|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 31 January 2007
doi: 10.1242/dev.02785
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern
University, Evanston, IL 60208, USA.
2 Department of Cell and Molecular Physiology, University of North Carolina
School of Medicine, Chapel Hill, NC 27599, USA.
3 Department of Microbiology and Immunology, University of Illinois-Chicago,
Chicago, IL 60612, USA.
4 UNC Neuroscience Center, Curriculum in Neurobiology, Neurodevelopmental
Disorders Research Center, University of North Carolina School of Medicine,
Chapel Hill, NC 27599, USA.
Author for correspondence (e-mail:
beitel{at}northwestern.edu)
Accepted 14 December 2006
| SUMMARY |
|---|
|
|
|---|
Key words: MAGUK, Cell junction, Basolateral, Epithelia, Drosophila, Trachea
| INTRODUCTION |
|---|
|
|
|---|
The tube expansion mechanism depends upon a fibrillar, chitin-based
extracellular matrix that is assembled in the tracheal lumen at the beginning
of the diameter dilation (Tonning et al.,
2005
). As development progresses, chitin at the apical cell
surface is organized into a highly patterned, multilayered cuticle. Lumenal
chitin is eliminated before hatching. Defects in chitin synthesis or
organization cause tracheal tube diameters to become either too large or too
small, and tube lengths to become over-elongated
(Araujo et al., 2005
;
Devine et al., 2005
;
Moussian et al., 2006
;
Tonning et al., 2005
). The
exact role of the chitin-based matrix in controlling tracheal cell shape is
unclear. Although the lumenal matrix and cuticle may serve as structural forms
or `mandrils' that mechanically shape the tracheal cells and tubes, an
instructive or signaling role for the matrix is suggested by the observation
that the organization of the ßH-spectrin cytoskeleton is
altered in chitinsynthetase mutants
(Tonning et al., 2005
).
Beginning at stage 15, organization of the lumenal matrix requires the
lumenal secretion of the putative chitin deacetylases, Vermiform (Verm) and
Serpentine (Serp). In verm and serp mutants, the chitinbased
matrix becomes disorganized and tracheal tubes become too long
(Luschnig et al., 2006
;
Wang et al., 2006
).
Surprisingly, lumenal secretion of Verm requires a cell-cell junction termed
the septate junction (SJ) (Wang et al.,
2006
). Septate junctions are complex cell adhesion junctions that
have at least 15 known components (reviewed by
Knust and Bossinger, 2002
;
Margolis and Borg, 2005
;
Wu and Beitel, 2004
). These
include transmembrane cell-adhesion proteins such as Neurexin IV (Nrx-IV;
herein referred to as Nrx) and Neuroglian (Nrg), cytoplasmic proteins such as
the FERM-domain protein Coracle (Cor; Cora - Flybase), the basal polarity
proteins Scribbled (Scrib), Discs large (Dlg; Dlg1 - Flybase), and Lethal
giant larvae (Lgl; L(2)gl - Flybase), and proteins with roles that remain to
be determined, such as the Na+/K+-ATPase
(Genova and Fehon, 2003
;
Paul et al., 2007
;
Paul et al., 2003
). Mutations
in most known SJ components cause tracheal phenotypes indistinguishable from
the verm mutant phenotype, consistent with the failure of Verm to be
secreted into the tracheal lumen in the SJ mutants so far examined
(Wang et al., 2006
). Secretion
of other apical lumenal markers appears normal in SJ mutants, indicating that
Verm is secreted by a specialized pathway, the mechanism of which remains to
be determined.
Although the role of SJs in lumenal (apical) secretion is not understood,
other SJ functions are well defined. SJs have functional and molecular
similarity to vertebrate tight junctions (TJs), in that both junctions require
members of the claudin protein family to create the paracellular diffusion
barriers between epithelial cells that are essential to the survival of
multicellular animals (Anderson et al.,
2004
; Behr et al.,
2003
; Wu and Beitel,
2004
; Wu et al.,
2004
). However, SJs are not simply the homologs of TJs, because
there are significant ultrastructural, molecular and functional differences
between SJ and TJs (reviewed by Wu and
Beitel, 2004
). For example, TJs are apical of adherens junctions
(AJs) and contain conserved apical polarity complexes, while SJs are basal of
AJs and contain the polarity proteins Scrib, Dlg and Lgl, which have
vertebrate homologs that also localize basolaterally (reviewed by
Knust and Bossinger, 2002
).
Thus, in some respects SJs are more related to complexes found in the
basolateral regions of vertebrate epithelial cells than to TJs.
Although Scrib, Dlg and Lgl establish and currently define the similarity
between SJ and vertebrate basolateral regions, it is notable that these
proteins are not representative of most SJ components. Drosophila
Scrib, Dlg and Lgl are maternally contributed and constitute a distinct
subgroup of proteins required for initial epithelial cell polarization during
embryonic stages 5-8 (Bilder and Perrimon,
2000
; Strand et al.,
1994
; Tanentzapf and Tepass,
2003
; Woods et al.,
1996
). By contrast, most SJ components are not maternally
expressed, are not required for cell polarity and only function relatively
late in development when SJs begin forming during stage 13 (reviewed by
Bilder, 2004
;
Knust and Bossinger, 2002
;
Tepass et al., 2001
). Whether
the Scrib, Dlg and Lgl proteins nucleate SJ assembly, or whether the nascent
SJ recruits and incorporates Scrib, Dlg and Lgl has not been determined. It
also has not yet been determined how Scrib, Dlg and Lgl are localized to the
basolateral membrane in either Drosophila or vertebrate epithelia.
Thus the similarity between Drosophila SJ and vertebrate basolateral
regions has been limited to polarity complexes, and has not extended to cell
adhesion complexes.
In this report we show that vari encodes a previously uncharacterized, membrane-associated, guanylate kinase (MAGUK) scaffolding protein that is required for SJ organization and that directly binds the cell adhesion protein Neurexin IV. Importantly, Vari helps define a new subgroup of MAGUKs that includes vertebrate PALS2. Both Vari and PALS2 localize basolaterally in epithelial cells and both interact through a PDZ domain with a basolateral adhesion protein. Thus, Vari is the first late-expressed SJ component to have a vertebrate homolog, and together Vari and PALS2 extend the similarity of Drosophila and vertebrate basolateral regions from polarity complexes to adhesion complexes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunohistochemistry
The following antibodies were used: anti-tracheal lumenal 2A12 1:5 and
anti-Arm N27A1 1:100 (Developmental Studies Hybridoma Bank); mouse anti-Cor
C566.9c and C615.16B 1:500; guinea pig (gp) anti-Cor 1:10000
(Fehon et al., 1994
); rabbit
(r) anti-Dlg 1:500 (Woods et al.,
1997
); r anti-Nrv2.1 1:500
(Paul et al., 2007
); r
anti-Nrx 1:200 (Baumgartner et al.,
1996
); r anti-Veli 1:500
(Bachmann et al., 2004
); rat
anti-DE-cadherin DECAD2 1:20 (Oda et al.,
1994
); r anti-Sinu 1:500 (Wu
et al., 2004
); r anti-Verm 1:300 and Serp 1:300
(Luschnig et al., 2006
); gp
anti-Verm 1:1000 (Wang et al.,
2006
). Embryos were fixed in formaldehyde
(Samakovlis et al., 1996
),
except for Sinu and Arm staining, which were heat fixed
(Miller et al., 1989
). Rat
anti-Vari was used at 1:250 with formaldehyde fixation (although heat fixation
can also be used) and was produced by cloning cDNA RE01836 into the pBad/His
vector (Invitrogen) followed by expression in Escherichia coli,
solubilization in 8 mol/l urea, purification with Ni-agarose beads, dialysis
against 2 mol/l urea or PBS buffers and inoculation into rats. Guinea pig
anti-Vari was produced by inoculating animals with purified 6XHis:Vari
PDZ-SH3-GUK (see Protein interactions below, except pET28a, Novagen was used
instead of pGEX-4T1). Secondary antibodies were used at 1:200 (Jackson
ImmunoResearch and Molecular Probes). Confocal images were acquired on a Leica
TCS SP2. To estimate relative levels of staining, heterozygous and homozygous
embryos were imaged on the same slide in the same session and image
adjustments were applied equally to matched images.
Molecular biology
RNAi was performed as previously described
(Kennerdell and Carthew, 1998
;
Wu et al., 2004
) using the
vari common ORF primers 5'-GCACCCTTTCCATTAAGAGATG,
TTCAAGCCAAACATCGAACTTA, ATTGGACTCATACCATCCCAAG and ATGACAAAAGGCATCAGTTCCT,
each of which was preceded by a T7 promoter sequence.
The genomic sequence of each vari allele was determined from at least 35 bp 5' of the first common exon and through the polyadenylation site, as well as 35 bp 5' and 3' of each spliceform-specific exon. UAS vari short and long transgenes were constructed by insertion of cDNAs RE01836 and RE31492, respectively, into pUAST followed by germline transformation. cDNAs were obtained from the Drosophila Genome Resource Center and sequenced using an ABI dye-terminator system. GenBank accession numbers: RE35569, DQ787101; RE47555, DQ787102; RE51859, DQ787103; RE54628, DQ787104; RE58272, DQ787105; RE60702, DQ787106; RE61615, DQ787107; RH14941, DQ787108.
Sequence comparisons and phylogenetic analyses
ClustalW and phylogenetic tree analyses were performed using the MacVector
program (Accelrys) using representative full-length sequences downloaded from
GenBank protein databases, expect for zebrafish ZO-1, for which a C-terminal
sequence was predicted from genomic DNA sequences to produce a hypothetical
protein that had more conservation with other vertebrate ZO-1 sequences. The
ClustalW alignment of the sequences is presented in FASTA format (see Fig. S1
in the supplementary material). The phylogenetic tree in
Fig. 2 was generated from 1000
bootstrap repetitions using the neighbor-joining method, gap site ignored,
random tie breaking of branches with equal values and an uncorrected `p'.
Human Carma3 was used as an outgroup to root the displayed tree.
|
Precipitation assays
For protein interaction experiments, vari cDNA RH61449 (GenBank
Accession number AY121709) was used as a template to amplify 1323 and 251 bp
fragments (nt #805-1056 and nt #805-2127) that encode the PDZ, SH3 and GUK
domains or only the PDZ domain of Vari, respectively. These fragments were
cloned in frame into GST expression vector (pGEX4T1, Pharmacia) to generate
fusion proteins of GST-Vari or GST-Vari.PDZ, which were used in the binding
experiments. A DNA fragment that encodes the Nrx C-terminal 48 amino acids was
cloned in a maltose binding protein (MBP) expression vector to generate
MBP-Nrx-CT fusion protein. All proteins were expressed according to the vector
manufacturer's instructions and the binding assays were carried out as
previously described (Bhat et al.,
1999
). The Nrx-CT peptide was cleaved from the MBP fusion protein
with thrombin and purified over spin column and the purified peptide of
approximately 7 kDa used for binding with GST, GST-Vari or GST-Vari.PDZ. The
peptide was identified by anti-NRX antibody in western blotting.
| RESULTS |
|---|
|
|
|---|
|
Vari and PALS2/VAM-1 define a new MAGUK subgroup
To gain insight into possible cell biological roles of Varicose, we
investigated the relationship between Vari and other MAGUKs. The MAGUK family
can be divided into evolutionarily conserved subgroups, and in several cases
it has been shown that subgroup members have similar functions
(Fig. 2) (reviewed by
Funke et al., 2005
). For
example, the Stardust (Sdt)/PALS1 and Dlg subgroups organize apical and
basolateral cell polarity complexes in both flies and vertebrates (reviewed by
Bilder, 2004
;
Margolis and Borg, 2005
). We
therefore aligned the Vari amino acid sequence with representative sequences
from known MAGUK subgroups and MAGUKs that had not previously been assigned to
specific subgroups. Phylogenetic trees were then generated using a `bootstrap'
algorithm that more robustly indicates relationships than do `best tree'
approaches (see Materials and methods). As shown in
Fig. 2A, Vari does not belong
to any of the previously characterized epithelial MAGUK subgroups such as the
Dlg, ZO-1, Sdt/Par-3 or Lin-2/CASK subgroups, but instead belongs to a new
subgroup of MAGUKs that includes PALS2
(Kamberov et al., 2000
), VAM-1
(Tseng et al., 2001
), MPP6 and
MPP2. This subgroup has at least two members each in zebrafish, mice and
humans, but to date the in vivo functions of the vertebrate members of this
subgroup have not been determined. Importantly, although the domain structure
of members of the Vari/PALS2 subgroup resembles that of P55 (MPP1) subgroup
members, at the amino acid level the P55 subgroup is much more closely related
to the LIN-2/CASK/Caki subgroup and is clearly distinct from the
Vari/PALS2/VAM-1 subgroup (Fig.
2A; see Fig. S1 in the supplementary material). Thus, Vari is a
founding member of a new subgroup of MAGUKs, the functions of which have not
been previously determined.
Caenorhabditis elegans epithelial MAGUKs are significantly diverged from those of Drosophila and vertebrates
Several additional results from the phylogenetic analysis are also notable.
First, while the P55 subgroup initially appears to be vertebrate-specific
because there are no corresponding genes in Drosophila or C.
elegans that have the PDZ-SH3-GUK structure of the P55 subgroup members,
the invertebrate equivalents of P55 may be alternative splice products of the
LIN-2/Caki subgroup that lack the CAM kinase and one or both L27 domains, and
thus have close amino acid sequence and domain organization similarity to the
P55 subgroup (Fig. 2A). Second,
it is apparent that zebrafish Humpback
(Konig et al., 1999
) also
defines a previously unrecognized subgroup of MAGUKs that is most similar to
the Sdt subgroup (Fig. 2A).
Third, some MAGUK subgroups, such as the Vari/PALS2 and Lin-2/Cask, have
characteristic sequences at their C-termini that could be PDZ-binding motifs,
while members of other subgroups, such as the Sdt/PALS1 and Humpback families,
do not have conserved C-termini and lack potential PDZ-binding motifs
(Fig. 2B). Fourth, although the
Dlg, Sdt, ZO-1 and Lin-2 subgroups have clear representatives in vertebrates,
Drosophila and C. elegans, the Vari and Humpback subgroups
do not appear to have C. elegans members. Further, C.
elegans DLG lacks the conserved C-terminal amino acids present in
Drosophila and vertebrate Dlgs, and the C. elegans ZO-1
C-terminus is also considerably divergent from the Drosophila and
vertebrate ZO-1 C-termini (Fig.
2B). Together, these observations show that while some MAGUK
subgroups have been strongly conserved, other subgroups are diverging. A
practical consequence of this divergence is that Drosophila is likely
to be more representative than C. elegans as a model system for
investigating the roles of MAGUKs in epithelial cell junctions.
|
Vari is required for septate junction formation
To determine if Vari organizes SJs, we tested all vari mutants for
SJ barrier function and examined the subcellular localization of five SJ
components in three epithelial tissues of three different vari
mutants: an intermediate allele vari3953b, a strong allele
vari327 and a putative null allele
variF033 (mutants described below). The dye exclusion
assay of Lamb et al. (Lamb et al.,
1998
) showed that all vari mutations except the
semi-viable vari38EFa2 mutation caused SJ barrier defects
(Table 1). As is typical of SJ
mutants, in animals homozygous for the strong or null alleles of vari
the SJ components Cor, Nrx, Sinuous (Sinu) and the
Na+/K+-ATPase were all mislocalized basally in the
trachea, hindgut and salivary glands (Fig.
1M,N; Fig.
3F,F',I,I'; and data not shown). However, although Dlg
levels were greatly reduced in strong and null vari mutants, Dlg was
nonetheless localized correctly (Fig.
3K,K'). In vari3953b, Dlg and the
Na+/K+-ATPase ß-subunit Nrv2 were correctly
localized, but Cor and Nrx were mislocalized basally
(Fig. 3G,G',L,L'
and data not shown). By contrast to the tissue-specific effects of
sinu mutations (Wu et al.,
2004
), but like mutations in the
Na+/K+-ATPase (Paul
et al., 2003
), the SJs of all tissues examined were similarly
affected by vari mutations.
|
|
To investigate if Vari had functions typical of other SJ components
expressed after establishment of apical-basal polarity, we asked whether Vari
was required for epithelial apical-basal polarity or for the recently
identified apical secretory function of SJs
(Wang et al., 2006
). As is the
case for late SJ components such as Sinu and Lachesin (Lac), Vari is not
necessary for AJ formation or for establishing apical-basal polarity, because
the AJ markers Armadillo/ß-catenin (Arm) and DE-Cadherin (E-cad; Shotgun
- Flybase), and the apical markers DPatJ (PatJ) and Veli were localized
properly in all vari mutants (Fig.
3P,R and data not shown). Similarly, and as reported for other SJ
mutants (Wang et al., 2006
),
the lumenal levels of the matrix-associated protein Verm were reduced and
punctate cytoplasmic accumulations of Verm were frequently observed in
vari mutants (Fig.
5B-D). Verm cytoplasmic staining was particularly strong and
penetrant in vari3953b mutants compared with vari
null and other SJ mutants, although the expressivity of the cytoplasmic
accumulations varied considerably (Fig.
5C,D). Interestingly, the Verm-related protein Serp behaved
differently from Verm in vari, cor or Lac mutants, because
no lumenal or cytoplasmic staining of Serp was observed
(Fig. 5G,H and data not shown).
Together, these results show that Vari localizes to SJs and is required for
their organization and function.
Localization of Vari to SJs depends on many other SJ components
Because Vari is a scaffolding protein involved in SJ assembly, we
determined the extent to which Vari localization depends on other SJ
components. In nrx4846, sinunwu7,
cor5 and nrv223b null mutants, Vari levels
were greatly reduced and the remaining Vari protein was mislocalized basally
(Fig. 3M,M',N,N'
and data not shown). Thus, as for all other SJ components examined to date,
there is an interdependence between Vari and other SJ components for
subcellular localization and SJ assembly.
Vari binds to the cytoplasmic domain of Nrx
If Vari and PALS2 share functional as well as sequence similarity, one
would expect them to interact with similar proteins. As the PDZ domain of
PALS2 binds to the C-terminal PDZ-binding motif EYFI of the basolateral cell
adhesion protein Necl-2 (Shingai et al.,
2003
), we investigated whether Vari's PDZ domain binds the SJ
component Nrx, a basolateral cell-adhesion protein with a C-terminus that ends
in the related sequence EIFI (Baumgartner
et al., 1996
). In a yeast two-hybrid screen using the cytoplasmic
48 amino acids of Nrx as bait, we recovered 15 positive clones from
2x106 colonies (Bhat et
al., 1999
). Two of these clones contained cDNAs encoding Vari,
seven encoded the multi-PDZ-domain protein dPATJ, and the remaining six
encoded proteins did not bear recognizable binding motifs (Materials and
methods). The recovery of only Vari and dPATJ, but not others of the more than
125 PDZ-binding proteins in the Drosophila genome, suggests that the
interaction between the Nrx C-terminus and Vari is quite specific.
|
|
The SH3 HOOK but not L27 domain is required for Varicose function
To investigate the functions of the different domains of Vari, we
characterized the original vari3953b allele
(Beitel and Krasnow, 2000
) and
the vari38EFa2 and variF033 alleles
(Butler et al., 2001
;
Thibault et al., 2004
), as
well as five vari mutations that we generated in an
ethylmethanesulfonate (EMS) non-complementation screen
(Fig. 1;
Table 1).
vari3953b has a 17 bp deletion in the intron after the
second common exon and is an intermediate allele that is viable in certain
trans-heterozygous combinations (Table
2). In vari3953b homozygotes, Vari protein
does not significantly accumulate at the SJ region and frequently has a
tracheal phenotype similar to that caused by a vari null mutation
(Fig. 3P,Q;
Table 1).
variF033 appears to be a null mutation that results from a
transposable element insertion into the first common intronic region
(Fig. 1K).
variF033 behaves as a deficiency in genetic crosses, and
in variF033 mutants Vari protein levels are not
distinguishable from background (Fig.
1M; Fig. 3O;
Table 1;
Table 2; and data not
shown).
|
We also investigated the role of the L27 protein-protein interaction domain
in Vari function. L27 domains are distinguishing features of several MAGUK
subgroups that in vitro evidence suggests are important mediators of MAGUK
scaffolding functions (e.g. Kamberov et
al., 2000
; Tseng et al.,
2001
) (reviewed by Funke et
al., 2005
). However, in only a few (e.g.
Nakagawa et al., 2004
) cases
has the in vivo importance of L27-mediated interactions been confirmed. For
Vari, a two-hybrid screen of the Drosophila proteome detected a
significant interaction between Vari and Veli
(Giot et al., 2003
), which
paralleled the L27-mediated in vitro interactions between Pals2/Vam-1 and
vertebrate Veli (Kamberov et al.,
2000
; Tseng et al.,
2001
). Despite this corroborative evidence, the functional
importance of the Vari-Veli interaction in epithelial cells was suspect,
because Veli localization is unaffected by vari mutations and because
the subcellular distributions of Vari and Veli do not overlap
(Fig. 3O). Veli localizes
apically, while Vari localizes to the basolateral SJs. We confirmed that the
Vari L27 domain is nonessential by showing that the short isoform of Vari,
which lacks the L27 domain, can completely rescue the tracheal and lethal
phenotypes of vari null mutants
(Fig. 1G,J) and restore normal
SJ localization of both Cor and Vari (Fig.
4G,I). Further, despite yeast two-hybrid data indicating that the
Vari L27 domain interacts with Veli, expression of the long isoform of Vari
rescued vari null mutants to viability, and in rescued animals the
L27-containing Vari-long isoform localized to SJs rather than the apical
domain where Veli is localized (Fig.
4J-L). Together, these results show that although the HOOK region
of Vari has an essential role, the L27 domain is dispensable.
| DISCUSSION |
|---|
|
|
|---|
Vari organizes septate junctions
The protein-protein interaction domains present in Vari suggest it acts as
a scaffolding protein that helps bring together different components of the SJ
complex. This hypothesis is supported by our GST-pull down assay results
showing Vari's PDZ domain can directly bind the intracellular domain of Nrx, a
transmembrane SJ adhesion protein. Binding of the Vari PDZ domain to Nrx would
leave Vari's SH3, GUK and predicted C-terminal PDZ-binding motif available to
anchor other SJ components to the membrane, or to bring together different
transmembrane SJ components. One model is that Vari may help bring the
Dlg-Scib complex to the membrane through interfolding of the Vari and Dlg SH3
domains, which is made possible by the unique HOOK domain insert in the MAGUK
SH3 domains (McGee et al.,
2001
; Tavares et al.,
2001
). Whether or not Vari anchors the Dlg complex to the rest of
the SJ, genetic evidence indicates that Vari has functions beyond simply
bridging between transmembrane Nrx and intracellular SJ complexes, because
vari mutations can strongly enhance the phenotypes caused by
mutations in the Drosophila claudin sinuous, whereas
nrx mutations do not enhance sinuous mutations
(Wu et al., 2004
).
Vari extends the similarity between Drosophila SJ and vertebrate basolateral regions from polarity to adhesion complexes
By itself, the finding that Vari encodes a MAGUK was not unexpected, as
many MAGUKs are associated with cell-cell junctions (reviewed by
Harris and Lim, 2001
).
However, it is significant that Vari helps define a new subgroup of MAGUKs
that includes mammalian PALS2, because Vari and PALS2 both localize
basolaterally and bind the C-termini of basolateral cell adhesion proteins.
Thus, Vari and PALS2 bolster the similarity between Drosophila and
vertebrate epithelial basolateral regions that was first evidenced by the
common basolateral localization of the Scrib, Dlg and Lgl early polarity
proteins. However, by contrast to the polarity proteins, Vari is not required
for cell polarity but rather is expressed late in embryonic development and is
part of a cell-adhesion complex. Thus, Vari fundamentally extends the
similarity of Drosophila and vertebrate basolateral regions from
containing only conserved polarity complexes to containing both conserved
polarity and cell-adhesion complexes.
Epithelial junctions as modular entities
The finding of more extensive similarity between SJ and vertebrate
basolateral regions suggests that continued study of Drosophila SJs
will provide insight into vertebrate epithelial basolateral regions. Further,
these results support the idea that during evolution there has been
conservation of different junctional functions, such as forming paracellular
barriers and anchoring of polarity complexes. However, the comparison of TJs
and SJs also makes it clear that there has been limited conservation of which
particular functions have assorted to different junctions. An attractive
explanation for these somewhat contradictory observations is that junctional
functions are modular, and that the disparate junctions in different species
represent alternative combinations of functional modules. For example,
Drosophila SJs could be considered a combination of the claudin-based
paracellular-barrier function and the basolateral polarity proteins Dlg, Scrib
and Lgl. Alternatively, vertebrate TJs could be considered a combination of
the claudin-based paracellular-barrier function and the apical polarity
complexes of Crbs-Baz and SdtaPKC-Par-6. Thus, when comparing junctions
between species, it is likely to be more useful to compare specific junctional
functions, such as molecular details of polarity or barrier functions, than to
attempt to directly compare junctions in their entirety.
If complex junctions such as TJs and SJs are comprised of functional
modules, one would expect that these junctions should contain distinct
molecular subcomplexes that mediate distinct functions. Consistent with this
proposal, extensive work by many labs has shown that the polarity proteins of
Crb-Sdt and Baz-cdc42-aPKC form specific complexes (reviewed by
Margolis and Borg, 2005
).
Claudin proteins appear to be part of a `barrier complex' because claudins are
required for and co-localize with the paracellular barrier in both
Drosophila and vertebrates. Functional demonstration of the
independence of the barrier and polarity complexes in both species is provided
by the observations that cell polarity is not affected by selective disruption
of the barrier complex in either mammals by knockdown of ZO-1 and ZO-2
(Umeda et al., 2006
), or in
Drosophila by mutations in claudin genes
(Behr et al., 2003
;
Wu et al., 2004
). The
Vari/PALS2 proteins could play a pivotal role in allowing cytoplasmic
subcomplexes to associate different adhesion-junctional complexes, either in
different cell types or during evolution, because changing which adhesion
complex Vari or PALS2 associate with could be as simple as changing the four
amino acid PDZ-binding motifs of one or a few transmembrane proteins. It seems
likely that evolving a few unstructured amino acids would be significantly
easier than evolving three-dimensional binding surfaces. Thus, Vari and its
homologs could provide crucial - but malleable - links between conserved
intracellular complexes and the divergent transmembrane junctional complexes
found across the animal kingdom.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/5/999/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, J. M., Van Itallie, C. M. and Fanning, A. S. (2004). Setting up a selective barrier at the apical junction complex. Curr. Opin. Cell Biol. 16,140 -145.[CrossRef][Medline]
Araujo, S. J., Aslam, H., Tear, G. and Casanova, J. (2005). mummy/cystic encodes an enzyme required for chitin and glycan synthesis, involved in trachea, embryonic cuticle and CNS development-analysis of its role in Drosophila tracheal morphogenesis. Dev. Biol. 288,179 -193.[CrossRef][Medline]
Bachmann, A., Timmer, M., Sierralta, J., Pietrini, G.,
Gundelfinger, E. D., Knust, E. and Thomas, U. (2004). Cell
type-specific recruitment of Drosophila Lin-7 to distinct MAGUK-based protein
complexes defines novel roles for Sdt and Dlg-S97. J. Cell
Sci. 117,1899
-1909.
Baumgartner, S., Littleton, J. T., Broadie, K., Bhat, M. A., Harbecke, R., Lengyel, J. A., Chiquet-Ehrismann, R., Prokop, A. and Bellen, H. J. (1996). A Drosophila neurexin is required for septate junction and blood-nerve barrier formation and function. Cell 87,1059 -1068.[CrossRef][Medline]
Behr, M., Riedel, D. and Schuh, R. (2003). The claudin-like megatrachea is essential in septate junctions for the epithelial barrier function in Drosophila. Dev. Cell 5, 611-620.[CrossRef][Medline]
Beitel, G. J. and Krasnow, M. A. (2000). Genetic control of epithelial tube size in the Drosophila tracheal system. Development 127,3271 -3282.[Abstract]
Bhat, M. A., Izaddoost, S., Lu, Y., Cho, K. O., Choi, K. W. and Bellen, H. J. (1999). Discs Lost, a novel multi-PDZ domain protein, establishes and maintains epithelial polarity. Cell 96,833 -845.[CrossRef][Medline]
Bilder, D. (2004). Epithelial polarity and
proliferation control: links from the Drosophila neoplastic tumor suppressors.
Genes Dev. 18,1909
-1925.
Bilder, D. and Perrimon, N. (2000). Localization of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403,676 -680.[CrossRef][Medline]
Butler, H., Levine, S., Wang, X., Bonyadi, S., Fu, G., Lasko,
P., Suter, B. and Doerig, R. (2001). Map position and
expression of the genes in the 38 region of Drosophila.
Genetics 158,1597
-1614.
Chen, C. K., Kuhnlein, R. P., Eulenberg, K. G., Vincent, S., Affolter, M. and Schuh, R. (1998). The transcription factors KNIRPS and KNIRPS RELATED control cell migration and branch morphogenesis during Drosophila tracheal development. Development 125,4959 -4968.[Abstract]
Chihara, T. and Hayashi, S. (2000). Control of tracheal tubulogenesis by Wingless signaling. Development 127,4433 -4442.[Abstract]
Devine, W. P., Lubarsky, B., Shaw, K., Luschnig, S., Messina, L.
and Krasnow, M. A. (2005). Requirement for chitin
biosynthesis in epithelial tube morphogenesis. Proc. Natl. Acad.
Sci. USA 102,17014
-17019.
Fehon, R. G., Dawson, I. A. and Artavanis-Tsakonas, S. (1994). A Drosophila homologue of membrane-skeleton protein 4.1 is associated with septate junctions and is encoded by the coracle gene. Development 120,545 -557.[Abstract]
Franch-Marro, X. and Casanova, J. (2002). spalt-induced specification of distinct dorsal and ventral domains is required for Drosophila tracheal patterning. Dev. Biol. 250,374 -382.[CrossRef][Medline]
Funke, L., Dakoji, S. and Bredt, D. S. (2005). Membrane-associated guanylate kinases regulate adhesion and plasticity at cell junctions. Annu. Rev. Biochem. 74,219 -245.[CrossRef][Medline]
Genova, J. L. and Fehon, R. G. (2003).
Neuroglian, Gliotactin, and the Na+/K+ ATPase are essential for septate
junction function in Drosophila. J. Cell Biol.
161,979
-989.
Giot, L., Bader, J. S., Brouwer, C., Chaudhuri, A., Kuang, B.,
Li, Y., Hao, Y. L., Ooi, C. E., Godwin, B., Vitols, E. et al.
(2003). A protein interaction map of Drosophila melanogaster.
Science 302,1727
-1736.
Harris, B. Z. and Lim, W. A. (2001). Mechanism and role of PDZ domains in signaling complex assembly. J. Cell Sci. 114,3219 -3231.
Hemphala, J., Uv, A., Cantera, R., Bray, S. and Samakovlis,
C. (2003). Grainy head controls apical membrane growth and
tube elongation in response to Branchless/FGF signalling.
Development 130,249
-258.
Kamberov, E., Makarova, O., Roh, M., Liu, A., Karnak, D.,
Straight, S. and Margolis, B. (2000). Molecular cloning and
characterization of Pals, proteins associated with mLin-7. J. Biol.
Chem. 275,11425
-11431.
Kennerdell, J. R. and Carthew, R. W. (1998). Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95,1017 -1026.[CrossRef][Medline]
Knust, E. and Bossinger, O. (2002). Composition
and formation of intercellular junctions in epithelial cells.
Science 298,1955
-1959.
Konig, C., Yan, Y. L., Postlethwait, J., Wendler, S. and Campos-Ortega, J. A. (1999). A recessive mutation leading to vertebral ankylosis in zebrafish is associated with amino acid alterations in the homologue of the human membrane-associated guanylate kinase DLG3. Mech. Dev. 86,17 -28.[CrossRef][Medline]
Lamb, R. S., Ward, R. E., Schweizer, L. and Fehon, R. G.
(1998). Drosophila coracle, a member of the protein 4.1
superfamily, has essential structural functions in the septate junctions and
developmental functions in embryonic and adult epithelial cells.
Mol. Biol. Cell 9,3505
-3519.
Le, T., Liang, Z., Patel, H., Yu, M. H., Sivasubramaniam, G.,
Slovitt, M., Tanentzapf, G., Mohanty, N., Paul, S. M., Wu, V. M. et al.
(2006). A new family of Drosophila balancer chromosomes
with a w- dfd-GMR YFP marker.
Genetics. 174,2255
-2257.
Luschnig, S., Batz, T., Armbruster, K. and Krasnow, M. A. (2006). serpentine and vermiform encode matrix proteins with chitin binding and deacetylation domains that limit tracheal tube length in Drosophila. Curr. Biol. 16,186 -194.[CrossRef][Medline]
Margolis, B. and Borg, J. P. (2005). Apicobasal
polarity complexes. J. Cell Sci.
118,5157
-5159.
McGee, A. W., Dakoji, S. R., Olsen, O., Bredt, D. S., Lim, W. A. and Prehoda, K. E. (2001). Structure of the SH3-guanylate kinase module from PSD-95 suggests a mechanism for regulated assembly of MAGUK scaffolding proteins. Mol. Cell 8,1291 -1301.[CrossRef][Medline]
Miller, K. G., Field, C. M. and Alberts, B. M.
(1989). Actin-binding proteins from Drosophila embryos:
a complex network of interacting proteins detected by Factin affinity
chromatography. J. Cell Biol.
109,2963
-2975.
Moussian, B., Tang, E., Tonning, A., Helms, S., Schwarz, H.,
Nusslein-Volhard, C. and Uv, A. E. (2006). Drosophila
Knickkopf and Retroactive are needed for epithelial tube growth and cuticle
differentiation through their specific requirement for chitin filament
organization. Development
133,163
-171.
Myat, M. M., Lightfoot, H., Wang, P. and Andrew, D. J. (2005). A molecular link between FGF and Dpp signaling in branch-specific migration of the Drosophila trachea. Dev. Biol. 281,38 -52.[CrossRef][Medline]
Nakagawa, T., Futai, K., Lashuel, H. A., Lo, I., Okamoto, K., Walz, T., Hayashi, Y. and Sheng, M. (2004). Quaternary structure, protein dynamics, and synaptic function of SAP97 controlled by L27 domain interactions. Neuron 44,453 -467.[CrossRef][Medline]
Oda, H., Uemura, T., Harada, Y., Iwai, Y. and Takeichi, M. (1994). A Drosophila homolog of cadherin associated with armadillo and essential for embryonic cell-cell adhesion. Dev. Biol. 165,716 -726.[CrossRef][Medline]
Paul, S. M., Ternet, M., Salvaterra, P. M. and Beitel, G. J.
(2003). The Na+/K+ ATPase is required for septate junction
function and epithelial tube-size control in the Drosophila tracheal system.
Development 130,4963
-4974.
Paul, S. M., Pallidino, M. J. and Beitel, G. J.
(2007). A pump-independent function of the Na,K-ATPase is
required for epithelial junction function and tracheal tube-size control.
Development 134,147
-155.
Ribeiro, C., Neumann, M. and Affolter, M. (2004). Genetic control of cell intercalation during tracheal morphogenesis in Drosophila. Curr. Biol. 14,2197 -2207.[CrossRef][Medline]
Samakovlis, C., Hacohen, N., Manning, G., Sutherland, D. C., Guillemin, K. and Krasnow, M. A. (1996). Development of the Drosophila tracheal system occurs by a series of morphologically distinct but genetically coupled branching events. Development 122,1395 -1407.[Abstract]
Shingai, T., Ikeda, W., Kakunaga, S., Morimoto, K., Takekuni,
K., Itoh, S., Satoh, K., Takeuchi, M., Imai, T., Monden, M. et al.
(2003). Implications of nectin-like
molecule-2/IGSF4/RA175/SgIGSF/TSLC1/SynCAM1 in cell-cell adhesion and
transmembrane protein localization in epithelial cells. J. Biol.
Chem. 278,35421
-35427.
Strand, D., Raska, I. and Mechler, B. M.
(1994). The Drosophila lethal(2)giant larvae tumor suppressor
protein is a component of the cytoskeleton. J. Cell
Biol. 127,1345
-1360.
Swanson, L. E. and Beitel, G. J. (2006). Tubulogenesis: an inside job. New work shows that a dynamic and highly patterned apical extracellular matrix regulates epithelial cell shape and tube size from within the lumen of the Drosophila tracheal system. Curr. Biol. 16,R51 -R53.[CrossRef][Medline]
Tanentzapf, G. and Tepass, U. (2003). Interactions between the crumbs, lethal giant larvae and bazooka pathways in epithelial polarization. Nat. Cell Biol. 5, 46-52.[CrossRef][Medline]
Tavares, G. A., Panepucci, E. H. and Brunger, A. T. (2001). Structural characterization of the intramolecular interaction between the SH3 and guanylate kinase domains of PSD-95. Mol. Cell 8,1313 -1325.[CrossRef][Medline]
Tepass, U., Tanentzapf, G., Ward, R. and Fehon, R. (2001). Epithelial cell polarity and cell junctions in Drosophila. Annu. Rev. Genet. 35,747 -784.[CrossRef][Medline]
Thibault, S. T., Singer, M. A., Miyazaki, W. Y., Milash, B., Dompe, N. A., Singh, C. M., Buchholz, R., Demsky, M., Fawcett, R., Francis-Lang, H. L. et al. (2004). A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat. Genet. 36,283 -287.[CrossRef][Medline]
Tomancak, P., Beaton, A., Weiszmann, R., Kwan, E., Shu, S., Lewis, S. E., Richards, S., Ashburner, M., Hartenstein, V., Celniker, S. E. et al. (2002). Systematic determination of patterns of gene expression during Drosophila embryogenesis. Genome Biol. 3, RESEARCH0088.
Tonning, A., Hemphala, J., Tang, E., Nannmark, U., Samakovlis, C. and Uv, A. (2005). A transient luminal chitinous matrix is required to model epithelial tube diameter in the Drosophila trachea. Dev. Cell 9,423 -430.[CrossRef][Medline]
Tseng, T. C., Marfatia, S. M., Bryant, P. J., Pack, S., Zhuang, Z., O'Brien, J. E., Lin, L., Hanada, T. and Chishti, A. H. (2001). VAM-1: a new member of the MAGUK family binds to human Veli-1 through a conserved domain. Biochim. Biophys. Acta 1518,249 -259.[Medline]
Umeda, K., Ikenouchi, J., Katahira-Tayama, S., Furuse, K., Sasaki, H., Nakayama, M., Matsui, T., Tsukita, S. and Furuse, M. (2006). ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell 126,741 -754.