DEV02795 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure 1 -

  Fig. S1. Map of the U6-siRNA cassette and its insertion site into the lentiviral vector LV-EGFP. (A) Cassette containing the U6 promoter and a multiple cloning site capable of accepting siRNA-encoding oligodeoxynucleotides at the ApaI and EcoRI sites (*preferred unique sites for insertion of oligodeoxynucleotides). The cassette was amplified by PCR using the following primers: 5′ primer, TATAGATCTCGAATTGGGTACCCGCTCTA (646-1125) and 3′ primer, TATAGATCTCGCAATTAACCCTCACTAAAG (1105-1125; sequence based on pSilencer 1.0-U6. Ambion). The first 9 nucleotides of each primer consist of a TAT spacer and BglII site. The PCR product was digested with BglII and ligated into the BbsI site of LV-EGFP. (B) The oligonucleotide sequences encoding Fxna siRNA are shown. (C) During viral integration into the host genome the short hairpin (sh) RNA-producing cassette is duplicated as part of the 3′-LTR and replaces the 5′-LTR (Tiscornia et al., 2003). (D) Upon termination of transcription, the RNA product folds back onto itself via the loop domain to form a double-stranded shRNA containing 3′ UU overhangs. (E) The endogenous enzyme Dicer processes the oligonucleotide hairpin structure into the final Fxna siRNA.