|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online November 26, 2007
doi: 10.1242/10.1242/dev.008979
1 Department of Physiology, Faculty of Medicine, University of Toronto, Toronto,
M5S 1A8, Canada.
2 Molecular and Medical Genetics, Faculty of Medicine, University of Toronto,
Toronto, M5S 1A8, Canada.
3 Mount Sinai Hospital, Toronto, Canada.
* Author for correspondence (e-mail: zp.feng{at}utoronto.ca)
Accepted 13 September 2007
| SUMMARY |
|---|
|
|
|---|
Key words: NCS-1, Neurite outgrowth, Activity-dependent calcium signals, fura-2 imaging, Lymnaea stagnalis
| INTRODUCTION |
|---|
|
|
|---|
Neuronal calcium sensor-1 (NCS-1) is a member of a superfamily of proteins
that respond to local Ca2+ changes
(Ames et al., 1997
;
Tanaka et al., 1995
). It
interacts with a variety of proteins that are involved in Ca2+
homeostasis (Burgoyne, 2004
).
In particular, NCS-1 modulation of L-
(Rousset et al., 2003
), non-L-
(Weiss et al., 2000
), N-
(Rousset et al., 2003
;
Wang et al., 2001
) and
P/Q-type Ca2+ channels (Rousset
et al., 2003
; Tsujimoto et
al., 2002
; Weiss and Burgoyne,
2001
) directly changes intracellular Ca2+ levels. It
also affects intracellular Ca2+ concentration directly by
modulating Ca2+-permeable transient receptor potential (TRP)
channels (Hui et al., 2006
)
and InsP3 receptor activity (Schlecker et
al., 2006
), and indirectly by affecting K+ channel
expression and function (Guo et al.,
2002
; Nakamura et al.,
2001
). It interacts with signaling-transduction pathways that are
known to affect ion channel activity or expression, including dopamine
receptors, G-protein dependent receptor kinase 2
(Kabbani et al., 2002
) and
cyclic nucleotide phosphodiesterase
(Schaad et al., 1996
), and to
regulate exocytosis via phosphatidylinositol-4 kinase β
(Kapp-Barnea et al., 2003
;
Taverna et al., 2002
;
Zhao et al., 2001
). Thus,
NCS-1 is a likely candidate for dynamically regulating cytosolic
Ca2+ levels.
There is compelling evidence that NCS-1 is involved in neurite development
in a few systems. For instance, NCS-1 expression increases in grey matter and
decreases in white matter during embryogenesis and early postnatal stages
(Kawasaki et al., 2003
).
Overexpression of NCS-1 in NG108-15/rat myotube co-cultures
(Chen et al., 2001
), and of
the Drosophila homologue Frequenin (Frq) in motor nerve terminals
(Angaut-Petit et al., 1998
),
reduces the number of neurites. More recently, NCS-1 was shown to impede
neurite extension without altering branching in NGF-treated PC12 cells by
potentiating TRPC5-evoked Ca2+ currents
(Hui et al., 2006
). However,
there has been no study to examine if and how NCS-1 is involved in regulation
of the window level of Ca2+ permissive to neurite outgrowth.
In this study, we examined the affects of NCS-1 on intracellular Ca2+ and neurite outgrowth in cultured L. stagnalis snail PeA neurons. Using RNA interference, we found that NCS-1 knockdown enhanced neurite extension and branching, and reduced activity-dependent Ca2+ influx in growth cones. Using a C-terminal peptide of NCS-1, we show that the C-terminus modulates growth cone whole-cell voltage-dependent Ca2+ currents and enhances neurite branching. Our findings indicate that NCS-1 modulates neurite branching and extension by regulating Ca2+ influx through at least two mechanisms: one that specifically affects branching, and another that specifically affects extension.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning
mRNA was extracted from three snail central ring ganglia using the Qiagen
RNeasy Mini Kit (Qiagen, Ontario, Canada). We first cloned a partial fragment
of L. stagnalis NCS-1 using first-strand cDNA using Transcriptor
reverse transcriptase (Roche Applied Sciences, Quebec, Canada) primed with
random 9-mers at 40°C for 25 minutes, then incubated at 70°C for 2
hours. PCR reactions (25 µl) contained cDNA, forward
(5'-TACAARCAGTTCTTCCCATTTGGAGACCC-3') and reverse
(5'-CCATCGTTATCCAGATCATACAGAYKRAANGCCCA-3') degenerate primers, to
generate an amplicon of
300 bp. The PCR cycle consisted of a 10-minute
enzyme-activation step at 94°C, followed by 45 cycles of 30 seconds at
94°C, 30 seconds at 60°C, and 2 minutes at 70°C, with a final
extension step at 70°C for 3 minutes. Utilizing the forward primer, DNA
sequencing confirmed the identity of the PCR product. Cloning of the
full-length NCS-1 gene was by 3' and 5' rapid
amplification of cDNA ends (RACE) following the SuperSMART PCR cDNA Synthesis
Kit (Clontech, Mountain View, CA) in a two-step PCR protocol with some
changes. First-strand cDNA was synthesized as described in the kit using the
included SMART CDS primer, followed by amplification with the included primer
2A. In the first PCR step, a gene-specific primer
(Table 1) was designed based on
the partial clone and run with primer-1
(5'-CGACGTGGACTATCCATGAACGCAAAGCAGTGGTATCAACGCAGAGT-3'), which
overlaps with the 5' end of primer 2A. In the second PCR step, a nested
gene-specific primer (Table 1)
was designed based on the partial clone and run with primer-2
(5'-TCGAGCGGCCGCCCGGGCAGGTCGACGTGGACTATCCATGAACGCA-3'), which
overlaps with the 5' end of primer-1. The 5' end was cloned in a
similar manner, except that a modified random 15-mer
(5'-AAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNN-3') was used to prime
first-strand synthesis in a reverse transcription at 25°C for 10 minutes
prior to a 42°C incubation for 90 minutes. The PCR cycle used in RACE
consisted of a 5 minute enzyme-activation step at 94°C, followed by 30
cycles of 30 seconds at 94°C, 30 seconds at 55°C, and 3 minutes at
72°C, with a final extension step at 72°C for 5 minutes. RACE products
were confirmed by sequencing. Table
1 lists the gene-specific primers used in RACE. A full-length
clone of 704 bp was cloned, coding for a 191 amino acid protein (GenBank
DQ099793).
|
-helices in the CTN at room temperature, similar to those seen
in the NCS-1 C-terminus (not shown), indicating that the TAT PTD domain did
not alter the conformation of the rest of the peptide.
dsRNA construct
Based on the L. stagnalis NCS-1 sequence we cloned, we designed a
27-mer NCS-1-specific dsRNA using SciTools RNAi Design software (IDT
DNA); we purchased this dsRNA from IDT DNA
(Kim et al., 2005
). TriFECTa
control dsRNA was used as a control in our experiments (IDT DNA). The
sequences for each dsRNA are as follows: LNCS dsRNA
5'GUCCUUAUUCUCGUCGAAGACGUUGAA/5P-CAACGUCUUCGACGAGAAUAAGGd AdC, TriFECTa
control 5'UCACAAGGGAGAGAAAGAGAGGAAGGA/5P-CUUCCUCUCUUUCUCUCCCUUGUdGdA,
where 5P represents a 5' phosphate, and dN represents a deoxynucleotide;
the other bases in these 27-mers were ribonucleotides. For whole animal
knockdown experiments, snails were pinned onto a dissection board, and
injected in the head, above the central ganglia, with 2 µl of 20 µM
NCS-1 dsRNA, control dsRNA or 2 µl water. Two days after the
injections, animals were sacrificed and separated for western blot analyses
into four groups of two for each treatment.
Western blot analysis
Protein extracts were prepared from snail ganglia and from rat brain
(Sprague-Dawley, Charles River Lab, Wilmington, MA). Western blots were
performed using NuPAGE Novex Bis-Tris Gel (Invitrogen, Ontario, Canada)
following the manufacturer's instructions. Specifically, extract samples
containing 20 µg protein were separated by electrophoresis on a NuPAGE
Novex Bis-Tris Gel in MES running buffer, and were then electrophoretically
transferred from the gel to a 0.2 µm PVDF membrane (Invitrogen). Membranes
were incubated with 5% blocking solution overnight at 4°C, followed by
incubation with rabbit polyclonal anti-rat NCS-1 antibody (diluted 1:500;
Biomol, Plymouth Meeting, PA) in 3% blocking solution for 2 hours at room
temperature. After washing, membranes were incubated with horseradish
peroxidase-conjugated rabbit secondary antibody (diluted 1:5000; Chemicon,
Temecula, CA) in 3% blocking solution for 2 hours at room temperature.
Antibody-labelled protein bands were visualized using an enhanced
chemiluminescent reagent (Amersham Biosciences, Ontario, Canada), and analyzed
by scanning densitometry with Kodak 1D image analysis software (Eastman Kodak,
USA). Mouse anti-actin antibody (1:500; Chemicon, CA) was used as a
control.
Immunocytochemistry and confocal imaging
Cultured PeA cells were fixed with 1% paraformaldehyde in snail saline
solution lacking NaCl overnight at 4°C. Cells were then washed three times
with snail saline, and incubated with rabbit polyclonal anti-rat NCS-1
antibody (diluted 1:300) in snail saline solution containing 0.3% Trition
X-100 and 0.5% BSA overnight at 4°C. Following three washes with snail
saline, cells were incubated with FITC-conjugated anti-rabbit secondary
antibody (diluted 1:600; Chemicon) for 2 hours at 20°C. After three washes
with snail saline, and one wash with distilled water, the preparation was
mounted with permafluor (Fisher Scientific, Canada). Confocal images of NCS-1
reactivity were acquired using a TCS SL laser confocal microscope (Leica
Confocal Software, version 2.5, build 1347, Leica Microsystems, Germany).
z-series scan images of labelled cells were viewed under a 40x
oil immersion lens using a He-Ne laser. The FITC-conjugated fluorophore was
excited at 483 nm, and peak intensity emissions were determined at 543 nm.
z-series scans of the cells were performed at a zoom level that
afforded the largest possible view of cells and their neurites. Each plane was
averaged three times using a step size between each plane of approximately 0.5
µm. Background fluorescence was determined using three regions not
encompassing cells throughout the entire z-stack. Confocal data were
analysed using LCS Lite Leica Confocal Software. In the double-labelled
experiments, in addition to the rat-NCS-1 antibody, mouse β-actin
antibody (diluted 1:500; Chemicon) was also incubated with the cells followed
by Alexa-568-conjugated goat anti-mouse antibody (diluted 1:800; Molecular
Probes) in the same manner as the rat NCS-1 antibody.
Neurite growth
PeA cells were cultured in CM at 20°C for 24-36 hours. Cells were then
treated without or with 5 nM NCS-1 dsRNA, 5 nM control dsRNA, 50
µM CTN or 50 µM scrambled CTN. Neurite growth pattern images were
collected at the time of treatment, and at several later timepoints, through
22 hours, using an Olympus inverted microscope (CK X41) with an Olympus C5050
digital camera. Images were analysed using ImageTool 3.1 software. We
considered branches to be outgrowths when segments were longer than 10 µm.
Using the 40x objective, neurite lengths were measured from the edge of
the somata to the visible tip of the growth cone. Neurite extension rates were
defined as the difference between the current and previous lengths divided by
the time elapsed between the two measurements.
Intracellular recording and ratiometric fura-2 Ca2+ imaging
Intracellular Ca2+ ([Ca]i) was measured as described
previously using a fura-2 ratiometric Ca2+ imaging system
(Feng et al., 2002
). Cells
were incubated for 30 minutes with 4 µM Fura-2 AM (Molecular Probes), and
then washed with snail saline three times before imaging. The experiments were
carried out in the dark to prevent photobleaching of the dye. Fura-2 was
alternately excited at 340 and 380 nm by illumination generated by a 100 W
Hg/Xe-arc lamp that had passed through 340 and 380 nm excitation filters; this
process was controlled by Image Pro 5 software (PTI). The fluorescence signal
was reflected via a 430 nm dichroic mirror, passed through a 510 nm emission
filter and detected and digitized by an intensified charged-coupled device
(ICCD) camera (Roper Scientific) in Image Pro 5 at 1-10 Hz. The fluorescence
intensity (Poenie-Tsien) ratios of images acquired at 340 and 380 nm were
calculated using Image Pro 5. Cells were stimulated by action potentials
generated by 1 second depolarizing current pulses (Axopatch 700B controlled by
Clampex, Axon Instruments) from a sharp electrode containing a saturated
solution of KCl or K2SO4. The number of action
potentials used was controlled by changing the amplitude of the current
pulses. The fluorescent signal evoked by the action potentials was recorded
with a time-lapse protocol. The peak fluorescent signal was measured and
compared under various conditions. The bath solution was composed of snail
saline. The fluorescence ratio intensity (340:380) was estimated as described
by Grynkiewicz et al. (Grynkiewicz et al.,
1985
), assuming a Kd of 224 nM.
Voltage-clamp recording
Whole-cell (ruptured) patch-clamp recordings were performed on growth cone
regions using an Axopatch 700A amplifier connected to an analogue-to-digital
interface Digidata 1322 that was linked to a personal computer running pClamp9
(Axon Instruments, Foster City, CA). Patch pipettes (Sutter borosilicate
glass, BF 150-86-15; Novato, CA) were pulled using a Sutter P-87
microelectrode puller, and subsequently fire polished using a Narashige
microforge (Narishige), as described previously
(Hui et al., 2005
). Pipettes
(4-10 M
) were filled with solution, containing 29 mM CsCl, 2.3 mM
CaCl2, 2 mM MgATP, 0.1 mM GTP-Tris, 11 mM EGTA and 10 mM HEPES,
adjusted to pH 7.4 with CsOH. Currents were recorded during perfusion with a
Ca2+ solution containing 10 mM CaCl2, 45.7 mM TEA-Cl, 1
mM MgCl2, 10 mM HEPES and 2 mM 4-AP, adjusted to pH 7.9 with
TEA-OH. Currents were elicited by stepping from a holding potential of -100 mV
to the test potential using Clampex (Axon Instruments).
Growth cones were transected with a glass pipette and included adjacent neurite. srCTN, or CTN, was added to the cell-culture dish, and sometimes the recording pipette solution. Data were filtered at 1 kHz (-3 dB) using a 4-pole Bessel filter, and digitized at a sampling frequency of 2 kHz. Data were analysed using Clampfit (Axon Instruments). All curve fittings were carried out using Origin 7 (Microcal Origin, MA). Current-voltage relations were fit to the modified Boltzmann equation: {1/[1+exp(-(V-Vh)/S)]}*(V-Vrev)*G, where V is the applied voltage, Vh is the half-activation voltage, S is the slope factor, Vrev is the reversal potential and G is the slope conductance. All experiments were performed at room temperature (20-25°C).
Data analysis and statistics
Unless otherwise stated, data are presented as the mean±s.e.m.
Statistical analyses were carried out using SigmaStat 3.0 (Jandel Scientific,
Chicago, IL). Differences between mean values from each experimental group
were tested using a Student's t-test for two groups or one-way
analysis of variance (ANOVA, Holm-sidak or Tukey method) for multiple
comparisons. Differences were considered significant if
P<0.05.
| RESULTS |
|---|
|
|
|---|
300 bp DNA segment from L. stagnalis brain. This was
followed by 5' and 3' RACE to yield a gene encoding for a 191
amino acid protein (GenBank Accession no. DQ099793). The sequence of this
L. stagnalis protein is most similar to that of the Aplysia
californica aplycalcin protein (Dyer
et al., 1996
If NCS-1 is involved in neurite outgrowth, it should be expressed in growth
cones. We examined the expression pattern of NCS-1 in L. stagnalis
pedal A (PeA) neurons by immunocytochemistry and confocal fluorescence
imaging. PeA neurons cultured for 3 days in CM showed NCS-1 immunoreactivity
in neurites and soma (Fig. 1C).
In contrast to previous studies (Bourne et
al., 2001
; O'Callaghan et al.,
2002
), immunoreactivity was diffusely distributed throughout the
cytosol rather than being most intense in the membranes. This pattern is
similar to that seen in Aplysia
(Dyer et al., 1996
) and may
indicate that the N-terminal myristoylation domain, which mediates membrane
localization for other NCS proteins (Ames
et al., 1995
), is concealed at resting levels of Ca2+.
Relative to primary neurites (Fig.
1D, n=5), NCS-1 expression levels were significantly
higher in somata (2.95±0.39, P<0.05), growth cones
(1.89±0.1, P<0.05) and branch points (1.91±0.3,
P<0.05). Secondary neurites showed slightly higher levels
(1.27±0.3) but not significantly different from those observed in
primary neurites. The higher levels of NCS-1 observed in growth cones and
branching points reaffirm the notion that the protein is involved in neurite
outgrowth.
NCS-1 knockdown affects both neurite elongation and branching
We next examined how NCS-1 affects neurite outgrowth by using a 27-mer
NCS-1-specific dsRNA molecule to knockdown the gene. Although the
27-mer design has been well established in mammalian systems
(Kim et al., 2005
), its
usefulness in invertebrates is unclear. We evaluated the effectiveness of this
dsRNA in gene silencing by injecting 2 µl of either the NCS-1
dsRNA (20 µM), or a control dsRNA (20 µM), into the snail central
ganglia and examined the protein level from brain protein extracts 2 days
later. The NCS-1 dsRNA treatment, but not control dsRNA treatment,
significantly reduced the expression of NCS-1 protein by 35.7±5.1% of
the mock group (P<0.05, n=4) without affecting that of
β-actin (Fig. 2A,B). No
significant difference was found in NCS-1 expression between the control and
mock groups.
|
30%
after the NCS-1 dsRNA treatment (soma 0.84±0.06,
n=15; neurite 0.94±0.13, n=6; branching point
0.97±0.08, n=8; and growth cone 1.10±0.16,
n=5; P<0.05) compared with the control dsRNA (soma
1.48±0.08, n=10; neurite 1.51±0.12, n=6;
branching point 1.44±0.05, n=4; and growth cone
1.60±0.12, n=6). Because the knockdown was only partial, we
anticipate that any functional differences we saw in dsRNA and control
treatments reflect only a
30% reduction in NCS-1. Having established the effectiveness of the dsRNA treatment, we examined the effects of NCS-1 knockdown on neurite outgrowth. The neurons were grown for 24 hours after isolation in order to allow for recovery and some neurite growth to which we could compare. The cells were subsequently treated with 5 nM dsRNA (NCS-1, control or mock) or water (mock) and allowed to grow for another 24 hours. The relatively short treatment period was appropriate in order to minimize variations arising from changing conditioned media, which was necessary due to evaporation. Even with only 24 hour treatment with the NCS-1 dsRNA, there was significant reduction in NCS-1 expression (Fig. 2) and change in the neuron morphology (Fig. 3A).
NCS-1 knockdown altered both neurite branching and extension in the
cultured neurons. Many cells did not sprout neurites during the first 24 hours
before dsRNA-treatment, and were not examined further. Of the remaining cells,
the number of newly formed neurite branches after NCS-1 dsRNA
treatment (3.9±0.6, n=57 cells) was significantly larger than
the control dsRNA (1.0±0.3, n=43 cells) and the mock control
(1.5±0.4, n=24 cells) treatments
(Fig. 3B). We measured the
length of the neurites before and after the treatments, and found that 75 to
80% of the neurites advanced and the remaining neurites either retracted or
remained unchanged during the period of treatment (24 hours). The fraction of
neurites which advanced was not affected by the treatments. As the
NCS-1 dsRNA treatment altered the degree of branch of the neurons and
extension of new branches requires advancement of neurites, we opted to
measure extension rates and retraction rates of individual neurites. During
this period, the average rate of growth of individual neurites was
6.44±0.49 µm/hour (n=57) in the NCS-1
dsRNA-treated neurons, 3.47±0.49 µm/hour (n=43) in the
control dsRNA-treated neurons and 3.77±0.67 µm/hour in the mock
group (Fig. 3C). This increase
was significantly greater in the NCS-1 dsRNA-treated neurons compared
with that in the control dsRNA-treated neurons and mock group
(P<0.05). The mean retraction rates varied from 0.76 to 1.16
µm/hour (mock control 1.17±0.46; control RNA 0.76±0.11;
NCS-1 RNA 0.95±0.16); the difference among the conditions,
however, was not statistically significant (P>0.05). Our findings
indicate that NCS-1 is involved in both neurite branching and extension
processes in PeA neurons, and that a reduction of
30% NCS-1 is sufficient
to influence these processes.
|
The NCS-1 C-terminal peptide reduces growth cone Ca2+ current activities
The C-terminus of NCS-1 has been shown to regulate activity-dependent
currents from presynaptic voltage-dependent Ca2+ channels
(Tsujimoto et al., 2002
).
Assuming that NCS-1 modulates growth cone Ca2+ channels similarly,
its effects on neurite outgrowth could be directly due to this modulation. To
test this hypothesis, we used a dominant-negative peptide to compete with
C-terminal NCS-1 interactions (CTN) and examined its effects on three
parameters: (1) voltage-dependent Ca2+ currents; (2)
activity-dependent Ca2+ influx; and (3) neurite outgrowth
properties.
|
|
|
The NCS-1 C-terminal peptide decreases activity-dependent Ca2+ dynamics in growth cones
We have shown that NCS-1 knockdown reduces intracellular Ca2+
influx and a peptide of its C-terminus reduces voltage-dependent
Ca2+ currents. Consequently, we asked whether the RNA interference
effects were mimicked by the C-terminal peptide. We examined the acute effects
of 50 µM CTN (or srCTN) on activity-dependent Ca2+ signals in
growth cones of PeA cells. After the peptide was added to the bath, 5 minutes
were allotted before recording to ensure that the peptide was in the cells. In
some cases, the activity-dependent Ca2+ signalling was recorded
before peptide treatment to allow for paired assessment of the changes,
avoiding any cell-specific differences.
Fig. 6A shows representative
Ca2+ signals in the neurites of a sprouted PeA cell in response to
one, three or six action potentials before and after CTN treatment. As with
the dsRNA treatments, the changes in fluorescence intensity ratio (F340/380)
in growth cones exhibited a positive linear relationship with the number of
action potentials for up to 7 Hz (Fig.
6B). After the CTN-treatment (0.019±0.002 AU/AP) this
correlation was reduced compared with control (0.037±0.004 AU/AP),
whereas srCTN-treatment did not appear to affect it (0.041±0.002
AU/AP). Comparing these slopes from several independent experiments
(Fig. 6C), the
activity-dependent Ca2+ influx in control (untreated) cells
(0.037±0.006 AU/AP; n=4) was significantly reduced by CTN
(0.021±0.003 AU/AP; n=8; P<0.05), but not by srCTN
(0.042±0.004 AU/AP, n=3), indicating that NCS-1 affects
activity-dependent Ca2+ influx in these regions. The basal
Ca2+ level under resting conditions was not significantly affected
by the peptide (control 0.89±0.07 AU; CTN 0.98±0.06 AU; srCTN
0.88±0.09 AU). Our findings indicate that the C-terminus of NCS-1 is at
least partly responsible for regulating activity-dependent
Ca2+-dynamics in growth cones.
Compared with the reduction in activity-dependent Ca2+ influx caused by NCS-1 knockdown (0.010±0.004 AU/AP), CTN appeared less effective (0.021±0.003 AU/AP). We next examined the role of CTN on neurite behaviour and asked whether CTN may mimic the dsRNA effects on neurite extension and branching.
C-terminus of NCS-1 affects neurite branching
We have shown that, similar to NCS-1 RNA knockdown, the NCS-1
C-terminus interactions affected activity-dependent Ca2+ influx and
voltage-dependent Ca2+ currents (Figs
5 and
6). We next examined whether
the NCS-1 C-terminus interactions are responsible for the effects of NCS-1
knockdown on neurite outgrowth. As in the dsRNA experiments, CTN was added to
PeA neurons 24 hours after plating the cells, and the change in outgrowth was
examined 24 hours later. Again,
80% of neurites advanced and the
remaining neurites either retracted or remained unchanged during the period of
treatment (24 hours). From cells that started with similar degrees of growth
(Fig. 7A, 0 hours), CTN-treated
cells showed more elaborate branching 24 hours after treatment than did the
controls. On average, there were significantly more new branches in
CTN-treated neurons (4.57±0.81, n=44) compared with mock
(1.50±0.39, n=24) and srCTN-treated neurons (0.83±0.25,
n=21) (Fig. 7B,
P<0.05). Treatment of srCTN had no significant effect compared to
mock. The degree of neurite branching in CTN-treated cells was similar to that
in NCS-1 dsRNA-treated cells (Fig.
3B), supporting the idea that the C-terminus of NCS-1 may be
involved in neurite branching.
|
|
Our findings are unlikely to be the result of differences in the effectiveness of delivery and efficacy between dsRNA and peptide treatments. In particular, the rates of extension and degrees of branching were measured from the same cells, even though they are differentially modulated by CTN compared with NCS-1 knockdown. These results indicate that NCS-1 affects neurite outgrowth at the level of both neurite extension and elaboration, and that C-terminal interactions are mostly involved in regulating neurite branching. Thus, distinct regions of NCS-1 appear to be differentially responsible for regulating the rate of neurite extension and the degree of neurite branching.
|
| DISCUSSION |
|---|
|
|
|---|
Ca2+ is an important regulator of neurite extension and growth
cone pathfinding (Gomez and Spitzer,
2000
). Intracellular Ca2+ transients can modulate the
rate of neuronal migration in cerebellar microexplant cultures
(Komuro and Rakic, 1996
) and
cortical cultures (Tang et al.,
2003
), and can also induce growth cone turning in cultured
Xenopus neurons (Zheng,
2000
). Neurite branching is also an activity-dependent event (see
Dent et al., 2003
). Inhibiting
neuronal activity or blocking Ca2+-conducting channels such as the
AMPA (Uesaka et al., 2005
) or
NMDA (Ruthazer et al., 2003
)
receptors suppresses branching; and repetitive Ca2+ transients
induced by netrin-1 facilitated release of intracellular Ca2+
stores promotes branching (Tang and Kalil,
2005
). In parallel with these findings, we show that NCS-1 affects
both neurite outgrowth and activity-dependent Ca2+ influx at the
growth cones.
One target of NCS-1 was recently found by others to be a canonical TRP
channel, TRPC5 (Hui et al.,
2006
). When overexpressing the dominant-negative NCS-1 mutant
E120Q in PC12 cells, the Ca2+ influx through TRPC5 was reduced and
the rate of neurite extension was enhanced, but branching was unchanged. There
are some similarities between these findings to ours. First, we found that
dsRNA knockdown of NCS-1 expression in L. stagnalis neurons
increased the rate of neurite extension. Second, in both NCS-1
knockdown and CTN treatment, the activity-dependent Ca2+ influx was
suppressed compared with untreated cells. In contrast to the NCS-1 E120Q
mutant study, we found that NCS-1 is also involved in neurite branching via
its C-terminus. We believe that this discrepancy lies in the use of different
experimental tools. The mutation in E120Q abolishes the third NCS-1 EF-hand
motif (EF-3), which is required for Ca2+-dependent conformational
changes, leaving other EF-hands and functional domains intact
(Weiss et al., 2000
). NCS-1
knockdown encompasses these effects, as it reduces the expression level of the
protein; but CTN competes with the C-terminus interactions and may not affect
EF-3 interactions. Thus, NCS-1 has two distinct effects on neurite outgrowth
properties that are mediated by different structural domains of NCS-1: one
involving EF-3 and another involving the C-terminus.
NCS-1 contains four EF-hand Ca2+-binding motifs and can
coordinate three Ca2+ ions when saturated
(Fig. 8C,D)
(Ames et al., 2000
). The first
N-terminal EF-hand (EF-1) is non-functional
(Cox et al., 1994
); the second
EF-hand (EF-2) binds Ca2+ with a relatively low affinity (Kd: 10
µM) compared with the third (EF-3) and fourth (EF-4) EF-hands (Kd: 400 nM)
(Ames et al., 2000
). Mutation
of EF-3 (E120Q) upregulates non-L-type Ca2+ channels in chromaffin
cells (Weiss et al., 2000
),
and, as mentioned above, suppresses TRPC5 channels in PC12 cells
(Hui et al., 2006
). These
opposing effects of E120Q may arise from interactions on other regions of
NCS-1. For example, the C-terminus encompassing part of EF-4 is involved in
activity-dependent facilitation of the presynaptic P/Q type Ca2+
channels in the Calyx of Held (Tsujimoto
et al., 2002
). Although Ca2+ binding to the EF-hands in
NCS-1 may be highly cooperative (Ames et
al., 2000
), these studies suggest that the different regions of
NCS-1 can function independently of each other.
The binding affinities of the EF-hands in NCS-1 appear to be compatible
with the optimal window level of Ca2+ that permits neurite
outgrowth (Kater and Mills,
1991
). In both mammalian
(Connor, 1986
) and
invertebrate cultured neurons (Cohan et
al., 1987
), intracellular Ca2+ concentrations of 40-80
nM produce stable growth cones; 100-300 nM Ca2+ concentrations
induce neurite outgrowth; and higher levels retard growth
(Kater et al., 1989
). Domains
EF-3 and EF-4 in NCS-1 have Ca2+-binding affinities around 400 nM,
just above the concentration threshold that is necessary for optimal neurite
outgrowth; and EF-2 has a binding affinity around 10 µM, which lies in the
range of outgrowth inhibition (Ames et al.,
2000
). Consequently, NCS-1 appears to have suitable structural
features to respond to levels of intracellular Ca2+ around the
optimal window necessary for neurite outgrowth.
Based on our findings, we envision a four-stage mechanism where NCS-1 is
involved in activity-dependent neurite outgrowth
(Fig. 8). First, at basal
levels of Ca2+, NCS-1 may or may not be involved in limited
outgrowth. Second, an optimal range of neuronal activity evokes
Ca2+ influx (200-300 nM) to promote both neurite extension and
branching. Higher activity, leading to higher Ca2+ influx, may
inhibit both processes through an NCS-1-dependent mechanism, as described in
stages three and four. Third, increasing Ca2+ allows it to bind to
one or more of the high-affinity sites on NCS-1, consequently inhibiting
elongation while still promoting branching. The elevation in Ca2+
in this stage may be partly due to NCS-1 facilitation of TRPC5 channels
(Hui et al., 2006
). Fourth,
raising Ca2+ to higher levels allows it to bind to the low-affinity
site on NCS-1 and also inhibit branching. The Ca2+ source at this
stage may involve NCS-1 facilitation of growth cone voltage-dependent
Ca2+ channels, leading to a positive-feedback mechanism to limit
outgrowth until the stimulus is relaxed (i.e. Ca2+ levels fall to,
and below that, of stage three). In this manner, branching and subsequent
extension could be controlled by an NCS-1-dependent mechanism involving
dynamic changes in the intracellular Ca2+ level. This simple model
emphasizes that different windows of [Ca2+]i are
permissive for neurite extension and branching, with NCS-1 modulating both
processes in a [Ca2+]i-dependent manner.
The individual stages of our model of NCS-1-dependent outgrowth can be
attributed to different regions of the protein. The third EF-hand (EF-3) was
previously shown to be selectively involved in neurite extension
(Hui et al., 2006
). Disrupting
this Ca2+-binding site, as in the E120Q mutant, prevented NCS-1
inhibition of neurite extension in stage three of the model without affecting
stage four: branching remained unaffected. In the current study, we show that
the C-terminus is selectively involved in neurite branching. Competing with
NCS-1 C-terminal interactions via the CTN peptide alleviated inhibition of
branching in stage four without affecting stage three: neurite extension
remained impeded. We show that NCS-1 is responsible for both effects, as
knockdown by RNA interference affected both stages three and four,
consequently preventing suppression of both branching and extension. As with
other functional properties of this protein
(Burgoyne et al., 2004
), the
different domains in NCS-1 appear to act independently in its modulation of
neurite outgrowth, with the third EF-hand responsible for extension and the
C-terminus responsible for branching.
The mechanism underlying neurite branching remains unclear but is thought
to be an activity-dependent event (Tang et
al., 2003
; Zheng,
2000
) (see also Dent et al.,
2003
). Our study suggests that NCS-1 is involved perhaps by
fine-tuning local Ca2+ transients. It is the spatial localization
of Ca2+ transients that determines the pathway of axonal
development. In particular, Ca2+ transients in the growth cone
stimulate axon extension (Gu and Spitzer,
1995
) and Ca2+ transients in the filopodia induce
growth cone turning (Gomez et al.,
2001
). The downstream actions of Ca2+ in neurons
include control of growth cone traction
(Conklin et al., 2005
),
polymerization of cytoskeletal structural elements
(Lautermilch and Spitzer,
2000
) and membrane insertion at growth cones
(Lockerbie et al., 1991
;
Wood et al., 1992
), which have
direct effects on neurite outgrowth behaviour. By creating local increases in
[Ca2+]i at growth cones, the neurite can be steered
(Henley and Poo, 2004
).
Consequently, the ability of NCS-1 to modulate Ca2+ dynamics at
developing growth cones endows it the ability to regulate neurite
outgrowth.
In conclusion, we showed that by modulating different levels of cytosolic Ca2+, NCS-1 can influence neurite outgrowth properties. NCS-1 not only facilitates the functioning of the fully mature synapse, but it is also crucial during the conception of the synapse by modulation of Ca2+ dynamics, and neurite extension and branching.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/24/4479/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ames, J. B., Porumb, T., Tanaka, T., Ikura, M. and Stryer,
L. (1995). Amino-terminal myristoylation induces cooperative
calcium binding to recoverin. J. Biol. Chem.
270,4526
-4533.
Ames, J. B., Ishima, R., Tanaka, T., Gordon, J. I., Stryer, L. and Ikura, M. (1997). Molecular mechanics of calcium-myristoyl switches. Nature 389,198 -202.[CrossRef][Medline]
Ames, J. B., Hendricks, K. B., Strahl, T., Huttner, I. G., Hamasaki, N. and Thorner, J. (2000). Structure and calcium-binding properties of Frq1, a novel calcium sensor in the yeast Saccharomyces cerevisiae. Biochemistry 39,12149 -12161.[CrossRef][Medline]
Angaut-Petit, D., Toth, P., Rogero, O., Faille, L., Tejedor, F. J. and Ferrus, A. (1998). Enhanced neurotransmitter release is associated with reduction of neuronal branching in a Drosophila mutant overexpressing frequenin. Eur. J. Neurosci. 10,423 -434.[Medline]
Berridge, M. J., Bootman, M. D. and Roderick, H. L. (2003). Calcium signalling: dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 4, 517-529.[CrossRef][Medline]
Bourne, Y., Dannenberg, J., Pollmann, V., Marchot, P. and Pongs,
O. (2001). Immunocytochemical localization and crystal
structure of human frequenin (neuronal calcium sensor 1). J. Biol.
Chem. 276,11949
-11955.
Burgoyne, D. (2004). The neuronal calcium-sensor proteins. Biochim. Biophys. Acta 1742,59 -68.[Medline]
Burgoyne, R. D. (2007). Neuronal calcium sensor proteins: generating diversity in neuronal Ca(2+) signalling. Nat. Rev. Neurosci. 8,182 -193.[CrossRef][Medline]
Burgoyne, R. D., O'Callaghan, D. W., Hasdemir, B., Haynes, L. P. and Tepikin, A. V. (2004). Neuronal Ca2+-sensor proteins: multitalented regulators of neuronal function. Trends Neurosci. 27,203 -209.[CrossRef][Medline]
Chen, X. L., Zhong, Z. G., Yokoyama, S., Bark, C., Meister, B.,
Berggren, P. O., Roder, J., Higashida, H. and Jeromin, A.
(2001). Overexpression of rat neuronal calcium sensor-1 in rodent
NG108-15 cells enhances synapse formation and transmission. J.
Physiol. 532,649
-659.
Cohan, C. S., Connor, J. A. and Kater, S. B. (1987). Electrically and chemically mediated increases in intracellular calcium in neuronal growth cones. J. Neurosci. 7,3588 -3599.[Abstract]
Conklin, M. W., Lin, M. S. and Spitzer, N. C. (2005). Local calcium transients contribute to disappearance of pFAK, focal complex removal and deadhesion of neuronal growth cones and fibroblasts. Dev. Biol. 287,201 -212.[CrossRef][Medline]
Connor, J. A. (1986). Digital imaging of free
calcium changes and of spatial gradients in growing processes in single,
mammalian central nervous system cells. Proc. Natl. Acad. Sci.
USA 83,6179
-6183.
Cox, J. A., Durussel, I., Comte, M., Nef, S., Nef, P., Lenz, S.
E. and Gundelfinger, E. D. (1994). Cation binding and
conformational changes in VILIP and NCS-1, two neuron-specific calcium-binding
proteins. J. Biol. Chem.
269,32807
-32813.
Dent, E. W., Tang, F. and Kalil, K. (2003). Axon guidance by growth cones and branches: common cytoskeletal and signaling mechanisms. Neuroscientist 9, 343-353.[Abstract]
Dunican, D. J. and Doherty, P. (2001). Designing cell-permeant phosphopeptides to modulate intracellular signaling pathways. Biopolymers 60, 45-60.[CrossRef][Medline]
Dyer, J. R., Sossin, W. S. and Klein, M. (1996). Cloning and characterization of aplycalcin and Aplysia neurocalcin, two new members of the calmodulin superfamily of small calcium-binding proteins. J. Neurochem. 67,932 -942.[Medline]
Feng, Z. P., Klumperman, J., Lukowiak, K. and Syed, N. I.
(1997). In vitro synaptogenesis between the somata of identified
Lymnaea neurons requires protein synthesis but not extrinsic growth factors or
substrate adhesion molecules. J. Neurosci.
17,7839
-7849.
Feng, Z. P., Grigoriev, N., Munno, D., Lukowiak, K., MacVicar,
B. A., Goldberg, J. I. and Syed, N. I. (2002). Development of
Ca2+ hotspots between Lymnaea neurons during synaptogenesis. J.
Physiol. 539,53
-65.
Gomez, T. M. and Spitzer, N. C. (2000). Regulation of growth cone behavior by calcium: new dynamics to earlier perspectives. J. Neurobiol. 44,174 -183.[CrossRef][Medline]
Gomez, T. M., Robles, E., Poo, M. and Spitzer, N. C.
(2001). Filopodial calcium transients promote substrate-dependent
growth cone turning. Science
291,1983
-1987.
Green, I., Christison, R., Voyce, C. J., Bundell, K. R. and Lindsay, M. A. (2003). Protein transduction domains: are they delivering? Trends Pharmacol. Sci. 24,213 -215.[Medline]
Grynkiewicz, G., Poenie, M. and Tsien, R. Y.
(1985). A new generation of Ca2+ indicators with greatly improved
fluorescence properties. J. Biol. Chem.
260,3440
-3450.
Gu, X. and Spitzer, N. C. (1995). Distinct aspects of neuronal differentiation encoded by frequency of spontaneous Ca2+ transients. Nature 375,784 -787.[CrossRef][Medline]
Guo, W., Malin, S. A., Johns, D. C., Jeromin, A. and Nerbonne,
J. M. (2002). Modulation of Kv4-encoded K(+) currents in the
mammalian myocardium by neuronal calcium sensor-1. J. Biol.
Chem. 277,26436
-26443.
Henley, J. and Poo, M. M. (2004). Guiding neuronal growth cones using Ca2+ signals. Trends Cell Biol. 14,320 -330.[CrossRef][Medline]
Hui, H.,