mech. Dev. 60,109 -123.[CrossRef][Medline]
Birbach, A., Gold, P., Binder, B. R., Hofer, E., de Martin, R.
and Schmid, J. A. (2002). Signaling molecules of the NF-kappa
B pathway shuttle constitutively between cytoplasm and nucleus. J.
Biol. Chem. 277,10842
-10851.
Birbach, A., Bailey, S. T., Ghosh, S. and Schmid, J. A.
(2004). Cytosolic, nuclear and nucleolar localization signals
determine subcellular distribution and activity of the NF-kappaB inducing
kinase NIK. J. Cell Sci.
117,3615
-3624.
Carlotti, F., Dower, S. K. and Qwarnstrom, E. E.
(2000). Dynamic shuttling of nuclear factor kappa B between the
nucleus and cytoplasm as a consequence of inhibitor dissociation.
J. Biol. Chem. 275,41028
-41034.
DeLotto, R. (2001). Gastrulation defective, a complement factor C2/B-like protease, interprets a ventral prepattern in Drosophila. EMBO Rep. 2,721 -726.[CrossRef][Medline]
Drier, E. A., Huang, L. H. and Steward, R.
(1999). Nuclear import of the Drosophila Rel protein Dorsal is
regulated by phosphorylation. Genes Dev.
13,556
-568.
Drier, E. A., Govind, S. and Steward, R. (2000). Cactus-independent regulation of Dorsal nuclear import by the ventral signal. Curr. Biol. 10, 23-26.[CrossRef][Medline]
Foe, V. E. and Alberts, B. M. (1983). Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J. Cell Sci. 61,31 -70.[Abstract]
Foe, V. E., Field, C. M. and Odell, G. M. (2000). Microtubules and mitotic cycle phase modulate spatiotemporal distributions of F-actin and myosin II in Drosophila syncytial blastoderm embryos. Development 127,1767 -1787.[Abstract]
Frescas, D., Mavrakis, M., Lorenz, H., Delotto, R. and
Lippincott-Schwartz, J. (2006). The secretory membrane system
in the Drosophila syncytial blastoderm embryo exists as functionally
compartmentalized units around individual nuclei. J. Cell
Biol. 173,219
-230.
Fuchs, J. P., Giloh, H., Kuo, C. H., Saumweber, H. and Sedat, J. (1983). Nuclear structure: determination of the fate of the nuclear envelope in Drosophila during mitosis using monoclonal antibodies. J. Cell Sci. 64,331 -349.[Abstract]
Fukuda, M., Asano, S., Nakamura, T., Adachi, M., Yoshida, M., Yanagida, M. and Nishida, E. (1997). CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 390,308 -311.[CrossRef][Medline]
Ghosh, S. and Baltimore, D. (1990). Activation in vitro of NF-kappa B by phosphorylation of its inhibitor I kappa B. Nature 344,678 -682.[CrossRef][Medline]
Ghosh, S. and Karin, M. (2002). Missing pieces in the NF-kappaB puzzle. Cell 109,S81 -S96.[CrossRef][Medline]
Gillespie, S. K. and Wasserman, S. A. (1994).
Dorsal, a Drosophila Rel-like protein, is phosphorylated upon activation of
the transmembrane protein Toll. Mol. Cell. Biol.
14,3559
-3568.
Handwerger, K. E., Murphy, C. and Gall, J. G.
(2003). Steady-state dynamics of Cajal body components in the
Xenopus germinal vesicle. J. Cell Biol.
160,495
-504.
Hashimoto, C., Gerttula, S. and Anderson, K. V.
(1991). Plasma membrane localization of the Toll protein in the
syncytial Drosophila embryo: importance of transmembrane signaling for
dorsal-ventral pattern formation. Development
111,1021
-1028.
Kiseleva, E., Rutherford, S., Cotter, L. M., Allen, T. D. and Goldberg, M. W. (2001). Steps of nuclear pore complex disassembly and reassembly during mitosis in early Drosophila embryos. J. Cell Sci. 114,3607 -3618.[Medline]
la Cour, T., Kiemer, L., Molgaard, A., Gupta, R., Skriver, K.
and Brunak, S. (2004). Analysis and prediction of
leucine-rich nuclear export signals. Protein Eng. Des.
Sel. 17,527
-536.
Leptin, M. (1991). twist and snail as positive
and negative regulators during Drosophila mesoderm development.
Genes Dev. 5,1568
-1576.
Li, X. and Stark, G. R. (2002). NFkappaB-dependent signaling pathways. Exp. Hematol. 30,285 -296.[CrossRef][Medline]
Minakhina, S., Yang, J. and Steward, R. (2003). Tamo selectively modulates nuclear import in Drosophila. Genes Cells 8,299 -310.[Abstract]
Morisato, D. and Anderson, K. V. (1995). Signaling pathways that establish the dorsal-ventral pattern of the Drosophila embryo. Annu. Rev. Genet. 29,371 -399.[Medline]
Moussian, B. and Roth, S. (2005). Dorsoventral axis formation in the Drosophila embryo - shaping and transducing a morphogen gradient. Curr. Biol. 15,R887 -R899.[CrossRef][Medline]
Nicolas, F. J., De Bosscher, K., Schmierer, B. and Hill, C.
S. (2004). Analysis of Smad nucleocytoplasmic shuttling in
living cells. J. Cell Sci.
117,4113
-4125.
Phair, R. D. and Misteli, T. (2001). Kinetic modelling approaches to in vivo imaging. Nat. Rev. Mol. Cell Biol. 2,898 -907.[CrossRef][Medline]
Pierce, J. W., Lenardo, M. and Baltimore, D.
(1988). Oligonucleotide that binds nuclear factor NF-kappa B acts
as a lymphoid-specific and inducible enhancer element. Proc. Natl.
Acad. Sci. USA 85,1482
-1486.
Reach, M., Galindo, R. L., Towb, P., Allen, J. L., Karin, M. and Wasserman, S. A. (1996). A gradient of cactus protein degradation establishes dorsoventral polarity in the Drosophila embryo. Dev. Biol. 180,353 -364.[CrossRef][Medline]
Rorth, P. (1998). Gal4 in the Drosophila female germline. Mech. Dev. 78,113 -118.[CrossRef][Medline]
Roth, S., Stein, D. and Nusslein-Volhard, C. (1989). A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo. Cell 59,1189 -1202.[CrossRef][Medline]
Roth, S., Hiromi, Y., Godt, D. and Nusslein-Volhard, C. (1991). cactus, a maternal gene required for proper formation of the dorsoventral morphogen gradient in Drosophila embryos. Development 112,371 -388.[Abstract]
Rothwarf, D. M. and Karin, M. (1999). The NF-kappa B activation pathway: a paradigm in information transfer from membrane to nucleus. Sci. STKE 1999, RE1.[Medline]
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element vectors.
Science 218,348
-353.
Rusch, J. and Levine, M. (1994). Regulation of
the dorsal morphogen by the Toll and torso signaling pathways: a receptor
tyrosine kinase selectively masks transcriptional repression. Genes
Dev. 8,1247
-1257.
Rushlow, C. A., Han, K., Manley, J. L. and Levine, M. (1989). The graded distribution of the dorsal morphogen is initiated by selective nuclear transport in Drosophila. Cell 59,1165 -1177.[CrossRef][Medline]
Smith, C. L. and DeLotto, R. (1994). Ventralizing signal determined by protease activation in Drosophila embryogenesis. Nature 368,548 -551.[CrossRef][Medline]
Stathopoulos, A. and Levine, M. (2002). Dorsal gradient networks in the Drosophila embryo. Dev. Biol. 246, 57-67.[CrossRef][Medline]
Steward, R. (1989). Relocalization of the dorsal protein from the cytoplasm to the nucleus correlates with its function. Cell 59,1179 -1188.[CrossRef][Medline]
Steward, R., Zusman, S. B., Huang, L. H. and Schedl, P. (1988). The dorsal protein is distributed in a gradient in early Drosophila embryos. Cell 55,487 -495.[CrossRef][Medline]
Towb, P., Galindo, R. L. and Wasserman, S. A. (1998). Recruitment of Tube and Pelle to signaling sites at the surface of the Drosophila embryo. Development 125,2443 -2450.[Abstract]
Yang, J. and Steward, R. (1997). A multimeric
complex and the nuclear targeting of the Drosophila Rel protein Dorsal.
Proc. Natl. Acad. Sci. USA
94,14524
-14529.
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||