|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online November 26, 2007
doi: 10.1242/10.1242/dev.012187
1 Division of Pediatric Ophthalmology, Division of Developmental Biology,
Children's Hospital Research Foundation and Department of Ophthalmology,
University of Cincinnati, Cincinnati, OH 45229, USA.
2 Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA
02215, USA.
3 Whitaker Cardiovascular Institute, Boston University School of Medicine,
Boston MA 02118, USA.
4 Graduate Program of Molecular and Developmental Biology, College of Medicine,
University of Cincinnati, Cincinnati, OH45229, USA.
Author for correspondence (e-mail:
richard.lang{at}cchmc.org)
Accepted 23 September 2007
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Macrophage, Angiopoietin, Wnt, Programmed cell death, Vascular regression, Cell cycle
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Rapid
identification and engulfment of apoptotic cells by macrophages prevents the
release of pro-inflammatory intracellular components that when chronically
released can be deleterious. Indeed, recognition of apoptotic cells by
macrophages results in the release of anti-inflammatory agents including
TGFβ (Savill et al.,
2002; Lucas et al.,
2003). In many circumstances where macrophages encounter apoptotic
cells, the macrophage is believed to have a after-the-fact role in disposal
and immune modulation.
There is emerging evidence to suggest that in some cases, macrophages play
an active role in inducing programmed cell death. This was first appreciated
after macrophage ablation experiments resulted in the persistence of viable
cells in ocular vessel networks that failed to undergo scheduled regression
(Lang and Bishop, 1993). The
proposal that macrophages can actively signal cell death has received support
from a number of systems including C. elegans, where caspase (CED-3)
partial function combined with recognition pathway mutants demonstrate that
recognition is a back-up stimulus for apoptosis
(Hoeppner et al., 2001;
Reddien et al., 2001).
Although there is currently no mechanistic parallel apparent, discovery of
macrophage-induced (Lang and Bishop,
1993; Diez-Roux and Lang,
1997) and phagocyte-enhanced
(Hoeppner et al., 2001;
Reddien et al., 2001)
apoptosis in mice and worms may suggest an activity functionally conserved in
metazoans.
Signaling mechanisms accounting for macrophage-induced cell death are now
being described. In the developing chick retina, it has been demonstrated that
macrophage-related microglia are a source of nerve growth factor (NGF) that
causes neurons to die (Frade et al.,
1996), and in mice, microglia promote programmed cell death of
Purkinje cells through production of superoxide ions
(Marin-Teva et al., 2004;
Mallat et al., 2005). In the
mouse eye the canonical Wnt pathway (Logan
and Nusse, 2004) is crucial for scheduled vascular regression. In
this system, resident macrophages produce Wnt7b and through close contact with
vascular endothelial cells (VECs) signal cell death
(Lobov et al., 2005).
The angiopoietin signaling system plays a key role in the regulation of
angiogenesis, vascular homeostasis and vascular regression
(Yancopoulos et al., 2000).
One angiopoietin receptor is the conventional tyrosine kinase receptor Tie2
(Dumont et al., 1994).
Expression of Tie2 is largely restricted to endothelial cells but can also be
found in haematopoietic cells and a subset of tumor-associated monocytes and
eosinophils (Iwama et al.,
1993; Dumont et al.,
1994; Feistritzer et al.,
2004; De Palma et al.,
2005). More recent work has indicated that integrins can serve as
alternative receptors for the angiopoietins
(Carlson et al., 2001) and that
integrins and Tie2 can form a complex
(Cascone et al., 2005).
Angiopoietin 1 (Ang1; also known as Angpt1 - Mouse Genome Informatics) and
angiopoietin 2 (Ang2; also known as Angpt2) are the two best characterized
Tie2 ligands. Ang1 (Suri et al.,
1996) is an agonist and elicits many responses including
cell-survival through the PI3-kinase-Akt signaling pathway
(Datta et al., 1999;
Peters et al., 2004). Under
some (Gale et al., 2002;
Lobov et al., 2002) but not
all (Kim et al., 2000b;
Gale et al., 2002)
circumstances, Ang2 (Maisonpierre et al.,
1997) is a signaling antagonist and inhibits the action of Ang1.
As an antagonist of the PI 3-kinase-Akt signaling pathway, Ang2 activity is
synonymous with survival signal withdrawal. Ang2 promotes vessel
destabilization (Maisonpierre et al.,
1997) and, in the presence of vascular endothelial cell growth
factor (VEGF), is an important angiogenic stimulus
(Yancopoulos et al., 2000;
Lobov et al., 2002). Under
conditions where VEGF signaling is inhibited or absent, the action of Ang2 in
destabilizing vessels can lead to cell death and capillary regression
(Yancopoulos et al., 2000;
Lobov et al., 2002).
The hyaloid vessels of the eye serve as a model system to further our
understanding of the mechanisms of vascular regression
(Lang and Bishop, 1993;
Diez-Roux and Lang, 1997;
Diez-Roux et al., 1999;
Ito and Yoshioka, 1999;
Meeson et al., 1999;
Ylikarppa et al., 2003;
Ohlmann et al., 2004;
Lobov et al., 2005). In the
current study we sought to explain the mechanisms by which hyaloid VECs
undergo apoptosis and examined the possibility of cooperation between the Wnt
and angiopoietin pathways. We show that during scheduled vascular regression,
macrophages are an obligatory participant in a signaling switch that favors
death over survival. This switch occurs when Ang2 has the dual effect of
suppressing PI 3-kinase-Akt survival signaling in VECs and stimulating Wnt7b
production in macrophages. In response to Wnt7b, VECs enter the cell cycle and
die in the G1 phase of the cell cycle due to Ang2-mediated withdrawal of
survival signals. We propose that close coupling of macrophage function to the
cell death program is an adaptation to ensure that a `professional' phagocyte
is on hand when cell death occurs.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
),
Wnt7blacZ (Lobov et
al., 2005), Wnt7bd1
(Lobov et al., 2005),
Ang2lacZ (Gale et al.,
2002), VE-cadherin:tTa
(Sun et al., 2005),
TET:myrAkt (Sun et al.,
2005) and TOPGAL
(DasGupta and Fuchs, 1999) mice
were performed as previously described.
Dissections, immunostaining and imaging
Hyaloid vessel preparations were generated as previously described
(Lobov et al., 2005) with the
exception that dissections were performed without gelatin. X-Gal staining was
done according to established protocols
(Shu et al., 2002). Indirect
immunofluorescent staining and BrdU labeling were performed as previously
described (Diez-Roux et al.,
1999). Primary antibodies were as follows: anti-BrdU (1:100,
Dako), anti-β-catenin (1:50, BD Transduction). Secondary antibodies
labeled with Alexa fluorochromes (Molecular Probes) were used at a 1:500
dilution. TUNEL labeling of apoptotic cells was performed using the In Situ
Cell Death Detection Kit (Roche Applied Science).
Cell culture experiments
Microvascular endothelial cells (MVECs; Cambrex) from skin were grown to
60-70% confluency, serum starved overnight and stimulated with Ang1 (500
ng/ml) and/or Wnt3a (250 ng/ml) in combination with the Akt inhibitor SH6
(Kozikowski et al., 2003;
Castillo et al., 2004) (10
µM) or the PI 3-kinase inhibitor wortmannin (250 nM) for 4 hours or 12
hours and labeled for β-catenin.
Intravitreal injection
Intravitreal injection was performed with glass needles pulled on a model
P87 flaming-pipette puller and beveled with a K. T. Brown Type model BV-10
diamond beveller (Sutter Instrument Company, Novato, CA). Materials injected
included 120 nl of 10 µM SH6 (Alexis Biochemicals) and 120 nl of 50 µM
Ang1 or Ang2 (R&D Systems).
Laser capture microdissection
Macrophages were captured from whole-mount hyaloid vessels of P3 CD1 mice,
injected with Ang2 intravitreally (see above) using the Veritas
Microdissection System. Control eyes were sham injected with PBS. For each
experiment, 5-7 ng/ml of RNA was used.
RT-PCR
RNA from dissected hyaloid vessel preparations was purified using the
Qiagen MicroEasy RNA Isolation Kit. Subsequent RT-PCR was performed using the
OneStep RT-PCR Kit (Qiagen). The following primers (shown 5' to
3') were used:
Gapdh: forward (F), ACTCCACTCACGGCAAATTC; reverse (R), CACATTGGGGGTAGGAACAC.
Ang1: F1, AGGCTTGGTTTCTCGTCAGA; R1, TCTGCACAGTCTCGAAATGG.
Wnt7b: F, AAGAACTCCGAGTAGGGAGTCG; R, TGCGT TGTACTTCTCCTTGAGC.
Wnt7b: 2nd round F, CCGAGTAGGGAGTCGAGAGG; R, CACACCGTGACACTTACATTCC.
Statistical analysis
Vessel number was quantified using established methods
(Ito and Yoshioka, 1999). At
least four hyaloid vessel preparations were quantified for each experiment.
All data are presented with standard error bars. The Student's t-test
and one-way ANOVA with Tukey's test were used to assess statistical
significance.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). However, mechanistically it has been difficult to reconcile
how Wnt signaling could culminate in death of VECs. This prompted us to
investigate other pathways that might be required. The Tie2 antagonist Ang2
can induce vessel regression in the absence of VEGF, and the Tie2 agonist Ang1
is linked with survival of endothelial cells
(Yancopoulos et al., 2000;
Lobov et al., 2002).
Furthermore, like Wn7bd1 mutant mice
(Lobov et al., 2005)
Ang2 mutants have persistent hyaloid vessels
(Gale et al., 2002) suggesting
that the Wnt and angiopoietin pathways function in concert to regulate
regression. To investigate the nature of this cooperation we assessed genetic
interaction between mutant loci representing each pathway
[Wnt7bd1 (Lobov et
al., 2005) and Ang2lacZ
(Gale et al., 2002)]. By 8
days after birth (P8) in wild-type mice
(Fig. 1A,B) hyaloid vessel
regression is all but complete. By contrast, Wnt7bd1/d1
(Fig. 1C,D) and
Ang2lacZ/lacZ (Fig.
1E,F) mutants show persistent vessels. Unlike
Wnt7bd1/d1 mutant vessels, those from
Ang2lacZ/lacZ mice show an unusual hypercellularity
(Fig. 1H). Compound
heterozygotes show a persistence phenotype
(Fig. 1J) that is more severe
than that of either single heterozygote
(Fig. 2A) and similar in degree
to that of the Wnt7bd1 homozygote
(Fig. 2A). Very similar
responses are observed when interactions between the Wnt pathway co-receptor
gene Lrp5lacZ and Ang2lacZ are
assessed (data not shown). These data are consistent with a cooperative action
between the Wnt and angiopoietin pathways in regulating vessel regression.
Proliferation and death are exquisitely sensitive to Wnt-Angiopoietin pathway interaction
Evidence for cooperative action of the two pathways also emerges when
proliferation and cell death are quantified
(Fig. 2B,C).
Ang2lacZ heterozygotes and homozygotes have progressively
reduced levels of cell death as determined by TUNEL analysis
(Fig. 2B). There is a similar
but more pronounced response in Wnt7bd1 mutants
(Fig. 2B). Double heterozygotes
show a level of cell death significantly less than
Ang2lacZ heterozygotes
(Fig. 2B) suggesting that Wnt7b
modulates the Ang2 pro-apoptotic function. An examination of BrdU labeling
levels is also revealing (Fig.
2C). The Ang2lacZ heterozygote is essentially
unchanged whereas the Ang2lacZ homozygote has a
dramatically increased BrdU labeling index
(Fig. 2C), consistent with the
distinct hyperplastic phenotype of the hyaloid vessels
(Fig. 1H).
Wnt7bd1 mutants show the opposite response, with the
heterozygote having less than half the wild-type level of labeling
(Fig. 2C). Combining
Ang2 heterozygosity with Wnt7b+/d1 completely
rescues the proliferation defect in the Wnt mutant. We conclude that for
proliferation and cell death, Wnt7b and Ang2 mutations show
a genetic interaction and that the pathways are finely balanced in regulating
cellular responses.
The Akt component of Tie2 signaling is critical for cell survival
Wnt7b is expressed by hyaloid-associated macrophages
(Lobov et al., 2005). X-Gal
staining of hyaloid vessels from Ang2+/lacZ mice revealed
that Ang2 is expressed in capillary cells
(Fig. 3A). The X-Gal staining
pattern (Fig. 3B, red
arrowheads) was characteristic of pericyte processes. Resident macrophages
(Fig. 3B, red dashed rings) did
not stain. Small-diameter capillaries that typically have minimal pericyte
investment also had limited staining (Fig.
3B, red bracket). Immunofluorescent staining of hyaloid vessels
from wild-type mice with desmin, a marker for pericytes, also showed a similar
pattern of staining as the X-Gal-positive cells
(Fig. 3C, white arrowheads).
X-Gal staining of hyaloid vessels from Tie2-lacZ mice
(Schlaeger et al., 1997)
showed a contrasting pattern of labeling similar to that of VECs
(Fig. 3D). This suggested that
the source of Ang2 required for hyaloid vessel regression was the
pericyte.
|
). Akt is
known to have multiple effects, including suppression of cell death
(Datta et al., 1999) and in
some settings, stabilization of β-catenin
(Moore and Lemischka, 2006).
Since Ang2 is an antagonist, loss-of-function Ang2 should be equivalent to
gain-of-function Akt. To determine whether this was the case, we used the TET
transactivation system (Corbel and Rossi,
2002) to express a dominant active form of Akt in VECs. When
tetracycline is withdrawn, bitransgenic VE-cadherin:tTa;TET:myrAkt
mice express myrAkt in VECs (Sun
et al., 2005). Withdrawal of tetracycline at the day of birth
followed by BrdU labeling at P5 showed that Akt gain-of-function mice have an
increased labeling index (Fig.
3J, light green bar) that is comparable to that obtained with the
intra-vitreal injection of Ang1 (an alternative strategy for pathway
activation; Fig. 3J, green bar)
or when the Ang2 gene is mutated
(Fig. 3J, red bar). These data
indicate that activation of the angiopoietin pathway stimulates proliferation,
that proliferation responses occur downstream of Akt, and confirms that Ang1
and Ang2 behave as agonist and antagonist, respectively.
Akt gain-of-function phenocopies other aspects of the
Ang2lacZ/lacZ hyaloid persistence phenotype
(Fig. 3E-L). In
VE-cadherin:tTa;TET:myrAkt mice, levels of apoptosis are low at P5
(Fig. 3K), vessel number is
greater at P8 (Fig. 3L) and
although there is some variability (Fig.
3F,G) many vessels have the hypercellularity
(Fig. 3I) characteristic of the
Ang2 mutant (Fig. 1H).
Limited stability of Ang1 after intra-vitreal injection precluded assessment
of vessel number at P8. To perform Akt loss-of-function experiments, we took
advantage of the Akt inhibitor SH6
(Kozikowski et al., 2003;
Castillo et al., 2004) and
compared the consequences of injecting Ang1, SH6 or both, into the vitreous of
wild-type mice at P4. Hyaloid vessels were dissected at P5 and TUNEL analysis
performed (Fig. 3M,N) so that
we could quantify the total remaining healthy capillaries
(Fig. 3O). SH6 injection
resulted in a dramatic increase in cell death and precocious hyaloid
regression (Fig. 3M-O).
Importantly, the specificity of the SH6 cell death response was demonstrated
by the rescue of precocious regression when Ang1 was co-injected
(Fig. 3O). The ability of Ang1
to reverse SH6-induced cell death may indicate that the inhibitor is in
equilibrium with Akt and can be competed out if sufficient activated Akt is
provided by Ang1 stimulation. Combined, these data indicate that Akt is a key
mediator of both proliferation and survival responses in VECs of the hyaloid
system.
Stabilization of β-catenin via Akt has been documented in other
systems (Fukumoto et al.,
2001; Sharma et al.,
2002) and this was one possible explanation for the cooperative
action of Wnt and angiopoietin pathways during hyaloid regression. We examined
this possibility in a culture system using β-catenin labeling of
microvascular endothelial cells (MVECs) under various treatment conditions.
MVECs were serum-starved overnight to remove the influence of other agents,
and then incubated for 12 hours (Fig.
4A-F) with serum-free medium as a control
(Fig. 4A), with recombinant
Wnt3a (Fig. 4B) or with Ang1
(Fig. 4C). Whereas there were
changes in the strength of β-catenin labeling in other regions of the
cells, Ang1, like Wnt3a, was found to stimulate translocation of
β-catenin to the nucleus. Prevention of nuclear β-catenin
localization, when wortmannin (a PI 3-kinase inhibitor;
Fig. 4D) or SH6 (an Akt
inhibitor; Fig. 4E) were added
in combination with Ang1, provided evidence that β-catenin stabilization
was downstream of PI 3-kinase and Akt. Quantification also showed that at the
concentrations of recombinant ligands chosen, Ang1 was at least as potent as
Wnt3a in stimulating this response (Fig.
4F). Furthermore, the inability of wortmannin or SH6 to prevent
β-catenin nuclear localization in response to Wnt3a emphasizes that the
Wnt and angiopoietin pathway are alternative β-catenin stabilization
options (Fig. 4F). We also
performed experiments in which MVECs were incubated with Ang1, Wnt3a or both
for 4 hours (Fig. 4F, right
panel). Since the combined factors gave a synergistic response, this also
suggested the Wnt and angiopoietin pathways cooperate to stabilize
β-catenin.
|
As an alternative way to assess angiopoietin-regulated Wnt pathway
responses, we quantified TOPGAL reporter expression in the hyaloid
vessels when Ang1 or 2 was injected into the eye. Previously we validated the
TOPGAL transgene - a lacZ open reading frame regulated by
Lef/TCF binding sites - as a Wnt pathway reporter for VECs of the hyaloid
capillaries (Lobov et al.,
2005). We have also demonstrated that lacZ expression and
X-Gal staining in Lrp5lacZ/lacZ mice is very weak in all
VECs, and therefore can be easily distinguished from the strong, sporadic VEC
staining of the TOPGAL transgene
(Lobov et al., 2005).
Intra-vitreal injection of recombinant Ang1 increased the number of
TOPGAL-expressing cells regardless of the Lrp5 status of the
experimental mouse (Fig. 5M-O).
This indicates that the angiopoietin pathway can activate a model Wnt pathway
target gene and is consistent with Akt-mediated stabilization of
β-catenin.
Injection of Ang2 into TOPGAL mice gave differing responses depending on Lrp5 status. In Lrp5 homozygous mutants, TOPGAL-positive cell number was close to zero and, as might be anticipated from an antagonist, injection of Ang2 did not elicit a change (Fig. 5P). In Lrp5 heterozygous mutants also, as expected, Ang2 reduced the number of TOPGAL-expressing cells (Fig. 5P). Surprisingly, in wild-type mice, Ang2 injection reproducibly elicited the opposite response and increased the number of TOPGAL-expressing cells (Fig. 5P). In seeking an explanation for this, we considered the possibility that besides regulating angiopoietin pathway signaling, Ang2 might have an additional activity regulating macrophage production of Wnt7b. Using the Wnt7blacZ allele, we assessed gene expression on the Ang2lacZ heterozygous and homozygous backgrounds and found that when Ang2 activity was absent, Wnt7b expression in macrophages was lost (Fig. 6A,B). Since it could be argued that macrophages in the Ang2lacZ null might be poorly differentiated and therefore incapable of expressing Wnt7b, we also performed a gain-of-function experiment. Ang2 was injected intra-vitreally in CD1 animals, hyaloid macrophages were isolated by laser capture microdissection and Wnt7b RT-PCR performed (Fig. 6C). Though Wnt7b expression in the control eye showed some variation, from being undetectable to being weakly present, in every experiment Ang2 injection resulted in upregulation of Wnt7b. These data show that directly or indirectly, Ang2 is required for Wnt7b expression in macrophages. This was a straightforward explanation for the increased number of cells expressing TOPGAL with injection of Ang2. Combined with the above analysis, this suggests that Ang2 has two functions, the pro-apoptotic suppression of Akt and the pro-cycle activation of macrophage Wnt7b. Expression of Ang1 in the hyaloid vessel complex (Fig. 6D) suggested that Ang1 and Ang2 had the opportunity to function as agonist and antagonist.
|
|
;
Lowe et al., 2004). This
strategy of cell death regulation could explain why Wnt7b - a promoter of cell
cycle entry in hyaloid VECs (Lobov et al.,
2005) - is required for cell death. To address the relationship
between cell cycle entry and cell death directly, we used BrdU labeling to
track the fate of a synchronous cohort of hyaloid VECs through the cell cycle.
BrdU was injected at t=0 hours and hyaloid vessel preparations fixed
at t=1 hour, then at 4-hour intervals subsequently. We scored the
number of cells that had both TUNEL and BrdU labeling
(Fig. 6E,F). This revealed that
BrdU-labeled, apoptotic cells rose to a peak, 17 hours after the BrdU
injection (Fig. 6I, red line).
The existence of this peak indicates that cell death is dependent on cell
cycle stage. By scoring the occurrence of paired, BrdU-labeled nuclei that are
the products of cell division (Fig.
6G,H), we were also able to define when, on average, the cohort of
BrdU-labeled cells left M phase and entered G1 phase. The peak of G1 phase
daughter cells corresponded with the peak of BrdU-positive, apoptotic cells at
17 hours after BrdU (Fig. 6J,
red line). These data (confirmed in two independent experiments) indicate that
cell cycle progression and cell death are coupled, and that cells die from G1
phase of the cell cycle.
To examine the role of the angiopoietin pathway in regulating cell cycle
stage-dependent cell death we injected Ang1 intra-vitreally into the right eye
of each animal 6 hours after the BrdU injection. This resulted in the absence
of a cell death peak at 17 hours (Fig.
6I, blue line) but did not significantly influence the appearance
of daughter pairs (Fig. 6J,
blue line). These data indicate that Ang1 suppresses cell death and that the
effects of this are observed in the G1 phase of the cell cycle. Combined with
previous work (Lobov et al.,
2005) these experiments show that the Wnt and angiopoietin
pathways are integrated through the cell cycle - Wnt7b promotes cell cycle
entry and Ang2 promotes cell death from G1 phase.
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Mechanism of the cell death switch
Current data indicate that cell cycle entry is a crucial element of the
switch because it is a precondition for cell death, an observation consistent
with coupling between cell cycle progression and cell death in other systems
(Lowe et al., 2004). In the
hyaloid vessels, Wnt pathway activation is a stimulus for cell cycle entry and
essential for cell death (Lobov et al.,
2005). An explanation for the Wnt pathway requirement emerges from
the demonstration that hyaloid VECs die from G1 phase of the cell cycle when
Ang2 suppresses survival signaling (Fig.
6).
|
)] to sensitize cells to pro-apoptotic stimuli (including
survival signal withdrawal) through enhanced cytochrome C release and caspase
9 activation (Evan and Vousden,
2001). Furthermore, in many settings where proliferating cells
die, they do so at cell cycle checkpoints. The p53 genotoxic damage control
checkpoint (Sherr and Roberts,
1995) and the so-called Restriction Point
(Pardee, 1989;
Planas-Silva and Weinberg,
1997) at which survival factors are critical
(Zhu et al., 1996;
Assoian, 1997;
Planas-Silva and Weinberg,
1997) can result in apoptosis in G1 phase of the cell cycle.
A hyaloid VEC will survive (death switch in the off position,
Fig. 7A) when Ang1 is the
predominant influence. This activates Akt and suppresses cell death,
presumably through the well-described inhibition of the pro-apoptotic
mediators FoxO and Bad (Datta et al.,
1999). Our data also indicate that activation of the angiopoietin
pathway is accompanied by proliferation. In this system, proliferation is at
least partly a consequence of Akt-mediated stabilization and nuclear
translocation of β-catenin (Fig.
7A).
When the death switch is in the on position
(Fig. 7B) Ang2 has two
functions. The first function is to suppress Akt activity and promote cell
death (Datta et al., 1999).
However, in suppressing Akt, Ang2 also eliminates the cell cycle entry
stimulus (via β-catenin) that is a pre-requisite for cell death. Thus,
the second function of Ang2, which is upregulation of macrophage
Wnt7b expression, appears to be an adaptation to provide an
alternative pathway to stimulate cell cycle entry and coupled cell death. How
Ang2 upregulates Wnt7b expression in macrophages is currently unclear. This
could be an indirect consequence of VECs producing a signaling molecule in
response to Ang2 ligation of Tie2. Alternatively, macrophages might respond
directly to the presence of Ang2 through the integrins that represent
alternative receptors for the angiopoietins
(Carlson et al., 2001;
Camenisch et al., 2002;
Cascone et al., 2005).
|
).
Indeed, the ability of macrophages to identify, engulf and dispose of foreign
matter and apoptotic cells gives them a crucial role in tissue homeostasis.
Even a modest reduction in this function can result in the chronic
inflammation that promotes diseases such as cancer and diabetes
(Wellen and Hotamisligil,
2005; Condeelis and Pollard,
2006). Being widely distributed and highly mobile, macrophages are
perfectly suited to this homeostatic function.
|
) and
superoxide ions where microglia signal apoptosis of Purkinje cells in mouse
brain slice cultures (Marin-Teva et al.,
2004; Mallat et al.,
2005). An additional example - where the dead cell recognition
machinery is a back-up pathway for caspase pathway activation in C.
elegans - is important because it implies that phagocyte-induced cell
death is a highly conserved activity that will probably be found throughout
the metazoans (Hoeppner et al.,
2001; Reddien et al.,
2001).
In the current work we describe a cell death signaling mechanism that
involves three cell types, the pericyte, the macrophage and the vascular
endothelial cell. Ang2, which is probably produced by pericytes, is a critical
initiator of a switch in the pattern of signaling that results in VEC cell
cycle entry and cell death (Fig.
7). In this system, the macrophage is the critical source of Wnt7b
(Lobov et al., 2005) that is
required for VEC cell cycle entry. In turn, Wnt7b expression in
macrophages requires Ang2. This arrangement of regulatory interactions means
that participation of the macrophage is obligatory. If the macrophage is
absent, there would be no source of Wnt7b to stimulate cell cycle entry, and
no cell death. Ang2-dependent Wnt7b expression may represent the
optimal way to ensure that when cell death occurs the macrophage and its dead
cell recognition and disposal capabilities are present. We anticipate that
this or related mechanisms may be generally applicable.
Macrophages have been implicated in a variety of diseases, often where
angiogenesis is a prominent component of the disease process. One example is
the vision-compromising choroidal neovascularization that occurs in the wet
form of age-related macular degeneration (AMD)
(Ferrara and Kerbel, 2005). In
this setting, according to depletion experiments
(Espinosa-Heidmann et al.,
2003; Sakurai et al.,
2003) macrophages enhance the formation of new blood vessels.
Another example is the activity of tumor-associated macrophages (TAMs) in
enhancing tumor angiogenesis and tumor progression
(Condeelis and Pollard, 2006).
In a mouse breast cancer model that closely mimics the human disease
(Lin et al., 2003), macrophage
deficiency leads to tumors that are poorly vascularized and in a response that
is probably related, essentially non-metastatic
(Lin et al., 2006).
In diseases like AMD and cancer where macrophages play a prominent role, it will be interesting to determine whether macrophage production of Wnt ligands is a factor contributing to disease progression. Based on the current work, macrophage Wnts are a stimulus for VEC proliferation and in the absence of a second, modulating signal (Ang2 in the hyaloid system, Fig. 7) could stimulate angiogenesis and promote disease progression. Further work will be needed to address these questions.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Assoian, R. K. (1997). Anchorage-dependent cell
cycle progression. J. Cell Biol.
136, 1-4.
Camenisch, G., Pisabarro, M. T., Sherman, D., Kowalski, J.,
Nagel, M., Hass, P., Xie, M. H., Gurney, A., Bodary, S., Liang, X. H. et
al. (2002). ANGPTL3 stimulates endothelial cell adhesion and
migration via integrin alpha vbeta 3 and induces blood vessel formation in
vivo. J. Biol. Chem.
277,17281
-17290.
Carlson, T. R., Feng, Y., Maisonpierre, P. C., Mrksich, M. and
Morla, A. O. (2001). Direct cell adhesion to the
angiopoietins mediated by integrins. J. Biol. Chem.
276,26516
-26525.
Cascone, I., Napione, L., Maniero, F., Serini, G. and Bussolino,
F. (2005). Stable interaction between alpha5beta1 integrin
and Tie2 tyrosine kinase receptor regulates endothelial cell response to
Ang-1. J. Cell Biol.
170,993
-1004.
Castillo, S. S., Brognard, J., Petukhov, P. A., Zhang, C.,
Tsurutani, J., Granville, C. A., Li, M., Jung, M., West, K. A., Gills, J. G.
et al. (2004). Preferential inhibition of Akt and killing of
Akt-dependent cancer cells by rationally designed phosphatidylinositol ether
lipid analogues. Cancer Res.
64,2782
-2792.
Condeelis, J. and Pollard, J. W. (2006). Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 124,263 -266.[CrossRef][Medline]
Corbel, S. Y. and Rossi, F. M. (2002). Latest developments and in vivo use of the Tet system: ex vivo and in vivo delivery of tetracycline-regulated genes. Curr. Opin. Biotechnol. 13,448 -452.[CrossRef][Medline]
DasGupta, R. and Fuchs, E. (1999). Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126,4557 -4568.[Abstract]
Datta, S. R., Brunet, A. and Greenberg, M. E.
(1999). Cellular survival: a play in three Akts. Genes
Dev. 13,2905
-2927.
De Palma, M., Venneri, M. A., Galli, R., Sergi Sergi, L., Politi, L. S., Sampaolesi, M. and Naldini, L. (2005). Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors. Cancer Cell 8,211 -226.[CrossRef][Medline]
Diez-Roux, G. and Lang, R. A. (1997). Macrophages induce apoptosis in normal cells in vivo. Development 124,3633 -3638.[Abstract]
Diez-Roux, G., Argilla, M., Makarenkova, H., Ko, K. and Lang, R. A. (1999). Macrophages kill capillary cells in G1 phase of the cell cycle during programmed vascular regression. Development 126,2141 -2147.[Abstract]
Dumont, D. J., Gradwohl, G., Fong, G. H., Puri, M. C.,
Gertsenstein, M., Auerbach, A. and Breitman, M. L. (1994).
Dominant-negative and targeted null mutations in the endothelial receptor
tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo.
Genes Dev. 8,1897
-1909.
Espinosa-Heidmann, D. G., Suner, I. J., Hernandez, E. P.,
Monroy, D., Csaky, K. G. and Cousins, S. W. (2003).
Macrophage depletion diminishes lesion size and severity in experimental
choroidal neovascularization. Invest. Ophthalmol. Vis.
Sci. 44,3586
-3592.
Evan, G. I. and Vousden, K. H. (2001). Proliferation, cell cycle and apoptosis in cancer. Nature 411,342 -348.[CrossRef][Medline]
Feistritzer, C., Mosheimer, B. A., Sturn, D. H., Bijuklic, K., Patsch, J. R. and Wiedermann, C. J. (2004). Expression and function of the angiopoietin receptor Tie-2 in human eosinophils. J. Allergy Clin. Immunol. 114,1077 -1084.[CrossRef][Medline]
Ferrara, N. and Kerbel, R. S. (2005). Angiogenesis as a therapeutic target. Nature 438,967 -974.[CrossRef][Medline]
Frade, J. M., Rodriguez-Tebar, A. and Barde, Y. A. (1996). Induction of cell death by endogenous nerve growth factor through its p75 receptor. Nature 383,166 -168.[CrossRef][Medline]
Fukumoto, S., Hsieh, C. M., Maemura, K., Layne, M. D., Yet, S.
F., Lee, K. H., Matsui, T., Rosenzweig, A., Taylor, W. G., Rubin, J. S. et
al. (2001). Akt participation in the Wnt signaling pathway
through Dishevelled. J. Biol. Chem.
276,17479
-17483.
Gale, N. W., Thurston, G., Hackett, S. F., Renard, R., Wang, Q., McClain, J., Martin, C., Witte, L., Witte, M. H., Jackson, D. et al. (2002). Angiopoietin-2 is required for postnatal angiogenesis and lymphatic patterning, and only the latter is rescued by Angiopoietin-1. Dev. Cell 3,411 -423.[CrossRef][Medline]
He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da
Costa, L. T., Morin, P. J., Vogelstein, B. and Kinzler, K. W.
(1998). Identification of c-MYC as a target of the APC pathway.
Science 281,1509
-1512.
Hoeppner, D. J., Hengartner, M. O. and Schnabel, R. (2001). Engulfment genes cooperate with ced-3 to promote cell death in Caenorhabditis elegans. Nature 412,202 -206.[CrossRef][Medline]
Ito, M. and Yoshioka, M. (1999). Regression of the hyaloid vessels and pupillary membrane of the mouse. Anat. Embryol. 200,403 -411.[CrossRef][Medline]
Iwama, A., Hamaguchi, I., Hashiyama, M., Murayama, Y., Yasunaga, K. and Suda, T. (1993). Molecular cloning and characterization of mouse TIE and TEK receptor tyrosine kinase genes and their expression in hematopoietic stem cells. Biochem. Biophys. Res. Commun. 195,301 -309.[CrossRef][Medline]
Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H.,
Glass, D. A., 2nd, Hartmann, C., Li, L., Hwang, T. H., Brayton, C. F. et
al. (2002). Cbfa1-independent decrease in osteoblast
proliferation, osteopenia, and persistent embryonic eye vascularization in
mice deficient in Lrp5, a Wnt coreceptor. J. Cell
Biol. 157,303
-314.
Kim, I., Kim, H. G., So, J. N., Kim, J. H., Kwak, H. J. and Koh,
G. Y. (2000a). Angiopoietin-1 regulates endothelial cell
survival through the phosphatidylinositol 3'-Kinase/Akt signal
transduction pathway. Circ. Res.
86, 24-29.
Kim, I., Kim, J. H., Moon, S. O., Kwak, H. J., Kim, N. G. and Koh, G. Y. (2000b). Angiopoietin-2 at high concentration can enhance endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Oncogene 19,4549 -4552.[CrossRef][Medline]
Kozikowski, A. P., Sun, H., Brognard, J. and Dennis, P. A. (2003). Novel PI analogues selectively block activation of the pro-survival serine/threonine kinase Akt. J. Am. Chem. Soc. 125,1144 -1145.[CrossRef][Medline]
Lang, R. A. and Bishop, M. J. (1993). Macrophages are required for cell death and tissue remodeling in the developing mouse eye. Cell 74,453 -462.[CrossRef][Medline]
Lin, E. Y., Jones, J. G., Li, P., Zhu, L., Whitney, K. D.,
Muller, W. J. and Pollard, J. W. (2003). Progression to
malignancy in the polyoma middle T oncoprotein mouse breast cancer model
provides a reliable model for human diseases. Am. J.
Pathol. 163,2113
-2126.
Lin, E. Y., Li, J. F., Gnatovskiy, L., Deng, Y., Zhu, L.,
Grzesik, D. A., Qian, H., Xue, X. N. and Pollard, J. W.
(2006). Macrophages regulate the angiogenic switch in a mouse
model of breast cancer. Cancer Res.
66,11238
-11246.
Lobov, I. B., Brooks, P. C. and Lang, R. A.
(2002). Angiopoietin-2 displays VEGF-dependent modulation of
capillary structure and endothelial cell survival in vivo. Proc.
Natl. Acad. Sci. USA 99,11205
-11210.
Lobov, I. B., Rao, S., Carroll, T. J., Vallance, J. E., Ito, M., Ondr, J. K., Kurup, S., Glass, D. A., Patel, M. S., Shu, W. et al. (2005). WNT7b mediates macrophage-induced programmed cell death in patterning of the vasculature. Nature 437,417 -421.[CrossRef][Medline]
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 20,781 -810.[CrossRef][Medline]
Lowe, S. W., Cepero, E. and Evan, G. (2004). Intrinsic tumour suppression. Nature 432,307 -315.[CrossRef][Medline]
Lucas, M., Stuart, L. M., Savill, J. and Lacy-Hulbert, A.
(2003). Apoptotic cells and innate immune stimuli combine to
regulate macrophage cytokine secretion. J. Immunol.
171,2610
-2615.
Maisonpierre, P. C., Suri, C., Jones, P. F., Bartunkova, S.,
Wiegand, S. J., Radziejewski, C., Compton, D., McClain, J., Aldrich, T. H.,
Papadopoulos, N. et al. (1997). Angiopoietin-2, a natural
antagonist for Tie2 that disrupts in vivo angiogenesis.
Science 277,55
-60.
Mallat, M., Marin-Teva, J. L. and Cheret, C. (2005). Phagocytosis in the developing CNS: more than clearing the corpses. Curr. Opin. Neurobiol. 15,101 -107.[CrossRef][Medline]
Marin-Teva, J. L., Dusart, I., Colin, C., Gervais, A., van Rooijen, N. and Mallat, M. (2004). Microglia promote the death of developing Purkinje cells. Neuron 41,535 -547.[CrossRef][Medline]
Meeson, A. P., Argilla, M., Ko, K., Witte, L. and Lang, R. A. (1999). VEGF deprivation-induced apoptosis is a component of programmed capillary regression. Development 126,1407 -1415.[Abstract]
Moore, K. A. and Lemischka, I. R. (2006). Stem
cells and their niches. Science
311,1880
-1885.
Ohlmann, A. V., Adamek, E., Ohlmann, A. and Lutjen-Drecoll,
E. (2004). Norrie gene product is necessary for regression of
hyaloid vessels. Invest. Ophthalmol. Vis. Sci.
45,2384
-2390.
Pardee, A. B. (1989). G1 events and regulation
of cell proliferation. Science
246,603
-608.
Peters, K. G., Kontos, C. D., Lin, P. C., Wong, A. L., Rao, P.,
Huang, L., Dewhirst, M. W. and Sankar, S. (2004). Functional
significance of Tie2 signaling in the adult vasculature. Recent
Prog. Horm. Res. 59,51
-71.
Planas-Silva, M. D. and Weinberg, R. A. (1997). The restriction point and control of cell proliferation. Curr. Opin. Cell Biol. 9,768 -772.[CrossRef][Medline]
Reddien, P. W., Cameron, S. and Horvitz, H. R. (2001). Phagocytosis promotes programmed cell death in C. elegans. Nature 412,198 -202.[CrossRef][Medline]
Sakurai, E., Anand, A., Ambati, B. K., van Rooijen, N. and
Ambati, J. (2003). Macrophage depletion inhibits experimental
choroidal neovascularization. Invest. Ophthalmol. Vis.
Sci. 44,3578
-3585.
Savill, J., Dransfield, I., Gregory, C. and Haslett, C. (2002). A blast from the past: clearance of apoptotic cells regulates immune responses. Nat. Rev. Immunol. 2, 965-975.[CrossRef][Medline]
Schlaeger, T. M., Bartunkova, S., Lawitts, J. A., Teichmann, G.,
Risau, W., Deutsch, U. and Sato, T. N. (1997). Uniform
vascular-endothelial-cell-specific gene expression in both embryonic and adult
transgenic mice. Proc. Natl. Acad. Sci. USA
94,3058
-3063.
Sharma, M., Chuang, W. W. and Sun, Z. (2002).
Phosphatidylinositol 3-kinase/Akt stimulates androgen pathway through GSK3beta
inhibition and nuclear beta-catenin accumulation. J. Biol.
Chem. 277,30935
-30941.
Sherr, C. J. and Roberts, J. M. (1995).
Inhibitors of mammalian G1 cyclin-dependent kinases. Genes
Dev. 9,1149
-1163.
Shu, W., Jiang, Y. Q., Lu, M. M. and Morrisey, E. E. (2002). Wnt7b regulates mesenchymal proliferation and vascular development in the lung. Development 129,4831 -4842.[Medline]
Sun, J. F., Phung, T., Shiojima, I., Felske, T., Upalakalin, J.
N., Feng, D., Kornaga, T., Dor, T., Dvorak, A. M., Walsh, K. et al.
(2005). Microvascular patterning is controlled by fine-tuning the
Akt signal. Proc. Natl. Acad. Sci. USA
102,128
-133.
Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C., Davis, S., Sato, T. N. and Yancopoulos, G. D. (1996). Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 87,1171 -1180.[CrossRef][Medline]
Tauber, A. I. (2003). Metchnikoff and the phagocytosis theory. Nat. Rev. Mol. Cell Biol. 4, 897-901.[CrossRef][Medline]
Wellen, K. E. and Hotamisligil, G. S. (2005). Inflammation, stress, and diabetes. J. Clin. Invest. 115,1111 -1119.[CrossRef][Medline]
Yancopoulos, G. D., Davis, S., Gale, N. W., Rudge, J. S., Wiegand, S. J. and Holash, J. (2000). Vascular-specific growth factors and blood vessel formation. Nature 407,242 -248.[CrossRef][Medline]
Ylikarppa, R., Eklund, L., Sormunen, R., Kontiola, A. I.,
Utriainen, A., Maatta, M., Fukai, N., Olsen, B. R. and Pihlajaniemi, T.
(2003). Lack of type XVIII collagen results in anterior ocular
defects. FASEB J. 17,2257
-2259.
Zhu, X., Ohtsubo, M., Bohmer, R. M., Roberts, J. M. and Assoian,
R. K. (1996). Adhesion-dependent cell cycle progression
linked to the expression of cyclin D1, activation of cyclin E-cdk2, and
phosphorylation of the retinoblastoma protein. J. Cell
Biol. 133,391
-403.
Related articles in Development:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
0.01, >0.001; ***P
