|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 31 October 2007
doi: 10.1242/dev.005942
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular Embryology, German Cancer Research Center, Im
Neuenheimer Feld 581, 69120 Heidelberg, Germany.
2 Department of Anatomy and Developmental Biology, University College London,
Gower Street, London WC1E 6BT, UK.
* Author for correspondence (e-mail: niehrs{at}dkfz-heidelberg.de)
Accepted 4 September 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Dkk, Kremen, LRP6, Mesd, Slug, Sox10, Wnt, Xenopus
| INTRODUCTION |
|---|
|
|
|---|
LRP5/6 proteins are essential components for Wnt/ß-catenin signal
transduction, and their inactivation phenocopies loss of Wnt signaling in
vertebrates and invertebrates (Pinson et
al., 2000
; Tamai et al.,
2000
; Wehrli et al.,
2000
). LRP5/6 proteins are members of the low-density lipoprotein
receptor family (LDLR), transmembrane receptors characterized by an
extracellular domain containing LDLR repeats and YWTD ß-propeller/EGF
modules (He et al., 2004
). The
YWTD ß-propeller/EGF modules are cysteine-rich domains of around 35 kDa,
which require specific folding and maturation assistance in the endoplasmic
reticulum (ER), mediated by the chaperone Mesd
(Culi and Mann, 2003
;
Hsieh et al., 2003
;
Culi et al., 2004
). Mesd is a
resident protein of the ER that binds to and promotes cell surface
localization of LRP5/6 by reducing receptor aggregation
(Hsieh et al., 2003
).
Wnt/LRP5/6 signaling is antagonized by Dickkopf (Dkk) proteins, which bind
and inhibit LRP5/6 (Bafico et al.,
2001
; Mao et al.,
2001
; Semenov et al.,
2001
). During early vertebrate development, Dkk1 is expressed in
anterior endomesoderm and plays an important role in AP patterning by
inhibiting Wnt/LRP6 signaling in the head organizer and prechordal plate
(Glinka et al., 1998
;
Hashimoto et al., 2000
;
Shinya et al., 2000
;
Mukhopadhyay et al.,
2001
).
Other Dkk receptors are the transmembrane proteins Kremen1 and 2 (Krm1 and
2, collectively termed Krms). Dkk1 forms a ternary complex with Krm1 or 2 and
LRP6, which is cleared from the cell surface, thereby shutting down Wnt signal
transduction (Mao et al.,
2002
). Krms are evolutionary conserved in vertebrates and are
differentially expressed during embryonic development in mouse and frog
(Nakamura et al., 2001
;
Davidson et al., 2002
). In
Xenopus, Krms and Dkk1 are co-expressed in the prechordal plate and
functionally cooperate in Wnt inhibition to regulate AP patterning of the
central nervous system (CNS) (Davidson et
al., 2002
). Recently, it was shown that Krm1 is required for
formation of thymic architecture in mice by acting as Wnt inhibitor
(Osada et al., 2006
).
While it is established that Krms and Dkk1 cooperate in Wnt inhibition
during Xenopus AP patterning, it is unknown whether Krms play other
roles during early development. In Xenopus embryos, krm2 is
expressed in various regions that do not overlap with dkk1 expression
domains (Davidson et al.,
2002
). We therefore investigated the possibility of
Dkk1-independent functions of Krm2.
Here we report that Krm2 plays a Dkk1-independent role in neural crest (NC) formation. Krm2 is positively regulated by zygotic Wnt signaling and is required for NC formation. We show that in the absence of Dkk1, Krms stimulate Wnt signaling and promote, via direct binding, cell-surface localization of LRP6. Furthermore, Krm2 knockdown specifically reduces LRP6 protein levels in NC cells. The results suggest that Krms act as inhibitor or activator of Wnt signaling, dependent on the presence or absence of Dkk, respectively.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In situ hybridization and RT-PCR
Whole-mount in situ hybridizations were carried out essentially as
described (Gawantka et al.,
1995
). For lineage tracing, lacZ mRNA (250 pg per
blastomere) was co-injected and ß-galactosidase staining was performed as
described (Sive et al., 2000
),
using blue (X-Gal) or red (Magenta-Gal) substrate. RT-PCR assays were carried
out in the exponential phase of amplification and with primers as described
[H4 (Niehrs et al.,
1994
); chordin (Sasai
et al., 1994
); XWnt8
(Christian et al., 1991
);
Xhox3 (Ruiz i Altaba and Melton,
1989
)]. Other primers were: Xenopus krm2 (forward,
GGAACCAGACCACACAGCACTTG; reverse, CCGCCTCCACACCTGCATACT) and Xenopus
brachyury (forward, CACAGTTCATAGCAGTGACCG; reverse,
TTCTGTGAGTGTACGGACTGG).
Morpholino antisense oligonucleotides
Krm2 MO-1 targeting the ATG start codon of Xkrm2 was as described
(Davidson et al., 2002
); Krm2
MO-2 [targets 5' untranslated region (UTR) of Xkrm2]:
ATCCTCACATGAAGACGTGCTGGAA; LRP6 MO [targets 5' UTR of X. laevis
(AF508961) and X. tropicalis (CX889920) LRP6]:
CCCCGGCTTCTCCGCTCCGACCCCT. Control morpholino: standard control morpholino
oligo designed by Gene Tools, LLC.
Explant immunostaining experiments
For neural crest immunostaining experiments, two-cell stage embryos were
injected with 7.5 and 12.5 ng CoMO or Krm2 MO-2, 0.2, 2 and 5 ng LRP6 MO, or
1.5, 3 and 5 ng Krm2 MO-1 per blastomere, respectively
(Fig. 7B). Anterior NC explants
were prepared from neurulae by peeling off the epidermal layer before
dissection with eyebrow knives. Immunostaining procedures were essentially
carried out as described (Unterseher et
al., 2004
), and embryos were mounted in Mowiol. Primary antibodies
used were rabbit anti-LRP6 T1479 (dilution 1: 50)
(Davidson et al., 2005
) and
mouse anti-ß1-integrin (dilution 1:10) (8C8, DSHB). Secondary antibodies
were goat anti-rabbit Alexa 488 and goat anti-mouse Alexa 546 (Molecular
Probes). Nuclei were counterstained with Hoechst. Explants were examined on a
confocal laser-scanning microscope (Nikon C1Si). For statistics, all images
were transformed into monochrome RGB images (red for Alexa 546, green for
Alexa 488, blue for Hoechst) and processed using ImageJ. For each neural crest
explant, fluorescence intensity was measured in red (R) and green (G) channels
at three random plasma membrane positions and averaged. The average R/G signal
intensity of all explants per sample was determined. LRP6 protein levels were
classified as unchanged when R/G <1.5, as moderately reduced (+) when
R/G=1.5-3, or as strongly reduced (++) when R/G >3.
Cell culture and luciferase reporter gene assays
HEK293T cells were maintained in DMEM supplemented with 1% L-Glutamine, 1%
PEN-STREP, and 10% FCS and grown at 10% CO2. Luciferase reporter
gene assays were carried out in triplicates in 96-well plates using Promega's
Dual-Luciferase Reporter Assay System as described
(Wu et al., 2000
). In all
experiments a total of 50 ng DNA per well was transfected; 1 ng
pCMV-SPORT6-mesd (mouse) or 5 ng pCS2-Xkrm1 DNA were used as
indicated. For Wnt reporter assays transfected DNAs per well were: 10 ng
TOPFLASH and 1 ng pTK-Renilla reporter plasmids; 12 ng
(Fig. 4B) or 24 ng
(Fig. 4A,D) human
LRP6; 2 ng mouse frizzled8 (fz8); 0.25 ng human
dishevelled1 (dvl1); 0.5 ng human
LRP6
E1-4 (Mao et
al., 2001
); 5 ng/3 ng mouse wnt1/human LRP6
(Fig. 4D); 0.5 ng
Xdkk1.
For BMP responsive reporter assays transfected DNAs per well were: 20 ng
BREx4-E1b-dLuc plasmid [modified from Hata et al.
(Hata et al., 2000
)] and 1 ng
pTK-Renilla; 10 ng pcDNA3.1-BMP4 as indicated.
After transfection, cells were grown for 48 hours, then lysed in 50 µl passive lysis buffer (Promega) per well. Luciferase activity was normalized against Renilla activity.
Co-immunoprecipitation assays, in vitro binding assays, Endoglycosidase H treatment and cell surface biotinylation
For co-immunoprecipitation (Co-IP) assays, HEK293T cells were transfected
in 10 cm plates with 0.1 µg pCS2-krm1-V5 or pCS2-krm2-V5
(both mouse) together with 1.5 µg pCS2-flag-LRP6, 0.1 µg
pCS2-flag-LDLR
C (both human), 0.5 µg
pCS2-flag-XFLRT3 (Xenopus fibronectin leucine-rich
transmembrane protein 3) or 1.5 µg empty vector pCS2 using Fugene6 (Roche).
After 48 hours, cells were washed in PBS and lysed in NP-40 buffer containing
150 mM NaCl, 50 mM Tris pH 7.4, 7.5% glycerol, 1 mM EDTA, 1 mM
ß-mercaptoethanol, 25 mM NaF, one protease inhibitor cocktail tablet/25
ml (Roche) and 0.8% NP-40. Lysates were subjected to Co-IP with anti-flag
antibody beads (Sigma) overnight at 4°C. Co-IPs were washed with NP-40
buffer and analyzed by SDS-PAGE and western blotting.
In vitro binding assays were carried out essentially as described
(Cruciat et al., 2006
).
Recombinant proteins were produced as conditioned media by transient
transfection of HEK293T cells with pCS2-krm1
TMC-V5,
pCS2-krm2
TMC-V5, pCS2-V5-dkk3 (all mouse) or
pCS2-myc-LRP6
TMC (human) in serum-free media (Optimem
I, Gibco). Media were concentrated about 50-fold using Centricon Plus-20
filters (Millipore). Equal amounts of V5-tagged proteins were resuspended in
NP-40 buffer containing 0.2% (w/v) NP-40 and incubated with anti-V5 antibody
beads (Sigma) under gentle shaking overnight at 4°C. IPs were washed and
incubated for 5 hours with media containing
pCS2-myc-LRP6
TMC. Co-IPs were washed again and
analyzed by SDS-PAGE and western blotting.
For deglycosylation of LRP6, HEK293T cells were grown in 10 cm plates and transfected with 1 µg flag-LRP6 together with 0.4 µg pCS2-myc-dkk3, pCMV-SPORT6-mesd, pCS2-krm2-V5 (all mouse) or empty pCS2. After 2 days, cells were washed in Hank's buffer and resuspended in 1 ml hypotonic buffer containing 1 mM EDTA, 5 mM HEPES, pH 7.5, 0.1 mM PMSF and one protease inhibitor cocktail tablet per 25 ml. Samples were dounced 25 times, and after removal of cell debris by centrifugation at 2500 rpm (1050 g), membranes were pelleted by centrifugation at 30,000 rpm (40,300 g). Pellets were lysed in NP-40 buffer (without NaF) containing 2% NP-40 and subjected to EndoH (Roche) treatment (0.25 U/ml) in 100 mM NaOAc, pH 5.5, for 30 minutes at 37°C. Samples were analyzed by SDS-PAGE and western blotting.
For cell surface biotinylation, HEK293T cells were transfected in 6 cm dishes with 0.25 µg pCS2-flag-LRP6 together with 0.1 µg pCS2-myc-dkk3, pCMV-SPORT6-mesd or pCS2-krm2-V5, or pCS2-flag-NME (human). After 2 days, cells were surface biotinylated by using 0.5 mg/ml sulpho-NHS-LC-biotin (Pierce) according to the manufacturer. After preparation of membranes as described above, samples were immunoprecipitated with anti-flag antibody beads and analyzed by SDS-PAGE and western blotting.
| RESULTS |
|---|
|
|
|---|
Furthermore, we analyzed the effect of Wnt and BMP pathway activation on krm2 expression in animal caps. In control caps krm2 was expressed at moderate levels. Wnt8 and Wnt3a mRNA injections increased krm2 expression, whereas BMP4 mRNA had no effect (Fig. 1F). LiCl treatment of early embryos, which leads to dorsoanteriorization, downregulated krm2 expression along with Wnt8 and other ventrolaterally expressed genes (Fig. 1G, and C.H. and C.N., unpublished).
We conclude that: (1) at gastrula stages krm2 is expressed and regulated like a classical ventrolateral gene; (2) krm2 is co-expressed with Wnts and regulated by zygotic Wnt signaling; (3) at neurula stages krm2 shows differential expression in the neural crest.
Overexpression of krm2 induces NC markers and NC-derived structures
To study potential Dkk1-independent roles of Krm2, we first analyzed
gain-of-function effects. Localized injection of krm2 mRNA into
prospective anterior embryonic regions induced ectopic cement glands
(Fig. 2A, arrowhead) and
retinal pigment epithelium (Fig.
2B, arrowhead). Ventral injection of krm2 mRNA led to
induction of protrusions containing melanocytes and fin-like structures
(Fig. 2C, arrowhead).
Widespread krm2 overexpression led to strongly hyper-pigmented
embryos due to overproduction of melanocytes
(Fig. 2E). Embryos frequently
also showed eye and tail defects (not shown).
|
Morpholino-mediated knockdown of Krm2 inhibits NC formation
As krm2 is expressed in the prospective NC region and is
sufficient to induce NC tissue, we next asked if it is also required for NC
development. We made use of the previously characterized morpholino antisense
oligonucleotide targeting the ATG codon of Xkrm2 (MO-1)
(Davidson et al., 2002
).
Besides the previously described microcephaly, we found that Krm2 MO-1
injection strongly reduced the pigmentation of embryos
(Fig. 3A). Co-injection of
V5-Xkrm2 mRNA (Davidson et al.,
2002
), a construct lacking the MO-binding site, partially restored
the pigmentation (Fig. 3A),
showing the specificity of the morpholino. Furthermore, Krm2 MO-1 inhibited
slug expression (Fig.
3B,C). This is also the case for a second Krm2 MO (Krm2 MO-2),
which targets the 5' UTR of krm2
(Fig. 3B,C), thus corroborating
the specificity of the NC inhibition.
To analyze if Krm2 is required specifically in the ectoderm for NC formation, or in the underlying, inducing mesoderm, we combined Krm2 MO-1-injected animal caps with uninjected dorsolateral marginal zones (DLMZs) and analyzed NC induction. DLMZs induced slug in control caps in 62% of cases (n=42). Slug induction was reduced upon injection of Krm2 MO-1 into the responding ectoderm (38%, n=24). By contrast, injection of Krm2 MO-1 into DLMZs did not affect slug induction in animal caps (86%, n=13) (Fig. 3D). These results indicate that Krm2 is required directly in the ectoderm for NC formation, where it is also expressed.
Morpholino-mediated knockdown of LRP6 inhibits NC formation
It is well established that canonical Wnt signaling is required for NC
induction (LaBonne and Bronner-Fraser,
1999
; Wu et al.,
2003
; Barembaum and
Bronner-Fraser, 2005
). In Xenopus, overexpression of Wnts
or Wnt receptors, as well as downstream signaling components, can all induce
NC. Conversely, inhibition of Wnts, Wnt receptors and ß-catenin blocks NC
induction (Yanfeng et al.,
2003
; Barembaum and
Bronner-Fraser, 2005
; Wu et
al., 2005
; Abu-Elmagd et al.,
2006
).
As Krm2 is a negative Wnt modulator and is itself Wnt-regulated, we therefore hypothesized that Krm2 may also play a positive role in Wnt/LRP6-mediated NC induction. Hence, we tested whether LRP6 knockdown mimics Krm2 loss-of-function during NC development.
Injection of an LRP6 MO targeting both X. laevis and X. tropicalis genes resulted in strongly anteriorized embryos with enlarged cement gland, shorter and ventrally bent tail and triangular body shape (Fig. 3E). This phenotype closely mimics the anteriorization induced by overexpression of the LRP6 antagonist dkk1 (Fig. 3E). Of note, a morphologically highly sensitive structure to injection of low doses of LRP6 MO is the dorsal fin (see Fig. S1 in the supplementary material). The LRP6 MO phenotype was fully rescued by co-injecting human LRP6 mRNA (Fig. 3Ec,e), confirming specificity of the MO. Furthermore, injection of LRP6 MO in X. tropicalis embryos resulted in the same phenotype as in X. laevis (Fig. 3F).
|
Krms stimulate LRP6-mediated Wnt signaling in HEK293T cells
The results obtained so far suggest that Krm2, besides its well-established
role in Wnt inhibition, may also, in the absence of Dkk1, positively regulate
Wnt signaling. Previously we found no effect of krm1 or 2 in
Wnt responsive reporter assays triggered by transfection of wnt/fz or
wnt/fz/LRP6 in HEK293T cells. We now find that Xkrm1, but
also Xkrm2, significantly stimulated Wnt signaling when
co-transfected with LRP6 alone, whereas no effect was observed with
frizzled8 or dishevelled
(Fig. 4A and see Fig. S2 in the
supplementary material). We conclude that Krms can promote LRP6-mediated
signaling.
One possibility for how Krm may stimulate LRP6 signaling is by promoting
its trafficking or stability. We therefore compared its effects to Mesd, an
LRP6 chaperone, which also stimulates LRP6-mediated Wnt signaling
(Culi and Mann, 2003
;
Hsieh et al., 2003
)
(Fig. 4A). As previously shown,
Mesd is required for maturation of ß-propeller/EGF modules of LDLR family
members (Culi et al., 2004
).
Consequently, mesd transfection did not promote signaling stimulated
by LRP6
E1-4, a constitutive active LRP6 construct with truncated
extracellular domain (Fig. 4A).
In these experiments, LRP6
E1-4 was intentionally
transfected at low amounts to sensitize the reporter assay for synergistic
effect. By contrast, krm1 does moderately stimulate
LRP6
E1-4-mediated signaling (Fig.
4A). Co-transfection of krm1 and mesd shows a
merely additive effect (Fig.
4B), suggesting that these genes do not functionally interact.
To test the specificity of the Wnt promoting effect of krm1, we analyzed a BMP responsive reporter and found it unaffected (Fig. 4C).
We next analyzed the effect of Xkrm1 and mesd on Wnt
signaling in the presence of a very low amount of dkk1, which alone
was insufficient to block LRP6 signaling. As reported
(Mao et al., 2002
;
Li et al., 2005
),
co-transfection of dkk1 with Xkrm1, but not mesd,
reduces the LRP6 signal to background levels
(Fig. 4D). When Wnt1 was
co-transfected additionally, the same result was observed.
Taken together, these data indicate a context-dependent role of Krms in Wnt signaling. Together with Dkk1, Krms inhibit Wnt/LRP6 signaling; however, in the absence of Dkk1, Krms promote LRP6 signaling.
Krms bind to LRP6
We previously reported that Dkk1 binds to both Kremen and LRP6, thereby
bridging the two receptors in a ternary complex, which is then removed from
the cell surface (Mao et al.,
2001
; Mao et al.,
2002
). As our results indicate that Krms can also function without
Dkk1, we tested whether they might bind directly to LRP6, in the absence of
Dkk1. We used HEK293T cells, which express very low levels of dkk1
(our unpublished observations). In co-immunoprecipitation experiments Krm1 and
2 were specifically precipitated with LRP6
(Fig. 5A,A', lane 2), but
not with the control transmembrane proteins FLRT3 and LDLR
C
(Fig. 5A,A', lanes 3,4).
This was also the case in Co-IPs with added anti-Dkk1 antibody, to block any
endogenous Dkk1 protein (C.M.C. and C.N., unpublished). To corroborate the
directness of binding and to demonstrate extracellular interaction we also
performed in vitro binding assays using secreted, recombinant proteins, which
show that LRP6 co-precipitates with both Krm1 and 2, but not Dkk3
(Fig. 5B). We conclude that
Krm1 and 2 specifically and directly bind to LRP6.
|
|
|
Co-transfection of mesd increased mature LRP6, consistent with it
being a reported chaperone (Culi and Mann,
2003
; Hsieh et al.,
2003
) (Fig. 6A,
lanes 5,6). Co-transfection of krm2 had a very similar effect on
LRP6. Mature LRP6 increased at the expense of the immature form
(Fig. 6A, lanes 7,8), the total
amount of LRP6 protein being mostly unaffected. Co-transfection of empty
vector (Fig. 6A, lanes 1,2) or
dkk3 (Fig. 6A, lanes
3,4), a gene not affecting the Wnt pathway
(Niehrs, 2006
), had no effect
on LRP6 protein expression.
To corroborate this finding, we monitored plasma membrane levels of LRP6 by cell surface biotinylation. Following co-transfection with krm2, cell surface levels of LRP6 were increased, while the total LRP6 was mostly unaffected (Fig. 6B). This effect mimicked mesd co-transfection (Fig. 6B). The cytoplasmic protein Nucleoside diphosphate kinase A (NME1) serves as control and was not biotinylated (Fig. 6B'). These data indicate that Krm2 promotes cell-surface localization of the Wnt co-receptor LRP6.
Krm2 knockdown reduces LRP6 protein levels in the NC
Our embryological data indicate a requirement of Krm2 for NC induction, and
the cell culture data suggest that this may be due to a role of Krm2 promoting
LRP6 cell-surface localization and thus Wnt signaling. To corroborate that it
acts on LRP6 in vivo, we analyzed by immunofluorescence microscopy whether
Krm2 is required for the cell-surface localization of endogenous LRP6 in NC
explants. We used an antibody against the intracellular LRP6 domain, which is
likely to recognize both mature and immature forms of the protein
(Davidson et al., 2005
) (data
not shown).
|
|
DISCUSSION Krm2 is required for NC induction
The Wnt signaling pathway is reiteratively used during NC induction,
delamination, migration and differentiation
(Kalcheim and Burstyn-Cohen,
2005
; Raible and Ragland,
2005
; Taneyhill and
Bronner-Fraser, 2005
). During NC induction BMP and Wnt signaling
are thought to act together to specify NC fate. In Xenopus,
overexpression of various Wnts leads to NC induction
(Saint-Jeannet et al., 1997
;
Chang and Hemmati-Brivanlou,
1998
; LaBonne and
Bronner-Fraser, 1998
). Conversely, inhibition of Wnt signaling,
e.g. by dominant-negative versions of Wnt1/8, Tcf-3 and LRP6
(Dorsky et al., 1998
;
LaBonne and Bronner-Fraser,
1998
; Tamai et al.,
2000
; Garcia-Castro et al.,
2002
), or MO-mediated depletion of Frizzled3/7 or ß-catenin
(Deardorff et al., 2001
;
Wu et al., 2005
;
Abu-Elmagd et al., 2006
),
blocks NC induction.
Krm2 is differentially expressed in the NC precursors and is required for NC formation. As Krm2 is both regulated by Wnts and promotes LRP6 activity, this suggests that in the context of NC induction Krm2 functions by promoting Wnt signaling. Consistent with this, depletion of LRP6 inhibited NC induction similarly to Krm2 knockdown. Incidentally, this is the first evidence indicating that LRP6 acts non-redundantly from LRP5 in NC formation in Xenopus.
The finding that anteriorly overexpressed Krm2 inhibited, while posterior overexpression enhanced, NC formation suggests a dual Krm2 action. Anteriorly overexpressed Krm2 probably cooperates with Dkk1 in Wnt inhibition, while in posterior regions Krm2 on its own promotes Wnt signaling. This dual activity is also supported by our cell culture experiments.
We cannot exclude the possibility that Krm2 may act also on other pathways that are involved in NC formation, e.g. BMP signaling. However, in cell culture reporter assays BMP signaling was unaffected by Krms.
Krm1 and 2 show differential expression at all stages of
development both in Xenopus and mouse
(Nakamura et al., 2001
;
Davidson et al., 2002
), and
analyses of their developmental role will need to take into account a possible
positive action on Wnt signaling. Interestingly, based on EST expression data,
KRM2 mRNA is significantly upregulated in several human cancers, e.g.
brain, testis, kidney and gastrointestinal tract tumors
(http://cgap.nci.nih.gov/),
and it is a Wnt target (this study), raising the possibility that Krm2 may be
a tumor associated gene or may even have an oncogenic (or tumor suppressive)
role.
Krms promote LRP6-mediated Wnt signaling
One surprising result of this study is that Krms not only act as negative,
but also as positive, Wnt modulators, providing an explanation for their role
in Wnt-mediated NC induction. Krm2 overexpression promoted cell surface
localization of LRP6 in cultured cells; in embryos, Krm2 was required to
maintain LRP6 protein levels in NC. Taken together, these data raise the
possibility that Krm2 regulates LRP6 intracellular transport and turnover.
This is reminiscent of the LRP6 chaperone Mesd, which promotes LRP6 folding
and cell surface localization (Culi and
Mann, 2003
; Hsieh et al.,
2003
) (this study). Do Krms then act as ER chaperones of LRP6?
Three lines of evidence argue against this: (1) Unlike Mesd, Krms are not
ER-resident (Culi and Mann,
2003
; Hsieh et al.,
2003
; Cruciat et al.,
2006
); (2) artificially ER-trapped Krm2 has a strongly reduced
effect on LRP6 surface localization compared to wild type Krm2 (C.H. and C.N.,
unpublished), indicating that a subcellular localization other than in the ER
is required for Krm to exert its full effect on LRP6; (3) Krms can, albeit
weakly, promote Wnt signaling induced by LRP6
E1-4 (see
Fig. 4A), a construct lacking
all four ß-propeller/EGF regions, which are the target of Mesd
(Culi et al., 2004
).
LRP6
E1-4, in contrast to full-length LRP6, is predominantly cell
surface localized (C.H. and C.N., unpublished)
(Cong et al., 2004
), indicating
that this construct does not require support in trafficking.
What, then, could be the mechanism of action of Krms? Krms may attenuate
LRP6 endocytosis and degradation, thus promoting cell surface localization of
LRP6. This would be the reverse of Krm action in the presence of Dkk1, which
induces rapid LRP6 internalization (Mao et
al., 2002
). Krms may therefore be context-dependent endocytosis
regulators of LRP6. Indeed, a hallmark of LDLR family members is their
regulated endocytosis (Howell and Herz,
2001
; May et al.,
2003
; Schneider and Nimpf,
2003
).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/23/4255/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Elmagd, M., Garcia-Morales, C. and Wheeler, G. N.
(2006). Frizzled7 mediates canonical Wnt signaling in neural
crest induction. Dev. Biol.
298,285
-298.[CrossRef][Medline]
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y.
H., Credidio, C. and Saint-Jeannet, J. P. (2003). Sox10
regulates the development of neural crest-derived melanocytes in Xenopus.
Dev. Biol. 259,19
-33.[CrossRef][Medline]
Bafico, A., Liu, G., Yaniv, A., Gazit, A. and Aaronson, S.
A. (2001). Novel mechanism of Wnt signalling inhibition
mediated by Dickkopf-1 interaction with LRP6/Arrow. Nat. Cell
Biol. 3,683
-686.[CrossRef][Medline]
Barembaum, M. and Bronner-Fraser, M. (2005).
Early steps in neural crest specification. Semin. Cell Dev.
Biol. 16,642
-646.[CrossRef][Medline]
Bienz, M. and Clevers, H. (2000). Linking
colorectal cancer to Wnt signaling. Cell
103,311
-320.[CrossRef][Medline]
Chang, C. and Hemmati-Brivanlou, A. (1998).
Neural crest induction by Xwnt7B in Xenopus. Dev.
Biol. 194,129
-134.[CrossRef][Medline]
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R.
T. (1991). Xwnt-8, a Xenopus Wnt-1/int-1-related gene
responsive to mesoderm-inducing growth factors, may play a role in ventral
mesodermal patterning during embryogenesis.
Development 111,1045
-1055.
Cong, F., Schweizer, L. and Varmus, H. (2004).
Wnt signals across the plasma membrane to activate the beta-catenin pathway by
forming oligomers containing its receptors, Frizzled and LRP.
Development 131,5103
-5115.
Cruciat, C. M., Hassler, C. and Niehrs, C.
(2006). The MRH protein Erlectin is a member of the endoplasmic
reticulum synexpression group and functions in N-glycan recognition.
J. Biol. Chem. 281,12986
-12993.
Culi, J. and Mann, R. S. (2003). Boca, an
endoplasmic reticulum protein required for wingless signaling and trafficking
of LDL receptor family members in Drosophila. Cell
112,343
-354.[CrossRef][Medline]
Culi, J., Springer, T. A. and Mann, R. S.
(2004). Boca-dependent maturation of beta-propeller/EGF modules
in low-density lipoprotein receptor proteins. EMBO J.
23,1372
-1380.[CrossRef][Medline]
Davidson, G., Mao, B., del Barco Barrantes, I. and Niehrs,
C. (2002). Kremen proteins interact with Dickkopf1 to
regulate anteroposterior CNS patterning. Development
129,5587
-5596.[CrossRef][Medline]
Davidson, G., Wu, W., Shen, J., Bilic, J., Fenger, U., Stannek,
P., Glinka, A. and Niehrs, C. (2005). Casein kinase 1 gamma
couples Wnt receptor activation to cytoplasmic signal transduction.
Nature 438,867
-872.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Saint-Jeannet, J. P. and Klein, P.
S. (2001). A role for frizzled 3 in neural crest development.
Development 128,3655
-3663.
Dorsky, R. I., Moon, R. T. and Raible, D. W.
(1998). Control of neural crest cell fate by the Wnt signalling
pathway. Nature 396,370
-373.[CrossRef][Medline]
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M.
(2002). Ectodermal Wnt function as a neural crest inducer.
Science 297,848
-851.
Gawantka, V., Delius, H., Hirschfeld, K., Blumenstock, C. and
Niehrs, C. (1995). Antagonizing the Spemann organizer: role
of the homeobox gene Xvent-1. EMBO J.
14,6268
-6279.[Medline]
Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C.
and Niehrs, C. (1998). Dickkopf-1 is a member of a new family
of secreted proteins and functions in head induction.
Nature 391,357
-362.[CrossRef][Medline]
Hashimoto, H., Itoh, M., Yamanaka, Y., Yamashita, S., Shimizu,
T., Solnica-Krezel, L., Hibi, M. and Hirano, T. (2000).
Zebrafish Dkk1 functions in forebrain specification and axial mesendoderm
formation. Dev. Biol.
217,138
-152.[CrossRef][Medline]
Hata, A., Seoane, J., Lagna, G., Montalvo, E.,
Hemmati-Brivanlou, A. and Massague, J. (2000). OAZ uses
distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf
signaling pathways. Cell
100,229
-240.[CrossRef][Medline]
He, X., Semenov, M., Tamai, K. and Zeng, X.
(2004). LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin
signaling: arrows point the way. Development
131,1663
-1677.
Honore, S. M., Aybar, M. J. and Mayor, R.
(2003). Sox10 is required for the early development of the
prospective neural crest in Xenopus embryos. Dev.
Biol. 260,79
-96.[CrossRef][Medline]
Howell, B. W. and Herz, J. (2001). The LDL
receptor gene family: signaling functions during development. Curr.
Opin. Neurobiol. 11,74
-81.[CrossRef][Medline]
Hsieh, J. C., Lee, L., Zhang, L., Wefer, S., Brown, K., DeRossi,
C., Wines, M. E., Rosenquist, T. and Holdener, B. C. (2003).
Mesd encodes an LRP5/6 chaperone essential for specification of mouse
embryonic polarity. Cell
112,355
-367.[CrossRef][Medline]
Kalcheim, C. and Burstyn-Cohen, T. (2005).
Early stages of neural crest ontogeny: formation and regulation of cell
delamination. Int. J. Dev. Biol.
49,105
-116.[CrossRef][Medline]
LaBonne, C. and Bronner-Fraser, M. (1998).
Neural crest induction in Xenopus: evidence for a two-signal model.
Development 125,2403
-2414.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1999).
Molecular mechanisms of neural crest formation. Annu. Rev. Cell
Dev. Biol. 15,81
-112.[CrossRef][Medline]
Li, Y., Chen, J., Lu, W., McCormick, L. M., Wang, J. and Bu,
G. (2005). Mesd binds to mature LDL-receptor-related
protein-6 and antagonizes ligand binding. J. Cell Sci.
118,5305
-5314.
Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A. and
Niehrs, C. (2001). LDL-receptor-related protein 6 is a
receptor for Dickkopf proteins. Nature
411,321
-325.[CrossRef][Medline]
Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B.
M., Delius, H., Hoppe, D., Stannek, P., Walter, C. et al.
(2002). Kremen proteins are Dickkopf receptors that regulate
Wnt/beta-catenin signalling. Nature
417,664
-667.[CrossRef][Medline]
May, P., Bock, H. H. and Herz, J. (2003).
Integration of endocytosis and signal transduction by lipoprotein receptors.
Sci. STKE 2003,PE12
.[Medline]
Moon, R. T., Brown, J. D. and Torres, M.
(1997). WNTs modulate cell fate and behavior during vertebrate
development. Trends Genet.
13,157
-162.[CrossRef][Medline]
Mukhopadhyay, M., Shtrom, S., Rodriguez-Esteban, C., Chen, L.,
Tsukui, T., Gomer, L., Dorward, D. W., Glinka, A., Grinberg, A., Huang, S. P.
et al. (2001). Dickkopf1 is required for embryonic head
induction and limb morphogenesis in the mouse. Dev.
Cell 1,423
-434.[CrossRef][Medline]
Nakamura, T., Aoki, S., Kitajima, K., Takahashi, T., Matsumoto,
K. and Nakamura, T. (2001). Molecular cloning and
characterization of Kremen, a novel kringle-containing transmembrane protein.
Biochim. Biophys. Acta
1518,63
-72.[Medline]
Niehrs, C. (2006). Function and biological
roles of the Dickkopf family of Wnt modulators.
Oncogene 25,7469
-7481.[CrossRef][Medline]
Niehrs, C., Steinbeisser, H. and De Robertis, E. M.
(1994). Mesodermal patterning by a gradient of the vertebrate
homeobox gene goosecoid. Science
263,817
-820.
Nusse, R. (2005). Wnt signaling in disease and
in development. Cell Res.
15, 28-32.[CrossRef][Medline]
Osada, M., Ito, E., Fermin, H. A., Vazquez-Cintron, E.,
Venkatesh, T., Friedel, R. H. and Pezzano, M. (2006). The Wnt
signaling antagonist Kremen1 is required for development of thymic
architecture. Clin. Dev. Immunol.
13,299
-319.[CrossRef][Medline]
Pinson, K. I., Brennan, J., Monkley, S., Avery, B. J. and
Skarnes, W. C. (2000). An LDL-receptor-related protein
mediates Wnt signalling in mice. Nature
407,535
-538.[CrossRef][Medline]
Raible, D. W. and Ragland, J. W. (2005).
Reiterated Wnt and BMP signals in neural crest development. Semin.
Cell Dev. Biol. 16,673
-682.[CrossRef][Medline]
Ruiz i Altaba, A. and Melton, D. A. (1989).
Involvement of the Xenopus homeobox gene Xhox3 in pattern formation along the
anterior-posterior axis. Cell
57,317
-326.[CrossRef][Medline]
Saint-Jeannet, J. P., He, X., Varmus, H. E. and Dawid, I. B.
(1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and
Wnt-3a. Proc. Natl. Acad. Sci. USA
94,13713
-13718.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K.
and De Robertis, E. M. (1994). Xenopus chordin: a novel
dorsalizing factor activated by organizer-specific homeobox genes.
Cell 79,779
-790.[CrossRef][Medline]
Schneider, W. J. and Nimpf, J. (2003). LDL
receptor relatives at the crossroad of endocytosis and signaling.
Cell. Mol. Life Sci. 60,892
-903.[CrossRef][Medline]
Semenov, M. V., Tamai, K., Brott, B. K., Kuhl, M., Sokol, S. and
He, X. (2001). Head inducer Dickkopf-1 is a ligand for Wnt
coreceptor LRP6. Curr. Biol.
11,951
-961.[CrossRef][Medline]
Shinya, M., Eschbach, C., Clark, M., Lehrach, H. and
Furutani-Seiki, M. (2000). Zebrafish Dkk1, induced by the
pre-MBT Wnt signaling, is secreted from the prechordal plate and patterns the
anterior neural plate. Mech. Dev.
98, 3-17.[CrossRef][Medline]
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Fate mapping and lineage labeling. In Early
Development of Xenopus laevis: A Laboratory Manual (ed. S. Curtis
and M. Cozza), pp. 143-170. New York: Cold Spring
Harbor Laboratory Press.
Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C.,
Katsuyama, Y., Hess, F., Saint-Jeannet, J. P. and He, X.
(2000). LDL-receptor-related proteins in Wnt signal transduction.
Nature 407,530
-535.[CrossRef][Medline]
Taneyhill, L. A. and Bronner-Fraser, M. (2005).
Recycling signals in the neural crest. J. Biol.
4, 10.[CrossRef][Medline]
Unterseher, F., Hefele, J. A., Giehl, K., De Robertis, E. M.,
Wedlich, D. and Schambony, A. (2004). Paraxial protocadherin
coordinates cell polarity during convergent extension via Rho A and JNK.
EMBO J. 23,3259
-3269.[CrossRef][Medline]
Villanueva, S., Glavic, A., Ruiz, P. and Mayor, R.
(2002). Posteriorization by FGF, Wnt, and retinoic acid is
required for neural crest induction. Dev. Biol.
241,289
-301.[CrossRef][Medline]
Wehrli, M., Dougan, S. T., Caldwell, K., O'Keefe, L., Schwartz,
S., Vaizel-Ohayon, D., Schejter, E., Tomlinson, A. and DiNardo, S.
(2000). arrow encodes an LDL-receptor-related protein essential
for Wingless signalling. Nature
407,527
-530.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of
Wnt signaling in development. Annu. Rev. Cell Dev.
Biol. 14,59
-88.[CrossRef][Medline]
Wu, J., Saint-Jeannet, J. P. and Klein, P. S.
(2003). Wnt-frizzled signaling in neural crest formation.
Trends Neurosci. 26,40
-45.[CrossRef][Medline]
Wu, J., Yang, J. and Klein, P. S. (2005).
Neural crest induction by the canonical Wnt pathway can be dissociated from
anterior-posterior neural patterning in Xenopus. Dev.
Biol. 279,220
-232.[CrossRef][Medline]
Wu, W., Glinka, A., Delius, H. and Niehrs, C.
(2000). Mutual antagonism between dickkopf1 and dickkopf2
regulates Wnt/beta-catenin signalling. Curr. Biol.
10,1611
-1614.[CrossRef][Medline]
Yanfeng, W., Saint-Jeannet, J. P. and Klein, P. S.
(2003). Wnt-frizzled signaling in the induction and
differentiation of the neural crest. BioEssays
25,317
-325.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
R. van Amerongen and R. Nusse Towards an integrated view of Wnt signaling in development Development, October 1, 2009; 136(19): 3205 - 3214. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Hong, B.-Y. Park, and J.-P. Saint-Jeannet Fgf8a induces neural crest indirectly through the activation of Wnt8 in the paraxial mesoderm Development, December 1, 2008; 135(23): 3903 - 3910. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ellwanger, H. Saito, P. Clement-Lacroix, N. Maltry, J. Niedermeyer, W. K. Lee, R. Baron, G. Rawadi, H. Westphal, and C. Niehrs Targeted Disruption of the Wnt Regulator Kremen Induces Limb Defects and High Bone Density Mol. Cell. Biol., August 1, 2008; 28(15): 4875 - 4882. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Semenov, X. Zhang, and X. He DKK1 Antagonizes Wnt Signaling without Promotion of LRP6 Internalization and Degradation J. Biol. Chem., August 1, 2008; 283(31): 21427 - 21432. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Cselenyi and E. Lee Context-Dependent Activation or Inhibition of Wnt-{beta}-Catenin Signaling by Kremen Sci. Signal., February 26, 2008; 1(8): pe10 - pe10. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||