|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 26, 2007
doi: 10.1242/10.1242/dev.02778



1 Natural Medicines Research Center, Korea Research Institute of Bioscience and
Biotechnology (KRIBB), Daejeon 305-333, Korea.
2 Department of Biological Sciences, Korea Advanced Institute of Science and
Technology, Daejeon 305-701, Korea.
3 Division of Molecular and Life Sciences, Pohang University of Science and
Technology, Pohang, Kyungbuk, Korea.
4 Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute,
Bethesda, MD 20892-5055, USA.
Authors for correspondence (e-mail:
hjlee{at}kribb.re.kr;
jkh{at}postech.ac.kr)
Accepted 6 December 2006
| SUMMARY |
|---|
|
|
|---|
Key words: SRF, Germ-layer formation, Activin and Nodal signaling, Xenopus
| INTRODUCTION |
|---|
|
|
|---|
Recent studies in the mouse and frog suggest that the intra- or
extracellular inhibition of mesoderm-inducing signals is crucial for
appropriate germ-layer specification. Inactivation of mouse Lefty2,
an extracellular feedback inhibitor of Nodal signaling, results in expansion
of the primitive streak and mesoderm migration defects
(Meno et al., 1999
). Knockdown
of Xenopus Lefty also causes the fate domains of the organizer and
dorsal mesoderm to expand, leading to exo-gastrulation
(Branford and Yost, 2002
;
Cha et al., 2006
). In the frog,
the loss of function of intracellular factors such as Ectodermin and
Xema expands mesoderm at the expense of ectoderm specification
(Dupont et al., 2005
;
Suri et al., 2005
). The
phenotype of mice mutant for DRAP1, a transcriptional corepressor, resembles
that of Lefty2 mutants (Iratni et
al., 2002
). These proteins have been shown to limit the spatial or
temporal extent of the response to Activin/Nodal signaling in vertebrate
embryos.
Serum response factor (SRF) is a MADS box-containing transcription factor
that binds to a serum response element (SRE) found in the promoters of a
variety of genes, including immediate early genes, neuronal genes and muscle
genes (Shore and Sharrocks,
1995
). SRF contains a highly conserved N-terminal DNA-binding and
dimerization domain termed the MADS box - owing to its homology among yeast
(MCM1, Agamous), plant (Deficiens) and vertebrate (SRF) proteins - and a
C-terminal transactivation domain
(Johansen and Prywes, 1993
;
Norman et al., 1988
;
Shore and Sharrocks, 1995
).
SRF controls cell growth and differentiation, neuronal transmission and muscle
development, and functions by regulating the expression of its target genes
(Carson et al., 2000
;
Castillo et al., 1997
;
Treisman, 1986
). SRF-deficient
mouse embryos display early embryonic lethality owing to the absence of
mesodermal cells, and this has led to the proposal that SRF is required for
mesoderm formation during mouse gastrulation
(Arsenian et al., 1998
).
Interestingly, experiments using SRF-/- embryonic stem cells
suggest that the phenotype of SRF mutants may be due to a non-cell-autonomous
defect in differentiation toward mesoderm, rather than any impairment in the
cellautonomous induction of the mesoderm program
(Weinhold et al., 2000
).
To better understand the molecular mechanisms by which SRF affects germ-layer specification during vertebrate embryogenesis, we have investigated SRF function in Xenopus early embryos, where mesoderm induction and patterning are much better characterized than, for example, in mice. SRF expression is restricted to the prospective ectoderm in Xenopus early embryos. Ectopic expression of SRF inhibits mesoderm formation. Conversely, loss-of-function of SRF stimulates mesendoderm induction, thereby expanding the expression of mesendodermal genes toward the ectodermal territory. In addition, SRF, a binding partner of Smad2 and FAST-1, impedes their association in Activin/Nodal signaling. These results suggest that SRF may function to restrict inappropriate germ-layer specification throughout the vertebrate embryo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Whole-mount in situ hybridization and RT-PCR
Whole-mount in situ hybridization was performed with digoxigenin
(DIG)-labeled probes as described
(Harland, 1991
). For RT-PCR
analysis, total RNA was prepared from embryos or animal cap explants with TRI
reagent (Sigma) and treated with RNase-free DNaseI (Roche) to remove genomic
DNA. RNA was transcribed using M-MLV reverse transcriptase (Promega). PCR
amplification was performed using Taq polymerase (TaKaRa). Primers used for
RT-PCR analysis are described at the homepage of the De Robertis group
http://www.hhmi.ucla.edu/derobertis/index.html.
The number of PCR cycles for each primer pair was determined empirically to
maintain amplification in the linear range.
Plasmids, RNA synthesis, morpholinos and cell lines
The mammalian expression plasmid for Flag-tagged Smad2 was described
previously (Lee et al., 2004
).
The pCGN-HA-SRF construct was kindly provided by Dr Jae-Hong Kim (Korea
University, Seoul, Republic of Korea)
(Johansen and Prywes, 1993
).
GST-tagged SRF and deletion mutant constructs were obtained by PCR and cloning
into the BamHI and SpeI sites of eukaryotic expression
vector pEBG. Flag-tagged SRF was generated in the pEF-Flag vector. Myc-tagged
FAST-1 deletion mutant constructs were obtained by PCR using the Myc-FAST-1
construct as template and cloning into the EcoRI and XhoI
sites of pCS2-MT.
For expression in Xenopus embryos, XSRF constructs including
pSP64T-wt XSRF and pSP64T-dn XSRF (kind gifts from Dr Harumasa Okamoto,
Neuroscience Research Institute, AIST, Tsukuba, Japan) were linearized with
XbaI and their capped mRNAs were synthesized using the SP6 mMessage
mMachine kit (Ambion). The XSRF-6Myc construct was generated by subcloning the
sequence containing its coding region and 5' untranslated region with
MO-binding sites into the BamHI and ClaI sites of pCS2-MT.
FAST-VP16A and FAST-EnR constructs were described
previously (Watanabe and Whitman,
1999
). The morpholino antisense oligonucleotides (GeneTools)
directed against Xenopus SRF were as follows: XSRF MO1,
CTGGTTACTGGGCAGCATCCCTTG; XSRF MO2, AAATTTA CTAATCTGCCCTTCCTTG. The standard
control MO (CO MO) was CCTCTTACCTCAGTTACAATTTATA.
Mv1Lu, HepG2 and HeLa cells were all maintained in Dulbecco's Modified Eagle Medium (high glucose) supplemented with 10% fetal bovine serum and 100 µg/ml gentamicin. Mv1Lu-SRF cells that stably express SRF were generated by transfection with pCGN-HA-SRF expression plasmid. A day after transfection, cells were split and selected for neomycin resistance. Neomycin-resistant colonies were pooled after 2 weeks of selection, expanded and analyzed.
Luciferase reporter assays
HepG2 or Mv1Lu cells were transiently transfected with different
combinations of plasmid DNA in 12-well plates using Lipofectamin and Plus
Reagent (Invitrogen, Rockville, MD) according to the manufacturer's
instructions. The cells were transfected with SRF, reporter plasmid,
ARELuc/FAST-1, constitutively active HA-tagged ALK4*, pCMV-Gal to
normalize transfection efficiency and pcDNA3 to normalize the amount of
transfected DNA. All transfections were normalized to a total of 1 µg of
DNA in each well. Cells were harvested 36 hours after transfection and the
luciferase activity was measured using Enhanced Luciferase Assay Kit (BD
Biosciences). Values were normalized to the ß-galactosidase activity and
represent the mean of three independent transfections with error bars
indicating the standard deviation. Similar results were obtained in three
separate experiments.
Immunoblotting and immunoprecipitation
293T, Mv1Lu and HeLa cells were used for the detection of protein-protein
interaction in vivo. For the treatment with Activin A, HeLa or Mv1Lu cells
were starved overnight in 0.2% serum-containing medium 24 hours after
transfection, and treated with 25 ng/ml Activin A for 2 hours. Cells were
lysed in ice-cold RIPA buffer containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl,
1% NP-40, 1 mM EDTA, 5 mM Na3VO4, 50 mM NaF and Protease
Inhibitor Cocktail (Complete, Roche). Cell lysates were separated by SDSPAGE
and transferred to nitrocellulose membranes. The membranes were immunoblotted
with various antibodies, followed by incubation with HRP-conjugated antibodies
to rabbit or mouse IgG and detected by chemiluminescence according to the
manufacturer's instructions (Pierce).
For immunoprecipitation, cell lysates were incubated with the appropriate antibody for 2 hours, followed by incubation with Protein G Plus-agarose beads (Santa Cruz Biotechnology) for 1 hour at 4°C. The beads were washed four times with RIPA buffer and then boiled for 5 minutes in 2xSDS sample buffer. The eluted immunoprecipitates were analyzed by immunoblotting as described above. For GST pull-down assay, cell lysates were incubated with glutathione-agarose beads (Santa Cruz Biotechnology) for 2 hours. After washing the beads four times with RIPA buffer, immunoblotting was performed.
Antibodies used for immunoprecipitation: anti-SRF rabbit polyclonal antibody (G-20, Santa Cruz Biotechnology); anti-Flag (M2, Sigma); anti-Smad2 (Zymed). Antibodies used for immunoblotting: anti-Smad2 mouse monoclonal antibody (BD Transduction Laboratories); anti-HA (Y-11, Santa Cruz Biotechnology); anti-Smad4 (Santa Cruz Biotechnology).
| RESULTS |
|---|
|
|
|---|
To examine the effects of ectopic expression of XSRF on axis formation, we
injected XSRF RNA into the marginal zone of two dorsal or ventral blastomeres
of four-cell stage embryos. Compared with the phenotype of uninjected control
embryos, dorsally XSRF-injected embryos exhibited a severely shortened body
axis and the truncation of anterior structures (72%, n=123)
(Fig. 1E,F). These phenotypes
are similar to those caused by experimental conditions in which Activin or
Nodal signaling is inhibited (Chang et al.,
1997
; Osada and Wright,
1999
; Piepenburg et al.,
2004
). Ventral injection of XSRF, however, resulted in more modest
defects in trunk and tail development (Fig.
1G). To characterize at the molecular level the events leading to
these disrupted phenotypes, we next examined the expression of mesodermal
markers in XSRF-injected embryos. Ventral or dorsal injection of XSRF
suppressed the expression of ventral mesodermal marker Wnt8, pan-mesodermal
marker Xbra, and dorsal mesodermal marker Chordin, in the early gastrula
embryos (Fig. 1H-M). Moreover,
XSRF-injected embryos showed dramatically inhibited formation of the somites,
a paraxial mesoderm derivative, which was evident by the absence of MyoD
expression at the tadpole stages (Fig.
1N,O). Consistently, RT-PCR analysis showed that ectopic XSRF
could reduce the expression of mesodermal markers, such as Wnt8, Mix2 and
Xbra, in the ventral region (Fig.
1P). Taken together, these results indicate that ectopically
injected XSRF could interfere with mesoderm formation, thereby leading to the
defects in axis specification.
|
Inhibition of XSRF function expands mesendoderm
To examine the effects of loss of XSRF function on germ-layer formation, we
first employed a dominant-negative (DN) XSRF construct that mainly comprises
the DNA-binding domain, lacking the C-terminal half of its wild-type form
(Belaguli et al., 1997
;
Watanabe et al., 2005
). Dorsal
injection of DN XSRF at the four-cell stage resulted in embryos with the
stout, shortened body axis and microcephaly
(Fig. 3A,B), which is similar
to the phenotypes caused by the increase in Activin/Nodal signaling. By
contrast, ventrally DN XSRF-injected embryos showed no dramatic changes in
phenotype (data not shown). Interestingly, overexpression of DN XSRF in the
animal region of four-cell stage embryos ectopically induced mesodermal
(Chordin and VegT), endodermal (Sox17ß) and neural (Zic3) markers in
ectoderm, with the reverse effect on the expression of epidermal keratin, an
epidermal marker (Fig. 3C). In
addition, DN XSRF enhanced the inducing activity of Activin protein in animal
cap cells, increasing the expression of two dorsal markers, Goosecoid and
Chordin, and decreasing that of Xbra which is dependent upon the relatively
low levels of Activin signals (Fig.
3D). Together, these data suggest that inhibition of XSRF function
may augment the mesendoderm-inducing signals in early embryos.
|
SRF associates with Smad2 and FAST-1
To elucidate the molecular mechanism by which SRF suppresses Activin/Nodal
signaling, we first tested whether SRF could interact with Smad2, a crucial
mediator of these signaling pathways (Shi
and Massague, 2003
). Indeed, coimmunoprecipitation experiments
using epitope-tagged proteins from 293T cells showed that SRF binds Smad2
(Fig. 5A). We also found that
endogenous Smad2 coimmunoprecipitates with endogenous SRF in Mv1Lu and HeLa
cells (Fig. 5B,C), showing that
their interaction occurs at physiological protein levels. The interaction
between Smad2 and SRF was enhanced by constitutively active Activin type-I
receptor (ALK4*) or Activin A. To locate the domain within Smad2
responsible for interaction with SRF, we evaluated the abilities of a series
of Smad2 deletion mutants to bind SRF using GST pull-down assay. These
indicated that it is the MH2 domain of Smad2 that retains the ability to bind
SRF (Fig. 5D,E).
Furthermore, we investigated whether SRF could also bind FAST-1, a
DNA-binding partner of Smad2 in Activin/Nodal signaling
(Whitman, 2001
). GST pull-down
assays demonstrated that SRF interacts with FAST-1
(Fig. 6A,B). This association
was not affected by constitutively active Activin type-I receptor (data not
shown). To identify the region within FAST-1 required for this interaction, we
examined whether SRF could coimmunoprecipitate with a series of deletion
fragments of FAST-1 in GST pull-down experiments.
Fig. 6B shows that the Forkhead
DNA-binding domain is required for FAST-1 to associate with SRF.
|
Since SRF associates with the MH2 domain of Smad2 that mediates its interaction with Smad4, we also examined the possible inhibitory effects of SRF on the ligand-induced formation of the Smad2-Smad4 complex that is essential for TGF-ß or Activin signaling. However, formation of the Smad2-Smad4 complex induced by Activin was not reduced in Mv1Lu cells stably overexpressing SRF as compared with that in control Mv1Lu cells (Fig. 7B).
We also tested whether SRF could interfere with the ability of FAST-1 to bind Smad2, as both of them associate with SRF. As shown in Fig. 7C, Myc-tagged FAST-1 coimmunoprecipitated with Flag-tagged Smad2 and this interaction was enhanced by constitutively active Activin type-I receptor (ALK4*). However, the level of Myc-tagged FAST-1 that coimmunoprecipitated with Flag-tagged Smad2 was markedly reduced by the co-transfection of SRF (Fig. 7C), suggesting a negative role of SRF in the association of FAST-1 and Smad2. Since this indicates the possible inhibitory effects of SRF on FAST-mediated transcription, we speculated that an activated form of FAST-1 (FAST-VP16A) would recover the defective phenotypes caused by overexpression of XSRF in Xenopus early embryos. Accordingly, we found that disruption of axial structure by XSRF could be rescued by coexpression of FAST-VP16A (29% defective, n=52) (Fig. 7D,E). Conversely, co-injection of an inhibitory form of FAST-1 (FAST-EnR) could rescue the gastrulation-defective phenotypes caused by XSRF MO (45% defective, n=38) (Fig. 7F,G). Overall, these results suggest that SRF may negatively regulate Activin/Nodal signaling by inhibiting the formation of a functional complex between FAST-1 and Smad2.
| DISCUSSION |
|---|
|
|
|---|
Conversely, XSRF loss-of-function results in a shift in the cellular fates
along the animal-vegetal axis, causing the mesoderm that normally exists at
the equator of the embryo to spread toward the animal pole at the expense of
ectoderm (Figs 3, 4). This
seems to be responsible for the defective embryos that show microcephaly and
alterations in gastrulation movement. Recent evidence has shown that loss of
inhibitors of mesoderm-inducing signals can lead to inappropriate germ-layer
development. Depletion of Xenopus Lefty, an extracellular inhibitor
of Nodal signaling, expands the organizer and mesendodermal tissues, with
consequent exo-gastrulation (Branford and
Yost, 2002
; Cha et al.,
2006
). The maternal protein Ectodermin acts as a ubiquitin ligase
for Smad4 to antagonize, intracellularly, TGF-ß signaling for ectoderm
specification (Dupont et al.,
2005
). In addition, knockdown of maternal Zic2 transcription
factor causes the same phenotypes as excess Nodal signaling, as this protein
functions to negatively regulate Nodal-related gene expression during
anteroposterior patterning (Houston and
Wylie, 2005
). This antagonism of TGF-ß/Nodal signaling for
proper germlayer formation is conserved in mice, and mutation of the
transcriptional co-repressor DRAP1 or mouse Lefty2 leads to expansion of the
primitive streak and severe gastrulation defects
(Iratni et al., 2002
;
Meno et al., 1999
). Given that
ectopic XSRF precludes mesoderm formation, both in vivo and caused by
Activin/Nodal signaling in animal caps, and that its knockdown leads to
expansion of mesoderm into the prospective ectoderm, it is reasonable to
suggest that XSRF has the same function of limiting the response to the
mesoderm-inducing signals during germ-layer specification.
|
|
|
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Brookdale Department of Molecular, Cell and Developmental
Biology, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York,
NY 10029, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Agius, E., Oelgeschlager, M., Wessely, O., Kemp, C. and De
Robertis, E. M. (2000). Endodermal Nodal-related signals and
mesoderm induction in Xenopus. Development
127,1173
-1183.[Abstract]
Arsenian, S., Weinhold, B., Oelgeschlager, M., Ruther, U. and
Nordheim, A. (1998). Serum response factor is essential for
mesoderm formation during mouse embryogenesis. EMBO J.
17,6289
-6299.[CrossRef][Medline]
Belaguli, N. S., Schildmeyer, L. A. and Schwartz, R. J.
(1997). Organization and myogenic restricted expression of the
murine serum response factor gene. A role for autoregulation. J.
Biol. Chem. 272,18222
-18231.
Branford, W. W. and Yost, H. J. (2002).
Lefty-dependent inhibition of Nodal- and Wnt-responsive organizer gene
expression is essential for normal gastrulation. Curr.
Biol. 12,2136
-2141.[CrossRef][Medline]
Carson, J. A., Fillmore, R. A., Schwartz, R. J. and Zimmer, W.
E. (2000). The smooth muscle gamma-actin gene promoter is a
molecular target for the mouse bagpipe homologue, mNkx3-1, and serum response
factor. J. Biol. Chem.
275,39061
-39072.
Castillo, S. O., Xiao, Q., Lyu, M. S., Kozak, C. A. and Nikodem,
V. M. (1997). Organization, sequence, chromosomal
localization, and promoter identification of the mouse orphan nuclear receptor
Nurr1 gene. Genomics 41,250
-257.[CrossRef][Medline]
Cha, Y. R., Takahashi, S. and Wright, C. V.
(2006). Cooperative non-cell and cell autonomous regulation of
Nodal gene expression and signaling by Lefty/Antivin and Brachyury in Xenopus.
Dev. Biol. 290,246
-264.[CrossRef][Medline]
Chai, J. and Tarnawski, A. S. (2002). Serum
response factor: discovery, biochemistry, biological roles and implications
for tissue injury healing. J. Physiol. Pharmacol.
53,147
-157.[Medline]
Chang, C., Wilson, P. A., Mathews, L. S. and Hemmati-Brivanlou,
A. (1997). A Xenopus type I activin receptor mediates
mesodermal but not neural specification during embryogenesis.
Development 124,827
-837.[Abstract]
Derynck, R. and Zhang, Y. E. (2003).
Smad-dependent and Smad-independent pathways in TGF-ß family signaling.
Nature 425,577
-584.[CrossRef][Medline]
Dupont, S., Zacchigna, L., Cordenonsi, M., Soligo, S., Adorno,
M., Rugge, M. and Piccolo, S. (2005). Germ-layer
specification and control of cell growth by Ectodermin, a Smad4 ubiquitin
ligase. Cell 121,87
-99.[CrossRef][Medline]
Gurdon, J. B. and Bourillot, P. Y. (2001).
Morphogen gradient interpretation. Nature
413,797
-803.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization:
an improved whole-mount method for Xenopus embryos. Methods Cell
Biol. 36,685
-696.[Medline]
Harland, R. and Gerhart, J. (1997). Formation
and function of Spemann's organizer. Annu. Rev. Cell Dev.
Biol. 13,611
-667.[CrossRef][Medline]
Heasman, J. (2006). Patterning the early
Xenopus embryo. Development
133,1205
-1217.
Houston, D. W. and Wylie, C. (2005). Maternal
Xenopus Zic2 negatively regulates Nodal-related gene expression during
anteroposterior patterning. Development
132,4845
-4855.
Iratni, R., Yan, Y. T., Chen, C., Ding, J., Zhang, Y., Price, S.
M., Reinberg, D. and Shen, M. M. (2002). Inhibition of excess
nodal signaling during mouse gastrulation by the transcriptional corepressor
DRAP1. Science 298,1996
-1999.
Johansen, F. E. and Prywes, R. (1993).
Identification of transcriptional activation and inhibitory domains in serum
response factor (SRF) by using GAL4-SRF constructs. Mol. Cell.
Biol. 13,4640
-4647.
Kofron, M., Puck, H., Standley, H., Wylie, C., Old, R., Whitman,
M. and Heasman, J. (2004). New roles for FoxH1 in patterning
the early embryo. Development
131,5065
-5078.
Lee, H. J., Lee, J. K., Miyake, S. and Kim, S. J.
(2004). A novel E1A-like inhibitor of differentiation (EID)
family member, EID-2, suppresses transforming growth factor (TGF)-beta
signaling by blocking TGF-beta-induced formation of Smad3-Smad4 complexes.
J. Biol. Chem. 279,2666
-2672.
Liu, X., Sun, Y., Weinberg, R. A. and Lodish, H. F.
(2001). Ski/Sno and TGF-beta signaling. Cytokine
Growth Factor Rev. 12,1
-8.[CrossRef][Medline]
Meno, C., Gritsman, K., Ohishi, S., Ohfuji, Y., Heckscher, E.,
Mochida, K., Shimono, A., Kondoh, H., Talbot, W. S., Robertson, E. J. et
al. (1999). Mouse Lefty2 and zebrafish antivin are feedback
inhibitors of nodal signaling during vertebrate gastrulation. Mol.
Cell 4,287
-298.[CrossRef][Medline]
Newport, J. and Kirschner, M. (1982). A major
developmental transition in early Xenopus embryos: I. Characterization and
timing of cellular changes at the midblastula stage.
Cell 30,675
-686.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1994).
Normal Table of Xenopus laevis (Daudin). New York:
Garland Publishing.
Norman, C., Runswick, M., Pollock, R. and Treisman, R.
(1988). Isolation and properties of cDNA clones encoding SRF, a
transcription factor that binds to the c-fos serum response element.
Cell 55,989
-1003.[CrossRef][Medline]
Onuma, Y., Takahashi, S., Yokota, C. and Asashima, M.
(2002). Multiple nodalrelated genes act coordinately in Xenopus
embryogenesis. Dev. Biol.
241,94
-105.[CrossRef][Medline]
Osada, S. I. and Wright, C. V. (1999). Xenopus
nodal-related signaling is essential for mesendodermal patterning during early
embryogenesis. Development
126,3229
-3240.[Abstract]
Panitz, F., Krain, B., Hollemann, T., Nordheim, A. and Pieler,
T. (1998). The Spemann organizer-expressed zinc finger gene
Xegr-1 responds to the MAP kinase/Ets-SRF signal transduction pathway.
EMBO J. 17,4414
-4425.[CrossRef][Medline]
Piepenburg, O., Grimmer, D., Williams, P. H. and Smith, J.
C. (2004). Activin redux: specification of mesodermal pattern
in Xenopus by graded concentrations of endogenous activin B.
Development 131,4977
-4986.
Pouponnot, C., Jayaraman, L. and Massague, J.
(1998). Physical and functional interaction of SMADs and
p300/CBP. J. Biol. Chem.
273,22865
-22868.
Qiu, P., Feng, X. H. and Li, L. (2003).
Interaction of Smad3 and SRF-associated complex mediates TGF-beta1 signals to
regulate SM22 transcription during myofibroblast differentiation.
J. Mol. Cell. Cardiol.
35,1407
-1420.[CrossRef][Medline]
Schier, A. F. (2003). Nodal signaling in
vertebrate development. Annu. Rev. Cell Dev. Biol.
19,589
-621.[CrossRef][Medline]
Shi, Y. and Massague, J. (2003). Mechanisms of
TGF-beta signaling from cell membrane to the nucleus.
Cell 113,685
-700.[CrossRef][Medline]
Shore, P. and Sharrocks, A. D. (1995). The
MADS-box family of transcription factors. Eur. J.
Biochem. 229,1
-13.[Medline]
Suri, C., Haremaki, T. and Weinstein, D. C.
(2005). Xema, a foxi-class gene expressed in the gastrula stage
Xenopus ectoderm, is required for the suppression of mesendoderm.
Development 132,2733
-2742.
ten Dijke, P. and Hill, C. S. (2004). New
insights into TGF-beta-Smad signalling. Trends Biochem.
Sci. 29,265
-273.[CrossRef][Medline]
Treisman, R. (1986). Identification of a
protein-binding site that mediates transcriptional response of the c-fos gene
to serum factors. Cell
46,567
-574.[CrossRef][Medline]
Watanabe, M. and Whitman, M. (1999). FAST-1 is
a key maternal effector of mesoderm inducers in the early Xenopus embryo.
Development 126,5621
-5634.[Abstract]
Watanabe, T., Hongo, I., Kidokoro, Y. and Okamoto, H.
(2005). Functional role of a novel ternary complex comprising SRF
and CREB in expression of Krox-20 in early embryos of Xenopus laevis.
Dev. Biol. 277,508
-521.[CrossRef][Medline]
Weinhold, B., Schratt, G., Arsenian, S., Berger, J., Kamino, K.,
Schwarz, H., Ruther, U. and Nordheim, A. (2000). Srf(-/-) ES
cells display non-cell-autonomous impairment in mesodermal differentiation.
EMBO J. 19,5835
-5844.[CrossRef][Medline]
Whitman, M. (2001). Nodal signaling in early
vertebrate embryos: themes and variations. Dev. Cell
1, 605-617.[CrossRef][Medline]
Wu, J. W., Krawitz, A. R., Chai, J., Li, W., Zhang, F., Luo, K.
and Shi, Y. (2002). Structural mechanism of Smad4 recognition
by the nuclear oncoprotein Ski: insights on Ski-mediated repression of
TGF-beta signaling. Cell
111,357
-367.[CrossRef][Medline]
Zhang, J., Houston, D. W., King, M. L., Payne, C., Wylie, C. and
Heasman, J. (1998). The role of maternal VegT in establishing
the primary germ layers in Xenopus embryos. Cell
94,515
-524.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
A. F. Schier Nodal Morphogens Cold Spring Harb Perspect Biol, November 1, 2009; 1(5): a003459 - a003459. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-M. Cheong, H. Kim, and J.-K. Han Identification of a Novel Negative Regulator of Activin/Nodal Signaling in Mesendodermal Formation of Xenopus Embryos J. Biol. Chem., June 19, 2009; 284(25): 17052 - 17060. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||