|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 7 February 2007
doi: 10.1242/dev.02799
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Biology, Institute for Stem Cell and Regenerative Medicine, University of Washington, Box 351800, Seattle WA 98195-1800, USA.
Author for correspondence (e-mail:
dparichy{at}u.washington.edu)
Accepted 4 January 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Pigment pattern, Morphogenesis, kit, Melanophore, Evolution
| INTRODUCTION |
|---|
|
|
|---|
Pigment patterns of Danio fishes provide an opportunity to study
genes underlying evolutionary change, the resulting cellular consequences, and
how alterations in cell behaviors affect species differences in form. Danios
exhibit virtually indistinguishable embryonic and early larval pigment
patterns but a diverse array of adult pigment patterns, ranging from
horizontal stripes to vertical bars, and from uniform patterns to alternating
spots and lines (Quigley et al.,
2004
; Quigley et al.,
2005
; Parichy,
2006
). Pigment cells comprising these patterns include black
melanophores, yellow xanthophores, iridescent iridophores and red
erythrophores (Kelsh, 2004
;
Parichy et al., 2006
). Because
the cells are readily visible, they allow for analyses of cell behaviors - and
how these behaviors differ among species - even as pigment patterns develop in
the living fish.
Of the many danio adult pigment patterns, that of the zebrafish, D.
rerio, is most studied: in a comparative context, the understanding of
pattern-forming mechanisms in D. rerio can be used to suggest
hypotheses for changes in genes and cell behaviors that may underlie pattern
differences among species. Danio rerio embryos develop an early
larval pigment pattern that is transformed into the adult pigment pattern
beginning
2 weeks post-fertilization. This metamorphosis involves the
loss of embryonic/early larval melanophores and the appearance of
`metamorphic' melanophores that develop from latent precursors
(Johnson et al., 1995
;
Parichy et al., 2000b
;
Parichy and Turner, 2003b
;
Quigley et al., 2004
). After
2 additional weeks, an early adult pigment pattern has formed, consisting
of two dark `primary' stripes of melanophores and a single light `primary
interstripe' of xanthophores and iridophores. During later growth, additional
stripes and interstripes are added (Fig.
1A).
Metamorphic melanophores in adult stripes of D. rerio appear
homogeneous yet actually comprise two populations
(Fig. 1B)
(Johnson et al., 1995
;
Parichy et al., 1999
;
Parichy et al., 2000b
). Early
metamorphic (EM) melanophores appear first scattered over the flank, but then
migrate to sites of stripe formation. Late metamorphic (LM) melanophores
develop subsequently within the nascent stripes.
These populations are genetically distinct. EM melanophores depend on the
kit receptor tyrosine kinase, which is expressed by melanophores and their
precursors. Mutants for a null allele, kitb5, completely
lack EM melanophores, yet retain LM melanophores, which develop in two to
three sparsely populated stripes (Fig.
1C, fish 1 versus fish 2)
(Johnson et al., 1995
;
Parichy et al., 1999
). This
situation differs from mouse, in which Kit null alleles lack all
melanocytes (Besmer et al.,
1993
; Wehrle-Haller,
2003
). LM melanophores are kit-independent, yet are
ablated in mutants for colony stimulating factor-1 receptor
(csf1r; previously known as fms) and endothelin receptor
b1 (ednrb1). When mutants for either of these genes are combined
with kitb5, both EM and LM melanophores are lost
(Johnson et al., 1995
;
Parichy et al., 2000a
;
Parichy et al., 2000b
;
Rawls et al., 2001
)
(Fig. 1C, fish 3). In D.
rerio then, EM melanophores are kit-dependent whereas LM
melanophores are kit-independent (though csf1r-dependent and
ednrb1-dependent).
|
As EM and LM melanophores are defined by mutant phenotypes, one approach to
testing for their presence in other species would be to isolate heterospecific
mutants for the corresponding, orthologous genes. Here, we ask if both EM and
LM melanophores are present in D. albolineatus, by isolating a D.
albolineatus kit mutant. We chose this species because it represents a
different Danio clade from D. rerio
(Quigley et al., 2005
) and
because it exhibits a different pigment pattern of nearly uniformly dispersed
melanophores that might, a priori, result from very different underlying
mechanisms (Fig. 1D,E).
We can make several predictions. For example, if distinct EM and LM
melanophores are not present in wild-type D. albolineatus
(Fig. 1F, fish 4), then either:
all melanophores are kit-dependent (as in mouse), and a kit
mutant should completely lack melanophores
(Fig. 1F, fish 5); or all
melanophores are kit-independent and a kit mutant should
resemble the wild type. As melanophores are widely dispersed in D.
albolineatus, it might be anticipated that only dispersed EM melanophores
would be present and LM melanophores would be absent, as the latter develop
only in stripes in D. rerio. Consistent with the idea that LM
melanophores might be missing in D. albolineatus, we previously
showed that csf1r may have contributed to stripe loss in this species
(Parichy and Johnson, 2001
;
Quigley et al., 2005
);
kit mutant D. albolineatus might therefore resemble
kit; csf1r double-mutant D. rerio
(Fig. 1C, fish 3). By contrast,
if D. albolineatus has distinct EM and LM melanophores, then a
kit mutant should develop some melanophores but not others. The
pattern of residual melanophores should then reveal if species differences
reflect evolutionary alterations to EM melanophores, LM melanophores or both
(Fig. 1F, fishes 6 and 7; see
below).
Our analyses demonstrate that D. albolineatus exhibit distinct populations of kit-dependent EM and kit-independent LM melanophores, suggesting that these populations may be present more generally in Danio. We find that kit mutant D. albolineatus develop LM melanophores, and that these melanophores develop in stripes - similar to kit mutant D. rerio - despite the nearly uniform melanophore pattern in adults. Nevertheless, kit mutant D. albolineatus develop fewer LM melanophores than do kit mutant D. rerio. These findings indicate that the difference between D. rerio and D. albolineatus pigment patterns evolved by the extent to which a pattern of stripes is enhanced or obscured as: EM melanophores migrate (D. rerio) or fail to migrate (D. albolineatus); and as LM melanophores develop in large numbers (D. rerio) or in small numbers (D. albolineatus) at sites of stripe formation. In defining the cellular context for pigment pattern formation in these species, our study sets the stage for analyses of molecular mechanisms underlying evolutionary diversification, as well as the evolution of kit function in pigment cell lineages.
| MATERIALS AND METHODS |
|---|
|
|
|---|
F2 non-complementation screen for kit mutant D. albolineatus
To obtain D. albolineatus mutant for the kit gene, we
screened mutagenized D. albolineatus by non-complementation against
kitb5 mutant D. rerio. Adult male D.
albolineatus were mutagenized three times over 3 weeks with 3 mmol/l
N-ethyl-N-nitrosourea (Sigma)
(Solnica-Krezel et al., 1994
).
These fish were then crossed to unmutagenized D. albolineatus females
and their progeny were reared to maturity. Male F1 progeny of mutagenized fish
were then crossed to female kit mutant D. rerio by in vitro
fertilization. The resulting F2 hybrid embryos were reared through 4 days
post-fertilization (dpf) and screened for a kit mutant embryonic
melanophore defect (see Results). Hybrid families with non-complementation
phenotypes identified founder D. albolineatus males potentially
carrying a new mutant allele of D. albolineatus kit. Founder F1
D. albolineatus males were retested against kit mutant
D. rerio and outcrossed to unmutagenized D. albolineatus
females for recovery of new mutants entirely within the D.
albolineatus background.
Molecular methods
For PCR and sequencing, genomic DNAs were isolated from small quantities of
fin tissue. Caudal fins were collected in 50 µl DNA extraction buffer (80
mmol/l KCl, 10 mmol/l Tris pH 8.0, 1 mmol/l EDTA, 0.3% Tween-20, 0.3% NP-40),
heated at 95°C for 5 minutes, and cooled on ice. Samples were then
digested with a final concentration of 1 µg/µl proteinase-K at 56°C
for 1 hour with occasional vortexing, heated at 95°C for 10 minutes,
chilled on ice and then extracted with pH 8.5 phenol:chloroform:isoamyl
alcohol (25:24:1). Recovered aqueous phases were diluted 1:40 for use in PCR.
For analyses of cDNAs, total RNAs were isolated from fins or embryos with
Trizol (Invitrogen) as per manufacturer's instructions and cDNAs were
synthesized using Superscript II reverse transcriptase (Invitrogen) and
oligo-dT priming. Sequencing used ABI BigDye v3.1 chemistry and ABI 3100
capillary sequencers. Primer sets (forward, reverse) for RT-PCR were: A1,
AGTTTTCCCCGAGTGAAATGTA, TGGACATGAGAACTGGATTCCT; A2, TGTCCGACTTGTTCCAGACGCG,
CCCTTCATAGGACACAATCTGC; A3, CCTGAGCCTGAGCTCTGTGAC, CCACTGTAGCTCCAGGAAAAC.
Imaging and quantitative methods
Fish were imaged using an Olympus SZX12 stereomicroscope or Zeiss Axioplan
2 compound microscope interfaced to Axiocam II digital cameras. For
quantitation, images were transferred to Adobe Photoshop CS2 and analyzed
using FoveaPro 4 (Reindeer Graphics). For analyzing melanophore densities, we
measured the height of the flank at the anterior margin of the anal fin (haa).
We then defined a square area of interest with equal dimensions of 0.6 haa, an
anterior boundary marked by the anterior margin of the anal fin, and a dorsal
boundary just ventral to where dorsal scale melanophores occur in both D.
rerio and D. albolineatus (
0.3 haa from the dorsal margin
of the flank). We counted all melanophores fully within areas of interest as
well as melanophores overlapping anterior or dorsal edges.
Histological analyses of melanophore development
Tyrosinase-expressing presumptive melanophore precursors were identified by
incubating larvae with the melanin precursor, L-dopa
(McCauley et al., 2004
;
Quigley et al., 2004
;
Quigley et al., 2005
). Larvae
were fixed 2 hours in 4% paraformaldehyde in phosphate buffered saline (PBS),
rinsed in three changes of PBS, then placed in a solution containing 0.1%
L-dopa in PBS for 1 hour to overnight.
Fin regeneration experiments
Caudal fins were amputated with a razor blade about halfway between base
and distal tip. Fins were allowed to regenerate in fish system water
(
27°C) containing 0.2 mmol/l phenylthiourea (PTU) to inhibit melanin
synthesis (Rawls and Johnson,
2000
). To reveal newly differentiated melanophores, PTU-treated
fish were imaged, transferred to system water without PTU, and re-imaged
12 hours later when regenerative melanophores had developed melanin.
| RESULTS |
|---|
|
|
|---|
600 F2 hybrid families by crossing
mutagenized F1 D. albolineatus to homozygous
kitb5 mutant D. rerio. Several families exhibited
melanophore defects without lesions in kit cDNAs and were discarded.
One family exhibited all the expected kit mutant phenotypes in
50% of hybrid offspring and we recovered the mutant (wp.a14e1)
entirely within the D. albolineatus background from the presumptively
heterozygous, mutagenized F1 D. albolineatus founder.
Danio albolineatus embryos homozygous for the wp.a14e1
mutation exhibit fewer melanophores than wild type, ectopic melanophores
behind the otocyst (Fig. 2B,D),
and death of all embryonic/early larval melanophores over several days (data
not shown). To see whether wp.a14e1 affects kit expression,
we amplified a 196 bp amplicon (A1) from kit cDNA isolated from adult
fins (Fig. 2E,F). RT-PCR for A1
revealed lower transcript abundance in wp.a14e1 compared with wild
type. RT-PCR for a second amplicon, A2, further showed a smaller size in
mutant cDNAs (Fig. 2E,F).
Sequencing wp.a14e1 kit cDNA revealed a 356 bp deletion that
corresponds to exons 5 and 6, as assessed by sequence comparison with the
Ensembl predicted genomic structure for D. rerio kit (kita,
ENSDARG00000043317). This deletion (N247
) causes a frameshift with 33
novel amino acids and a premature stop codon
(Fig. 2F) upstream of the
transmembrane and kinase domains.
As wp.a14e1 kit cDNA lacks precisely two exons, we considered the possibility that a splicing defect might reduce, without eliminating, wild-type transcript. To test this idea, we attempted to amplify a portion of the deleted exons (A3) by RT-PCR. While A3 amplified from wild type, we could not detect amplification from wp.a14e1 homozygotes, suggesting that no wild-type transcript was present (Fig. 2F,E). We also considered the possibility that alternative splicing downstream of the deleted exons could produce in-frame transcripts that retain some residual activity. To test this idea, we attempted to amplify full-length and nearly full-length kit cDNAs from wild type and wp.a14e1 homozygotes. Although an appropriately sized fragment amplified from wild type, we could not detect multiple smaller transcripts in wp.a14e1 (data not shown).
|
kit mutant reveals kit-dependent and kit-independent melanophores in D. albolineatus
Isolation of a kit mutant D. albolineatus allowed us to
test whether genetically distinct metamorphic melanophores are present. We
find that D. albolineatus resembles D. rerio in having
distinct kit-dependent and kit-independent metamorphic
melanophores. During early pigment pattern metamorphosis
(Fig. 3;
15-35 dpf),
wild-type D. rerio developed new, metamorphic melanophores (although
total melanophore densities changed relatively little, presumably due to
countervailing effects of overall somatic growth). Wild-type D.
albolineatus showed small increases in melanophore densities during this
period. Simultaneously, kit mutants of both species completely lacked
melanophores. Thus, D. albolineatus exhibits a population of early
metamorphic kit-dependent melanophores; we designate these EM
melanophores, and we infer that these cells correspond to the EM melanophores
of D. rerio.
During late pigment pattern metamorphosis
(Fig. 3;
36-48 dpf),
wild-type D. rerio exhibited a sharp but transient increase in
melanophore density, whereas wild-type D. albolineatus showed a
continued slow increase. kit mutants of both species developed
residual kit-independent melanophores during this period. Thus,
D. albolineatus exhibits late kit-independent metamorphic
melanophores; we designate these cells LM melanophores, presumably
corresponding to LM melanophores of D. rerio.
Pigment pattern evolution by changes in EM and LM melanophores
By subtracting away EM melanophores, and revealing a residual pattern of LM
melanophores, kit mutants should provide a glimpse into the relative
roles of these melanophore populations during pigment pattern evolution: if
this species difference results principally from changes in LM melanophores,
then kit mutant D. rerio and kit mutant D.
albolineatus should have very different pigment patterns of residual LM
melanophores (Fig. 1C,F: fish 2
versus fish 6); or, if the species difference results principally from changes
in EM melanophores, then the mutants should have similar pigment patterns of
residual LM melanophores (Fig.
1C,F: fish 2, fish 7).
|
Further comparison of wild types and kit mutants reveals evolutionary changes in LM melanophores as well. In both D. rerio and D. albolineatus, kit inactivation caused a similar drop in total melanophore densities, corresponding to the loss of kit-dependent EM melanophores (Fig. 3). By contrast, LM melanophores that developed in kit mutants were far fewer in D. albolineatus than in D. rerio (Fig. 3, Fig. 4G,H). Together, these observations show that pigment pattern differences between wild-type D. rerio and wildtype D. albolineatus involve: (1) changes in the morphogenesis of kit-dependent EM melanophores; and (2) changes in the population size of kit-independent LM melanophores.
Late kit requirement in metamorphic melanophore lineage development
To better understand when kit is required within metamorphic
melanophores, and whether this requirement is similar in D. rerio and
D. albolineatus, we examined the distribution of late-stage
melanoblasts, which are competent to produce melanin when supplied with the
melanin precursor, L-dopa (Quigley et al.,
2004
). If kit is required during a late step in
melanophore differentiation, L-dopa+ melanoblasts should be
observed in kit mutants in regions where melanophores develop in wild
type but not in kit mutants. Conversely, if kit is required
at early steps of melanophore differentiation or specification,
L-dopa+ melanoblasts should be absent from such regions
in kit mutants. As kit mutants of both species lack
melanophores over the dorsum, we examined this region at the end of pigment
pattern metamorphosis. Following L-dopa incubation, very few newly melanized
cells were observed in wild-type D. rerio
(Fig. 5A,A'), suggesting
that most melanoblasts had already differentiated as melanophores. In
kit mutant D. rerio, larger numbers of
L-dopa+ melanoblasts were present
(Fig. 5B,B') than in wild
type; these cells may die or simply fail to differentiate.
In wild-type D. albolineatus, L-dopa incubation revealed numerous
previously unmelanized melanoblasts (Fig.
5C,C'). Many of these cells die without reaching a melanized
stage, revealing a late block in melanophore development that contributes to
the reduced total melanophore number in this species, as reported previously
(Quigley et al., 2005
). If
kit functions at a similar step in melanophore development in D.
albolineatus, then kit mutant D. albolineatus should
have similar or greater numbers of L-dopa+ cells. Consistent with
this prediction, L-dopa+ melanoblasts in kit mutant D.
albolineatus were at least as numerous
(Fig. 5D,D') as
melanoblasts and melanophores in wild-type D. albolineatus. These
results suggest that: (1) kit is required during a late step in
metamorphic melanophore development; and (2) this requirement is similar
between species.
Differential kit-dependence of regeneration melanophores and other lineages
In D. rerio, amputation of the fin is followed by regeneration of
the fin and its pigment pattern (Goodrich
and Nichols, 1931
). An early population of `primary' regeneration
melanophores requires kit for its development, whereas a later
population of `secondary' regeneration melanophores develops independently of
kit (Rawls and Johnson,
2000
). We tested whether similar kit-dependent and
kit-independent regenerative melanophores are present in D.
albolineatus. In wild-type D. albolineatus, large numbers of
regenerative melanophores develop by 10 days post-amputation (dpa)
(Fig. 6A). In kit
mutant D. albolineatus, there were far fewer melanophores even in the
unamputated fin, and new regenerative melanophores failed to develop by 10 dpa
(Fig. 6B); after longer periods
(
20 dpa) a few kit-independent regenerative melanophores were
observed (Fig. 6C). Thus,
kit-independent regenerative melanophores are found in both species.
Finally, mammalian kit mutants have defects in hematopoiesis and
primordial germ cell development (Russell,
1949
; Besmer et al.,
1993
) that are not found in D. rerio kit mutants
(Parichy et al., 1999
). We
observed no gross defects for hematopoiesis or fertility in kit
mutant D. albolineatus.
|
|
| DISCUSSION |
|---|
|
|
|---|
|
Our demonstration that D. albolineatus has
kit-independent melanophores shows that these cells are not unique to
D. rerio and may be present more widely among danios. Whether these
cells have a broader phylogenetic distribution remains uncertain; emerging
transgenic technologies as well as genetic screens offer the prospect of
testing for kit-independent melanophores in additional model
organisms (Kelsh et al., 2004
;
Chapman et al., 2005
;
Goda et al., 2006
;
Sobkow et al., 2006
). Whatever
the phylogenetic distribution of these cells, our genetic deconstruction of
pigment pattern evolution illustrates a powerful approach to identifying
homology and novelty in the evolution of developmental mechanisms more
generally.
While our data reveal kit-dependent EM melanophores and
kit-independent LM melanophores, the reasons for the different
genetic requirements of these populations remain obscure. At least three
possibilities can be suggested. First, duplication of an ancestral
kit gene with subsequent partitioning of daughter gene activities
between EM and LM melanophores would seem an attractive explanation, given the
history of such events for receptor tyrosine kinases
(Braasch et al., 2006
;
Grassot et al., 2006
).
Nevertheless, a paralogous kit locus in D. rerio, kitb, is
not detectably expressed in either embryonic melanophores
(Mellgren and Johnson, 2005
)
or metamorphic melanophores (D.M.P., unpublished).
Second, differential kit-dependence might reflect particular
morphogenetic activities. For instance, mouse melanoblasts require
kit during proliferative and migratory phases, yet become independent
of kit transiently after reaching the dermis, and again once they
reach the hair follicle (Yoshida et al.,
1996
). In D. rerio embryonic melanophores, kit
is required initially for migration and, afterwards, transiently for survival
(Rawls and Johnson, 2003
).
Conceivably EM and LM melanophores differ in their kit-dependence
because they execute different morphogenetic behaviors. While it is tempting
to associate kit-dependence with the migration of EM melanophores
into stripes (Parichy et al.,
2000b
; Parichy and Turner,
2003b
), the corresponding cells in D. albolineatus do not
migrate substantially (Quigley et al.,
2005
) yet still require kit (this study), suggesting that
other morphogenetic differences would have to explain differential
kit-dependence of EM melanophores and LM melanophores.
Third, differential kit-dependence could result from compensatory
function by another genetic pathway. Such a pathway would presumably be
activated sufficiently only in LM melanophores, perhaps owing to their
microenvironment. For example, Kit and Ednrb exhibit some functional
redundancy in melanocytes (Hou et al.,
2004
; Aoki et al.,
2005
), and might have similar overlap in melanophores. Consistent
with this idea, ednrb1 mutation ablates residual LM melanophores in
kit mutant D. rerio
(Johnson et al., 1995
;
Parichy et al., 2000a
). This
model predicts that endothelins, or ligands for other candidate receptors,
should be present near LM melanophores but not EM melanophores.
Finally, our study provides new insights into the functions of kit
in kit-dependent melanophores, and the extent to which these
functions are conserved across species and developmental contexts. kit has
been implicated in survival, proliferation, differentiation and migration in
melanophore or melanocyte lineages, with different studies emphasizing
different primary roles depending on the particular stage and system
(Reid et al., 1995
;
Wehrle-Haller and Weston,
1995
; Bernex et al.,
1996
; Langtimm-Sedlak et al.,
1996
; Yoshida et al.,
1996
; Mackenzie et al.,
1997
; Parichy et al.,
1999
; Kelsh et al.,
2000
). Recent studies have demonstrated requirements for zebrafish
kit in embryonic melanophore migration and survival
(Rawls and Johnson, 2003
), for
population expansion during larval melanophore regeneration
(Yang et al., 2004
;
Yang and Johnson, 2006
), and
during terminal differentiation of regenerating fin melanophores as well as
larval melanophores when their development is delayed experimentally
(Rawls and Johnson, 2000
;
Mellgren and Johnson, 2004
).
Our finding of numerous melanoblasts in kit mutants of D.
rerio and D. albolineatus indicates that kit is
required during late steps in metamorphic melanophore development as well,
presumably to promote survival or differentiation. The various functions for
kit suggest the flexible roles this signaling pathway plays during
melanophore and melanocyte development, and the differential sensitivity of
these functions to perturbations across developmental contexts.
Cellular bases for species differences
An examination of phenotypes within Danio suggests that a pattern
including horizontal stripes is likely to be ancestral, whereas the especially
distinctive stripes of D. rerio and the more uniform pattern of
D. albolineatus are both derived
(Parichy and Johnson, 2001
;
Quigley et al., 2005
). What
are the cellular bases for these novel phenotypes? Our analyses indicate that
species differences reflect changes in both EM and LM melanophores, yet these
populations have been affected in different ways.
Despite the different pigment patterns of wild-type D. rerio and
D. albolineatus, we find similar melanophore stripes in kit
mutants of both species. This implies that species differences depend in part
on changes in the distribution of EM melanophores, which are subtracted away
in the kit mutants. During normal development, EM melanophores arise
dispersed over the flank in D. rerio and in D. albolineatus.
These cells migrate to join developing stripes in D. rerio, but
migrate little in D. albolineatus, remaining in their dispersed
arrangement. Why should these cells not migrate? In D. rerio,
melanophore movement into stripes requires interactions between melanophores
and xanthophores (Parichy et al.,
2000b
; Parichy and Turner,
2003a
), as well as interactions between melanophores themselves
(Maderspacher and Nusslein-Volhard,
2003
; Watanabe et al.,
2006
). The lack of EM melanophore migration in D.
albolineatus might reflect changes in these cellular interactions, a
possibility supported by interspecific hybridization studies
(Quigley et al., 2005
). A
variety of candidate patterning molecules
(Nishimura et al., 1999
;
Santiago and Erickson, 2002
;
Iwashita et al., 2006
;
Watanabe et al., 2006
) could
contribute to such interactions and are currently being tested for such roles.
Nevertheless, factors other than cell-cell interactions could explain this
species difference as well. For example, the kit pathway is itself a
candidate: both kit mutant D. rerio embryos and wild-type
D. albolineatus adults have fewer melanophores, reduced melanophore
migration, increased melanophore death and numerous melanophores and
melanoblasts in the epidermis (Quigley et
al., 2005
). While the kit mutant phenotype of D.
albolineatus shows that kit retains a function in this species,
these data do not exclude more subtle evolutionary changes in kit or
its pathway.
Our analyses also show that kit-independent LM melanophores have
contributed to the species difference between D. rerio and D.
albolineatus. Whereas D. rerio develops numerous LM melanophores
in its nascent stripes, D. albolineatus develops far fewer of these
cells. If, as we surmise, no kit activity is present in either
kit mutant, we can ask how LM melanophore populations have changed to
make stripes more or less conspicuous. If LM melanophores develop due to kitb
activity or compensatory activity by a different genetic pathway (e.g.
endothelin signaling), then such loci would be good candidates for
contributing to the species difference. However, LM melanophores of D.
rerio also require csf1r, and this pathway has itself been
implicated in generating the different pigment patterns of D. rerio
and D. albolineatus. In D. rerio, csf1r promotes xanthophore
development and LM melanophore development
(Parichy et al., 2000b
),
whereas D. albolineatus has more xanthophores and fewer LM
melanophores than D. rerio (this study)
(Quigley et al., 2005
). This
might be seen as a csf1r-dependent change in the allocation of cells,
perhaps from a common precursor, toward xanthophores and away from LM
melanophores. Nevertheless, our histological analyses show that late-stage
melanoblasts are plentiful in D. albolineatus, arguing against this
model. Further dissection of LM melanophore development in D. rerio
should clarify the roles of csf1r and other pathways, and should
suggest additional hypotheses for species differences.
This study indicates that a mostly uniform pigment pattern in D.
albolineatus arose in part by obscuring an ancestral stripe pattern:
through a failure of EM melanophores to migrate into stripes, and by a reduced
number of LM melanophores constituting the stripes themselves. The residual
stripes that form in kit mutant D. albolineatus reveal
latent stripe-forming potential that is, nevertheless, somewhat predicted by
the phenotype of wild-type larval D. albolineatus, in which
melanophores adjacent to the primary interstripe tend to be larger and darker
(Fig. 1D). A similar pattern
comprising primary melanophore stripes and a primary interstripe occurs in
other juvenile danios, some of which then develop adult pigment patterns very
different from either D. rerio or D. albolineatus
(Quigley et al., 2004
) (e.g.
D. dangila; D.M.P., unpublished, and movies at
http://protist.biology.washington.edu/dparichy].
Conceivably, the simple juvenile pattern of stripes and interstripe is a
`groundplan' that is modified in different ways in different Danio
species. An analogous groundplan is present in larval salamanders, in which
the lateral lines have a conserved role in initiating melanophore stripe
formation: stripes have been enhanced by additional stripe-forming mechanisms
in one species, and obscured by changes in pigment cell numbers and behaviors
in other species (Parichy,
1996b
; Parichy,
1996a
). Pigment pattern groundplans also have been described for
butterflies (Nijhout, 1991
).
Our findings illustrate how mechanistic dissection of phenotypes can provide
novel insights into evolutionarily conserved and derived features, and how the
modularity of pigment patterns can generate diversity through alterations in
some but not other pattern elements.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/6/1081/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Aoki, H., Motohashi, T., Yoshimura, N., Yamazaki, H., Yamane,
T., Panthier, J. J. and Kunisada, T. (2005). Cooperative and
indispensable roles of endothelin 3 and KIT signalings in melanocyte
development. Dev. Dyn.
233,407
-417.[CrossRef][Medline]
Asai, R., Taguchi, E., Kume, Y., Saito, M. and Kondo, S.
(1999). Zebrafish leopard gene as a component of the putative
reaction-diffusion system. Mech. Dev.
89, 87-92.[CrossRef][Medline]
Bernex, F., De Sepulveda, P., Kress, C., Elbaz, C., Delouis, C.
and Panthier, J. J. (1996). Spatial and temporal patterns of
c-kit-expressing cells in WlacZ/+ and
WlacZ/WlacZ mouse embryos.
Development 122,3023
-3033.[Abstract]
Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer,
A., Gyssler, C. and Bachvarova, R. F. (1993). The kit-ligand
(steel factor) and its receptor ckit/W: pleiotropic roles in gametogenesis and
melanogenesis. Dev. Suppl.
1993,125
-137.
Braasch, I., Salzburger, W. and Meyer, A.
(2006). Asymmetric evolution in two fish-specifically duplicated
receptor tyrosine kinase paralogons involved in teleost coloration.
Mol. Biol. Evol. 23,1192
-1202.
Chapman, S. C., Lawson, A., Macarthur, W. C., Wiese, R. J.,
Loechel, R. H., Burgos-Trinidad, M., Wakefield, J. K., Ramabhadran, R., Mauch,
T. J. and Schoenwolf, G. C. (2005). Ubiquitous GFP expression
in transgenic chickens using a lentiviral vector.
Development 132,935
-940.
Goda, T., Abu-Daya, A., Carruthers, S., Clark, M. D., Stemple,
D. L. and Zimmerman, L. B. (2006). Genetic screens for
mutations affecting development of Xenopus tropicalis. PLoS
Genet. 2,e91
.[CrossRef][Medline]
Gompel, N., Prud'homme, B., Wittkopp, P. J., Kassner, V. A. and
Carroll, S. B. (2005). Chance caught on the wing:
cis-regulatory evolution and the origin of pigment patterns in Drosophila.
Nature 433,481
-487.[CrossRef][Medline]
Goodrich, H. B. and Nichols, R. (1931). The
development and the regeneration of the color pattern in Brachydanio
rerio. J. Morphol. 52,513
-523.
Grassot, J., Gouy, M., Perriere, G. and Mouchiroud, G.
(2006). Origin and molecular evolution of receptor tyrosine
kinases with immunoglobulin-like domains. Mol. Biol.
Evol. 23,1232
-1241.
Hoekstra, H. E., Hirschmann, R. J., Bundey, R. A., Insel, P. A.
and Crossland, J. P. (2006). A single amino acid mutation
contributes to adaptive beach mouse color pattern.
Science 313,101
-104.
Hou, L., Pavan, W. J., Shin, M. K. and Arnheiter, H.
(2004). Cell-autonomous and cell non-autonomous signaling through
endothelin receptor B during melanocyte development.
Development 131,3239
-3247.
Iwashita, M., Watanabe, M., Ishii, M., Chen, T., Johnson, S. L.,
Kurachi, Y., Okada, N. and Kondo, S. (2006). Pigment pattern
in jaguar/obelix zebrafish is caused by a Kir7.1 mutation: Implications for
the regulation of melanosome movement. Plos Genet.
2,1861
-1870.
Johnson, S. L., Africa, D., Walker, C. and Weston, J. A.
(1995). Genetic control of adult pigment stripe development in
zebrafish. Dev. Biol.
167, 27-33.[CrossRef][Medline]
Kelsh, R. N. (2004). Genetics and evolution of
pigment patterns in fish. Pigment Cell Res.
17,326
-336.[CrossRef][Medline]
Kelsh, R. N., Schmid, B. and Eisen, J. S.
(2000). Genetic analysis of melanophore development in zebrafish
embryos. Dev. Biol. 225,277
-293.[CrossRef][Medline]
Kelsh, R. N., Inoue, C., Momoi, A., Kondoh, H., Furutani-Seiki,
M., Ozato, K. and Wakamatsu, Y. (2004). The Tomita collection
of medaka pigmentation mutants as a resource for understanding neural crest
cell development. Mech. Dev.
121,841
-859.[CrossRef][Medline]
Langtimm-Sedlak, C. J., Schroeder, B., Saskowski, J. L.,
Carnahan, J. F. and Sieber-Blum, M. (1996). Multiple actions
of stem cell factor in neural crest differentiation in vitro. Dev.
Biol. 174,345
-359.[CrossRef][Medline]
Mackenzie, M. A., Jordan, S. A., Budd, P. S. and Jackson, I.
J. (1997). Activation of the receptor tyrosine kinase Kit is
required for the proliferation of melanoblasts in the mouse embryo.
Dev. Biol. 192,99
-107.[CrossRef][Medline]
Maderspacher, F. and Nusslein-Volhard, C.
(2003). Formation of the adult pigment pattern in zebrafish
requires leopard and obelix dependent cell interactions.
Development 130,3447
-3457.
McCauley, D. W., Hixon, E. and Jeffery, W. R.
(2004). Evolution of pigment cell regression in the cavefish
Astyanax: a late step in melanogenesis. Evol.
Dev. 6,209
-218.[CrossRef][Medline]
Mellgren, E. M. and Johnson, S. L. (2004). A
requirement for kit in embryonic zebrafish melanocyte differentiation is
revealed by melanoblast delay. Dev. Genes Evol.
214,493
-502.[Medline]
Mellgren, E. M. and Johnson, S. L. (2005).
kitb, a second zebrafish ortholog of mouse Kit. Dev. Genes
Evol. 215,1
-8.[CrossRef][Medline]
Nijhout, H. F. (1991). The
Development and Evolution of Butterfly Wing Patterns. Washington,
DC: Smithsonian Institution Press.
Nishimura, E. K., Yoshida, H., Kunisada, T. and Nishikawa, S.
I. (1999). Regulation of E- and P-cadherin expression
correlated with melanocyte migration and diversification. Dev.
Biol. 215,155
-166.[CrossRef][Medline]
Parichy, D. M. (1996a). Pigment patterns of
larval salamanders (Ambystomatidae, Salamandridae): the role of the lateral
line sensory system and the evolution of pattern-forming mechanisms.
Dev. Biol. 175,265
-282.[CrossRef][Medline]
Parichy, D. M. (1996b). When neural crest and
placodes collide: interactions between melanophores and the lateral lines that
generate stripes in the salamander Ambystoma tigrinum tigrinum
(Ambystomatidae). Dev. Biol.
175,283
-300.[CrossRef][Medline]
Parichy, D. M. (2005). Variation and
developmental biology: prospects for the future. In Variation: A
Hierarchical Examination of a Central Concept in Biology (ed. B.
Halgrimsson and B. K. Hall), pp. 475-498. New York:
Academic Press.
Parichy, D. M. (2006). Evolution of danio
pigment pattern development. Heredity
97,200
-210.[CrossRef][Medline]
Parichy, D. M. and Johnson, S. L. (2001).
Zebrafish hybrids suggest genetic mechanisms for pigment pattern
diversification in Danio. Dev. Genes Evol.
211,319
-328.[CrossRef][Medline]
Parichy, D. M. and Turner, J. M. (2003a).
Temporal and cellular requirements for Fms signaling during zebrafish adult
pigment pattern development. Development
130,817
-833.
Parichy, D. M. and Turner, J. M. (2003b).
Zebrafish puma mutant decouples pigment pattern and somatic
metamorphosis. Dev. Biol.
256,242
-257.[CrossRef][Medline]
Parichy, D. M., Rawls, J. F., Pratt, S. J., Whitfield, T. T. and
Johnson, S. L. (1999). Zebrafish sparse corresponds to an
orthologue of c-kit and is required for the morphogenesis of a subpopulation
of melanocytes, but is not essential for hematopoiesis or primordial germ cell
development. Development
126,3425
-3436.[Abstract]
Parichy, D. M., Mellgren, E. M., Rawls, J. F., Lopes, S. S.,
Kelsh, R. N. and Johnson, S. L. (2000a). Mutational analysis
of endothelin receptor b1 (rose) during neural crest and
pigment pattern development in the zebrafish Danio rerio. Dev.
Biol. 227,294
-306.[CrossRef][Medline]
Parichy, D. M., Ransom, D. G., Paw, B., Zon, L. I. and Johnson,
S. L. (2000b). An orthologue of the kit-related gene
fms is required for development of neural crest-derived xanthophores
and a subpopulation of adult melanocytes in the zebrafish, Danio rerio.Development 127,3031
-3044.[Abstract]
Parichy, D. M., Reedy, M. V. and Erickson, C. A.
(2006). Regulation of melanoblast migration and differentiation.
In The Pigmentary System: Physiology and
Pathophysiology. 2nd edn (ed. J. J. Nordland, R. E. Boissy, V. J.
Hearing, R. A. King, W. S. Oetting and J. P. Ortonne). New York: Oxford
University Press.
Quigley, I. K., Turner, J. M., Nuckels, R. J., Manuel, J. L.,
Budi, E. H., Macdonald, E. L. and Parichy, D. M. (2004).
Pigment pattern evolution by differential deployment of neural crest and
post-embryonic melanophore lineages in Danio fishes.
Development 131,6053
-6069.
Quigley, I. K., Manuel, J. L., Roberts, R. A., Nuckels, R. J.,
Herrington, E. R., Macdonald, E. L. and Parichy, D. M.
(2005). Evolutionary diversification of pigment pattern in
Danio fishes: differential fms dependence and stripe loss in
D. albolineatus. Development
132,89
-104.
Rawls, J. F. and Johnson, S. L. (2000).
Zebrafish kit mutation reveals primary and secondary regulation of
melanocyte development during fin stripe regeneration.
Development 127,3715
-3724.[Abstract]
Rawls, J. F. and Johnson, S. L. (2003).
Temporal and molecular separation of the kit receptor tyrosine kinase's roles
in zebrafish melanocyte migration and survival. Dev.
Biol. 262,152
-161.[CrossRef][Medline]
Rawls, J. F., Mellgren, E. M. and Johnson, S. L.
(2001). How the zebrafish gets its stripes. Dev.
Biol. 240,301
-314.[CrossRef][Medline]
Reid, K., Nishikawa, S. I., Bartlett, P. F. and Murphy, M.
(1995). Steel factor directs melanocyte development in
vitro through selective regulation of the number of of c-kit+
progenitors. Dev. Biol.
169,568
-579.[CrossRef][Medline]
Russell, E. S. (1949). Analysis of pleiotropism
at the W-locus in the mouse: relationship between the effects of
W and Wv substitution on hair pigmentation and
erythrocytes. Genetics
34,708
-723.
Santiago, A. and Erickson, C. A. (2002).
Ephrin-B ligands play a dual role in the control of neural crest cell
migration. Development
129,3621
-3632.
Shapiro, M. D., Marks, M. E., Peichel, C. L., Blackman, B. K.,
Nereng, K. S., Jonsson, B., Schluter, D. and Kingsley, D. M.
(2004). Genetic and developmental basis of evolutionary pelvic
reduction in threespine sticklebacks. Nature
428,717
-723.[CrossRef][Medline]
Sobkow, L., Epperlein, H. H., Herklotz, S., Straube, W. L. and
Tanaka, E. M. (2006). A germline GFP transgenic axolotl and
its use to track cell fate: dual origin of the fin mesenchyme during
development and the fate of blood cells during regeneration. Dev.
Biol. 290,386
-397.[CrossRef][Medline]
Solnica-Krezel, L., Schier, A. F. and Driever, W.
(1994). Efficient recovery of ENU-induced mutations from the
zebrafish germline. Genetics
136,1401
-1420.[Abstract]
Watanabe, M., Iwashita, M., Ishii, M., Kurachi, Y., Kawakami,
A., Kondo, S. and Okada, N. (2006). Spot pattern of
leopard Danio is caused by mutation in the zebrafish connexin41.8
gene. EMBO Rep. 7,893
-897.[CrossRef][Medline]
Wehrle-Haller, B. (2003). The role of
Kit-ligand in melanocyte development and epidermal homeostasis.
Pigment Cell Res. 16,287
-296.[CrossRef][Medline]
Wehrle-Haller, B. and Weston, J. A. (1995).
Soluble and cell-bound forms of steel factor activity play distinct roles in
melanocyte precursor dispersal and survival on the lateral neural crest
migration pathway. Development
121,731
-742.[Abstract]
Yamamoto, Y., Stock, D. W. and Jeffery, W. R.
(2004). Hedgehog signalling controls eye degeneration in blind
cavefish. Nature 431,844
-847.[CrossRef][Medline]
Yang, C. T. and Johnson, S. L. (2006). Small
molecule-induced ablation and subsequent regeneration of larval zebrafish
melanocytes. Development
133,3563
-3573.
Yang, C. T., Sengelmann, R. D. and Johnson, S. L.
(2004). Larval melanocyte regeneration following laser ablation
in zebrafish. J. Invest. Dermatol.
123,924
-929.[CrossRef][Medline]
Yoshida, H., Kunisada, T., Kusakabe, M., Nishikawa, S. and
Nishikawa, S. I. (1996). Distinct stages of melanocyte
differentiation revealed by analysis of nonuniform pigmentation patterns.
Development 122,1207
-1214.[Abstract]
This article has been cited by other articles:
![]() |
E. H. Budi, L. B. Patterson, and D. M. Parichy Embryonic requirements for ErbB signaling in neural crest development and adult pigment pattern formation Development, August 1, 2008; 135(15): 2603 - 2614. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Engeszer, G. Wang, M. J. Ryan, and D. M. Parichy Sex-specific perceptual spaces for a vertebrate basal social aggregative behavior PNAS, January 22, 2008; 105(3): 929 - 933. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||