|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online March 1, 2007
doi: 10.1242/10.1242/dev.002220
1 Department of Zoology, Graduate School of Science, Kyoto University, Sakyo-ku,
Kyoto 606-8502, Japan.
2 Department of Biology, Graduate School of Science, Osaka University, 1-1
Machikaneya-cho, Toyonaka, Osaka 560-0043, Japan.
3 Department of Marine Biotechnology, Faculty of Life Science and Biotechnology,
Fukuyama University, Fukuyama 729-0292, Japan.
4 UMR 7009, Centre National de la Recherche Scientifique/Université
Pierre et Marie Curie, Biologie du Développement, Observatoire
Océanologique de Villefranche-sur-Mer, quai de la Darse-06234
Villefranche-sur-Mer Cedex, France.
Authors for correspondence (e-mail:
jean-philippe.chambon{at}obs-vlfr.fr;
satoh{at}ascidian.zool.kyoto-u.ac.jp)
Accepted 11 January 2007
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Ascidian tadpoles, Apoptosis, Ci-sushi, Metamorphosis, MAPK
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Our
ability to study the full extent of processes such as apoptosis during
embryonic development has been advanced by the sequencing of the genomes of
model organism and by the subsequent development of DNA-chip technologies
coupled with gene-silencing-based approaches that can provide a mass of
testable information about the dynamics of gene regulatory networks.
Programmed cell death has been found to operate in all multicellular animals
studied so far, including cnidarians, nematodes, insects, ascidians,
amphibians, fish, birds and mammals (Cikala
et al., 1999; Ellis et al.,
1991; Steller,
1995; Chambon et al.,
2002; Vaux and Korsmeyer,
1999; Jacobson et al.,
1997). Metamorphosis represents a dramatic example of apoptosis
and occurs throughout the animal kingdom
(Vaux and Korsmeyer, 1999;
Jacobson et al., 1997). In
basal chordates such as ascidians, metamorphosis is characterized by a period
of intense cell reorganization and remodelling that is dependent on programmed
cell death events (Chambon et al.,
2002; Jeffery,
2002).
Although the execution of apoptosis occurs through the activation and
function of a highly conserved family of cysteine proteases, termed caspases,
present from hydra to man (Cikala et al.,
1999; Thornberry and Lazebnik,
1998), the initiation of apoptosis also depends on the activation
of extrinsic and/or intrinsic death pathways
(Ashkenazi and Dixit, 1998). In
addition, the apoptotic process is also regulated by many intracellular
signalling pathways, including the mitogen-activating-protein kinase (MAPK)
pathways (Deng et al., 2003;
Lin and Dibling, 2002;
Chen et al., 2005).
MAPK proteins play both pro-apoptotic and anti-apoptotic roles depending on
the cellular environment (Tibbles and
Woodgett, 1999; Davis,
2000; Chang and Karin,
2001). Conventional MAPK proteins consist of three family members
(Johnson and Lapadat, 2002):
the extracellular signal-regulated kinase (ERK)
(Seger and Krebs, 1995); the
c-Jun NH2-terminal kinase (JNK); and p38
(Waskiewicz and Cooper, 1995).
ERK1-2 was initially reported to be a prosurvival factor
(Wada and Penninger, 2004;
Johnson and Lapadat, 2002),
although a recent study suggests that it also has a key pro-apoptotic role in
neuronal apoptosis induced by potassium (K+) withdrawal
(Subramaniam et al., 2004).
JNK can exhibit either pro- or anti-apoptotic functions, depending on the cell
type, the nature of the death stimulus, the duration of JNK activation and the
activity of other signalling pathways (for a review, see
Liu and Lin, 2005). Similar to
JNK, the involvement of p38-MAPK in apoptosis is also diverse
(Sarkar et al., 2002).
MAPK plays a pro-apoptotic role during ascidian metamorphosis. The
activation of the Ciona intestinalis MAPK ERK (Ci-ERK) in tail cells
precedes the wave of apoptosis, suggesting that the phosphorylated form of
Ci-ERK transduces the death-activating signal in tail tissues during
metamorphosis (Chambon et al.,
2002). Moreover, inhibition of Ci-ERK blocks metamorphosis
(Chambon et al., 2002).
Finally, it was recently reported that programmed cell death in C.
intestinalis larvae also correlates with JNK activity
(Tarallo and Sordino, 2004).
However, it is not yet fully known what transcriptional events are targeted by
MAPK to induce apoptosis in vivo. The simplicity of the ascidian tadpole,
which consists of approximately 2600 cells, the rapid rate of development and
the predictable wave of apoptosis during tail regression make the ascidians an
amenable system in which to study apoptosis. In addition, the recent
development of comprehensive microarrays (75% representation of the genome),
coupled with extensive in situ gene expression profiles during embryogenesis
(Satou et al., 2002)
(http://ghost.zool.kyoto-u.ac.jp/indexr1.html),
make the ascidian a useful organism for identifying the gene-regulatory
network that controls the onset of metamorphosis and also for identifying the
subset of genes regulated by MAPKs that induce apoptosis. Here, using ascidian
metamorphosis as a model, we set out to identify the genes downstream of
either JNK- or ERK-activity that control the onset of apoptosis during
development. In addition, through a gene-silencing-based approach, we
demonstrate that one of the genes identified by our screen, Ci-sushi,
links JNK activation to the wave of apoptosis that precedes tail regression.
As well as identifying 110 genes regulated by either JNK or ERK, we describe
how the activation of JNK in the CNS controls apoptosis in adjacent tissues
(notochord, epithelia and muscle), and propose a model for the synchronous
apoptosis that occurs in these tissues.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Indirect immunofluorescence
Larvae were fixed for 20 minutes with 3.7% formaldehyde in filtered
seawater. Embryos were permeabilized with 0.2% Triton in phosphatebuffered
saline (PBS) and washed once in PBS. Phosphorylated ERK was visualized by
incubating larvae for 1 hour at room temperature with a monoclonal antibody
raised against the active form of MAPKs ERK1 and ERK2 (dual-phosphorylated
`HTGFLT(p)EY(p)VAT' peptide) (BD Transduction Laboratories). Embryos were then
washed three times in PBS 0.008% Triton and incubated for 1 hour at room
temperature with FITC-conjugated donkey-anti-mouse immunoglobulin as a
secondary antibody (Jackson ImmunoResearch Laboratories) diluted 1:500 in PBS.
Larvae were then washed three times in PBS, once in tris-buffered saline
(TBS), were rinsed in distilled water and were then mounted in Vectashield
containing DAPI (Vecta Laboratory). The slides were analyzed with a Zeiss
Microscope. Phosphorylated JNK and p38 were both detected with a MAP Kinase
Activation Monoclonal Antibody kit (BD Transduction Laboratories). Appropriate
secondary antibodies were TRITC-conjugated donkey-anti-mouse or
FITC-conjugated donkey-anti-mouse immunoglobulin (Jackson Laboratories).
Treatment with JNK and MEK inhibitors
The JNK inhibitor SP600125 (Sigma-Aldrich) was dissolved to DMSO and added
at a final concentration of 10 µM immediately after hatching. The MEK
inhibitor U0126 (Promega) was dissolved in DMSO and added either once (6
µM) immediately after hatching, or once at this time-point (6 µM)
followed by every 6 hours thereafter (6 µM at each administration). Embryos
were cultured at 18°C during 48 hours. Treated and control larvae were
scored for signs of metamorphosis. Results were the mean of three independent
experiments.
SDS-PAGE and western immunoblotting
For activated-ERK analysis, larvae were sonicated on ice in RIPA lysis
buffer [150 mM NaCl, 50 mM Tris-Cl (pH 7.6), 5 mM EDTA, 0.5% NP-40, 1 mM PMSF,
1 mM orthovanadate, 0.5% sodium deoxycholate, 0.1% SDS] supplemented with
Complete Protease Inhibitor Cocktail Tablets (Roche Molecular Biochemicals).
Lysates were then clarified by centrifugation. Samples were diluted in sample
buffer (Laemmli, 1970) and
incubated at 85°C for 5 minutes. Total proteins were separated on 12.5%
SDS gels and transferred onto PVDF membranes. The blots were blocked with 5%
milk powder in PBS-Tween, were incubated for 1 hour with a monoclonal
anti-dual-phosphorylated ERK (BD Transduction Laboratories) that was diluted
1:500 in PBS-Tween, were washed in TBS-Tween, were incubated for 1 hour with
the secondary antibody (HRP-conjugated anti-mouse IgG antibody diluted
1:10,000) and were then washed in PBS-Tween. Labelled proteins were detected
using the Supersignal West Pico Chemiluminescent Substrate (Pierce).
Additional analysis by western blotting with different antibodies was
performed using 12.5% SDS polyacrylamide gels containing 0.13% bisacrylamide.
The various primary antibodies used were MAP Kinase Activation Sampler kit and
MAP Kinase Sampler kit (BD Transduction Laboratories), and, as a secondary
antibody, we used horseradish peroxidase linked to rabbit antibodies directed
against mouse-immunoglobulin Fc fragments (Sigma, Saint Louis, MO).
Microarray design
A C. intestinalis microarray (oligonucleotide-based chip version
1) was made by Agilent Technologies (ink-jet-based Sure Print technology). A
total of 21,939 features on the chip consisted of 21,617 independent 60-mer
oligonucleotide probe sequences. These probes represent 22,445 cDNA/EST
sequences selected from over 450,000 C. intestinalis ESTs and 4062
cDNAs (Satou et al., 2002)
(http://ghost.zool.kyoto-u.ac.jp/indexr1.html),
with at least one sequence per gene. Information on the C.
intestinalis genome (Dehal et al.,
2002) indicates that 17,490 of these features represent 11,903
(75.1% of the total 15,852) C. intestinalis gene models, according to
computational analysis. Manual checking indicated that approximately 5% of the
remaining 3949 gene models are estimated to have representative features also.
The additional 4127 features not corresponding to any gene models represent
approximately 3500 independent cDNA clusters. As a result, the total features
on the array are estimated to cover approximately 75-80% of the genes in the
C. intestinalis genome.
RNA extraction, labelling and hybridization
Total RNA of tadpole-type larvae was extracted 7 hours after hatching (25
hpf) using TRIZOL reagent and was then treated with DNase (Promega). Labelling
of amplified cRNA with either cyanine-3 CTP or cyanine-5 CTP (Perkin-Elmer/NEN
Life Sciences) was performed using 250-ng aliquots of total RNA with a Low RNA
Input Fluorescent Linear Amplification kit (Agilent Technologies), following
the manufacturer's instruction. The quality and size distribution of targets
was determined by the RNA 6000 Nano Lab-on-chip Assay (Agilent Technologies),
and quantification was performed using a NanoDrop microscale spectrophotometer
(NanoDrop). A set of cRNA targets from each sample was assembled into a
hybridization reaction using an In Situ Hybridization kit (Agilent Tech.).
Each hybridization was compared with that of the 0-hour larvae sample (18
hpf). Hybridization was performed twice with a dye swap. Hybridized
microarrays were washed according to the manufacturer's protocol and then
scanned using a G2565BA Micro-Array Scanner System with SureScan technology
(Agilent Technologies).
Data analysis
The intensity of 21,939 gene features per array was extracted from scanned
microarray images using Feature Extraction 7.1 software (Agilent
Technologies), which performs background subtractions and dye normalization.
The data were analyzed using Excel (Microsoft). Hierarchical clustering was
performed using Cluster and Treeview
(Eisen et al., 1998).
The gene features were searched against the C. intestinalis draft
genome sequence (Dehal et al.,
2002) to obtain information about corresponding genes. The
features that had several hits in the draft genome sequences were excluded
from the present analyses and the remaining 18,222 gene features were picked
up to be included in the analyses. Gene features that coincided with a
predicted gene model or cDNA sequences from the cDNA/EST database
(Satou et al., 2002) and the
deduced protein sequences were used to characterize corresponding genes with
the Genome browser of JGI
(http://genome.jgi-psf.org/ciona4/ciona4.home.html).
The cDNA and EST sequences were used in combination with the JGI gene model to
obtain more-complete gene models. The GENES Human ENTRY number concerning JGI
gene models was used for analysis on the Kyoto Encyclopedia of Genes and
Genomes (KEGG;
http://www.genome.ad.jp/kegg)
GENES Human database and KEGG PATHWAY database
(Kanehisa and Goto, 2000;
Kanehisa, 2002).
mRNA isolation and reverse transcriptase-PCR
For mRNA isolation, larvae were lyzed in TRIzol (Invitrogen), according to
the supplier's instructions. mRNA was reverse transcribed. For each gene, a
set of specific forward (For) and Reverse (Rev) oligonucleotides was designed
to amplify a small part of coding region (from 200-600 bp):
C-JUN: (For: CCGTCTTGAAGGGTATGAGC, Rev: GTTCCAGTTTCCGCTTTCTG);
SRF: (For: CCACGACGATGAACATTACG, Rev: GTCGGCGTTTTATGTTCGTT);
MKP: (For: CCACTTTCCAGACCGATTTC, Rev: CCTCACAGGTCCACTCCATT);
Ci-GNRH: (For: TGTGTGTTACTTGTCGTTCTAGCC, Rev: GGATCCGTTGCAAGAGTTGT);
Ci-sushi: (For: TTGCAAGTCTTTGCACAGTTG, Rev: CCAACGGCTGTGATATGTGA);
Ci-ETS: (For: CAAAGCACACCAAGCCAGTA, Rev: GTTGGGGTAGCATGGTTCAT);
Ci-LyOx: (For: TGGGTGGGACTTGAACAC, Rev: TTCCCTCTTGCGTACTTTGG);
Ci-Vwa1a: (For: TGGTTGCAAACAAGAAGCTG, Rev: ATCCTCATTTGCATCGAACC);
Ci-Vwa1b: (For: GCACTGTCGGTTCAGTGTGT, Rev: CCGAAACTAGGTTGCGTTGT);
Ci-Vwa1c: (For: ATACTTCGACCCAGCACGTC, Rev: AAACTCCGTTACGCCTCAGA);
Ci-OATP: (For: CGGTTGGGTTGATCTTGAGT, Rev: GACGATCCCAACTTTTTCCA);
Ci-dhg: (For: GTCACCGTTTCCTCTGAAGC, Rev: GCGCCGTGTATTATGGTCTT);
Ci-Mx: (For: ACCCAGACATTGCAGGAAC, Rev: GAGCCGCTACAATTCTCAGG).
Reverse transcriptase (RT)-PCR was performed on equal amounts of input RNA and cDNA using the amplimers describe above. S26 mRNA was used as a control using the amplimer For: TCCCCTTCTTCCTCAAGCAC and Rev: GCCCAACCACCATCCTGTA. For the control S26, PCR was first performed on cDNA from untreated larvae or from 18 hpf larvae, and the number of cycles adjusted so as to produce a non-saturating signal on ethidium bromide-stained 1.2% agarose slab gels. Semi-quantitative PCR was next performed on cDNA from each time-point or from untreated and treated larvae using the number of cycles determined above. PCR products were run on 1.2% agarose slab gels.
Microinjection of morpholino oligo
Chorionated C. intestinalis oocytes were vigorously pipetted to
remove the outer follicular cells. These partially dechorionated oocytes were
then fertilized and transferred to cleaned Petri dishes (cleaned with ethanol
and rinsed in distilled water) and allowed to settle by gravity. As the
oocytes settled, a substantial proportion fixed to the plastic Petri dishes.
Those zygotes that became fixed were injected (injection-pipette holder
mounted at 
30°), with the injection needle controlled by a hydraulic
micromanipulator (Narishige) coupled to a high-pressure injection device
(Narishige IM300). Ci-sushi morpholino antisense DNA (Gene Tools) at
a pipette concentration of 1 mM was mixed 10:1 with 20 mM Texas Red-Dextran 10
kDa (Molecular Probes) and injected into the zygotes (1% injection
volume) after extrusion of the second polar body and before the first
cleavage. The following day (at 18 hpf), those tadpoles that were fluorescent
were isolated and further analyzed through metamorphosis and TUNEL labelling.
As a control, we used standard control morpholino (Gene Tools). Results were
the mean of three independent experiments.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed by using digoxigenin
(DIG)-labelled antisense probes as described previously
(Satou, 1999). RNA probes were
prepared using a DIG RNA-labelling kit (Roche). Control embryos hybridized
with a sense probe did not show any signal above background levels.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). After settlement, C. intestinalis metamorphose
into sessile filter feeders, a process involving a massive reorganization of
the body plan and, most notably, apoptosis-dependent tail regression
(Chambon et al., 2002). The
potential role of the CNS in initiating metamorphosis by selecting sites for
settlement was previously proposed
(Cloney, 1978;
Cloney, 1982).
We chose to focus on MAPK signalling cascades for two reasons. First, we
and others have shown that the inhibition of ERK prevents tail regression and
apoptosis during ascidian metamorphosis
(Chambon et al., 2002;
Tarallo and Sordino, 2004).
Second, it has previously been reported that MAPK pathways are well conserved
in the C. intestinalis genome
(Satou et al., 2003;
Hotta et al., 2003) (see Table
S1 in the supplementary material) and that some components of these pathways
are strongly and/or exclusively expressed in the CNS of C.
intestinalis during the tadpole stage
(Imai et al., 2004) (see also
http://ghost.zool.kyoto-u.ac.jp/ST2005.html).
We examined whether activation of the three main MAPK pathways occurs during
the swimming phase of C. intestinalis larvae. Given the perfect match
between the Ciona and human peptide sequences in each of the two
proteins (see Fig. S1 in the supplementary material), we used antibodies
directed against the human dual-phosphorylated peptides to detect activated
and non-phosphorylated Ci-ERK, Ci-JNK and Ci-p38 from C. intestinalis
protein extracts and/or by indirect immunofluorescence
(Fig. 1A-C and D). C.
intestinalis larvae from hatching (18 hours post-fertilization; hpf) to
the onset of metamorphosis (28 hpf) were analyzed by western blotting. The
level of total protein extract of each sample was visualized by Coomassie Blue
staining (Fig. 1A, upper
panel). An activated form of Ci-JNK was present during the swimming phase of
the larvae at 20 and 22 hpf. Ci-ERK was activated between 20 and 24 hpf, with
peaks at 20 and 22 hpf, and was then activated again at 28 hpf, as we
previously described (Chambon et al.,
2002). No activation of Ci-p38 was detected at any time during the
swimming period. We confirmed that Ci-ERK, Ci-JNK and Ci-p38 protein levels
did not vary significantly during this period
(Fig. 1A, lower panels).
In order to determine where in the larvae JNK and ERK activation occurred, we used the same antibodies for indirect immunofluorescence studies on larvae fixed at various times. In agreement with protein expression analysis and our activation study (Fig. 2C), Ci-JNK and Ci-ERK were found to be activated at 20 and 22 hpf. No Ci-p38 was detected in any region of the swimming larvae (see Fig. S2 in the supplementary material).
Ci-JNK was phosphorylated in the CNS of larvae (1B,ctivated Ci-JNK was detected in the CNS localized in the trunk of the larvae: specifically, in the posterior part of the sensory vesicle that contains the pigmented ocellus and otolith, the visceral ganglion composed of motoneurons and between these the neck region. The caudal nerve cord also contained activated Ci-JNK.
|
).
Activated Ci-ERK was detected in all the papillae, from the anterior part to
the extremity of each of the three palps. Some nuclei of the anterior
epidermis of the trunk were also positively stained for phosphorylated Ci-ERK.
As we previously described, Ci-ERK was also later activated in tail cells at
28 hpf (Chambon et al.,
2002).
ERK- and JNK-inhibitor treatment blocks initiation of apoptosis and metamorphosis
We next compared the status of apoptosis in larvae that had initiated
metamorphosis and that had been treated with MAPK inhibitors. The hatching
larvae were treated with a MAPK inhibitor and, after 10 hours (at 28 hpf),
were fixed and processed for TUNEL labelling
(Fig. 2A). Major differences
were observed between larvae treated with the MEK inhibitor (U0126) or JNK
inhibitor (SP600125) to those larvae untreated or treated with the p38
inhibitor (SB203580). Consistent with our previous work
(Chambon et al., 2002), the
untreated larvae that began metamorphosis exhibited TUNEL-positive cells at
the tip of the tail (Fig. 2A).
No difference was observed when larvae were treated with the p38 inhibitor. By
contrast, the inhibition of JNK (SP600125) and ERK (U0126) phosphorylation
inhibited initiation of apoptosis at the tip of the tail
(Fig. 2A).
Hatched larvae were incubated at 18°C in filtered seawater with DMSO
(0.1%), U0126 (6 µM) or SP600125 (10 µM). Inhibition of the JNK cascade
with SP600125 completely blocked metamorphosis
(Fig. 2D) at 2 days
post-fertilization. Similarly, but to a lesser extent, inhibition of MEK with
U0126 blocked metamorphosis in a significant proportion of the tadpoles
(Fig. 2D)
(Chambon et al., 2002). Given
that U0126 has a short half-life, U0126 treatment was repeated every 6 hours.
In this condition, inhibition of MEK significantly decreased the number of
larvae that reached the metamorphosis stage and increased the number of
swimming larvae (Fig. 2D). As
depicted in Fig. 2D, at 2 days
after fertilization, inhibition of the JNK pathway with 10 µM SP600125
induced 100% blockade of metamorphosis, and inhibition of the ERK pathway
with 6 µM U0126 led to a significant decrease (94%) in the number of
metamorphosed larvae. In the control (DMSO treated) group, 95% of larvae
underwent metamorphosis.
Although Ci-ERK and Ci-JNK activation was observed in DMSO-treated larvae, the activated Ci-ERK and Ci-JNK labelling was lost at 24 hpf with SP600125 and U0126 treatment, respectively (Fig. 2B). Moreover, incubation with SP600125 or U0126 significantly decreased Ci-JNK or Ci-ERK phosphorylation when compared with the control by western blot analysis (Fig. 2C).
|
) to
identify genes that are differentially transcribed during the swimming phase.
An overview of the results for each MAPK pathway is displayed in
Fig. 3A. Although very few
modulations in gene expression were observed immediately after hatching, the
situation changed between 26 and 28 hpf, which corresponded approximately to
the start of tail absorption (Fig.
3A). Interestingly, the two transcription factors SRF
(serum response factor) and c-jun, which are known to be targeted by
ERK and JNK, respectively, were upregulated at 26 and 28 hpf
(Fig. 3B). The expression of
SRF was maximum at these times before declining to its initial level,
whereas c-jun expression was highly up-regulated from 26 to 50 hpf
(Fig. 3B, upper and middle
panel). We confirmed the microarray expression profile of SRF and
c-jun by semi-quantitative reverse transcriptase (RT)-PCR
(Fig. 3C). SRF is a
target of the ERK signalling pathway and provides a positive-feedback loop
(Kasza et al., 2005). A
similar positive feedback exists for JNK, as demonstrated in hypoxic HepG2
cells, through regulation of the c-jun promoter
(Minet et al., 2001).
Moreover, the MKP (MAP kinase phosphatase) gene, a key
protein of MAPK pathways, was upregulated from 26 to 30 hpf
(Fig. 3B, lower panel;
Fig. 3C). MKP is a member of
the dual specific phosphatase (DSP) protein family, members of which
inactivate MAPKs through dephosphorylation. The increase in MKP gene
expression could provide a negative-feedback loop on activated MAPK pathways
in C. intestinalis larvae; as has been described for the ERK pathway
in Drosophila and Xenopus
(Gomez et al., 2005).
|
; Ishibashi et
al., 2005) to determine the transcriptional differences between
larvae treated with MAPK inhibitors or with DMSO (control). We chose tadpole
larvae that were at 25 hpf for two reasons. First, because both ERK and JNK
displayed a peak of activity starting at 20 hpf
(Fig. 1); and second, because
the major change in gene expression began between 24 and 26 hpf
(Fig. 3). Among the many genes
where the expression pattern is altered at 25 hpf, we anticipated identifying
the subset that is involved in the initiation of the wave of apoptosis,
because this is blocked by both inhibitors.
To identify genes regulated by these two MAPK pathways, we determined the
expression profile of DMSO-treated larvae aged 25 hpf with identically aged
larvae that had been treated with either SP600125 or U0126. Only genes that
consistently displayed greater than threefold changes during SP600125
treatment or greater than twofold changes in transcript abundance during U0126
treatment were scored. This conservative approach, which has been used in a
variety of microarray studies (e.g. Butler
et al., 2003; Munoz-Sanjuan et
al., 2002), is likely to miss a number of genes that are
differentially expressed in response to MAPK-inhibitor treatment. The genes
affected by the MAPK-inhibitor-treatment protocol were categorized into four
major classes based on Lee et al. (Lee et
al., 1999) (Tables
1,
2). Class A coded for proteins
common to many cell types, class B were proteins associated with cell-cell
communication, class C coded for proteins that function as transcription
factors and other regulatory proteins, and class D were proteins of an unknown
function (DI) or with no similarity (DII).
|
|
|
; Nakayama et al.,
2002; Davidson and Swalla,
2002; Woods et al.,
2004). For example, Ci-meta5, a gene previously shown to
be involved in metamorphosis (Nakayama et
al., 2001; Nakayama et al.,
2002), was identified by our screen. A total of 12 genes were upregulated and 41 genes were downregulated by U0126 MEK-inhibitor treatment (Table 2). In addition to genes previously shown to be involved in ascidian metamorphosis, treatment with MAPK inhibitors identified other genes not previously implicated in this process. We will come back to some of these genes later in the discussion.
In order to confirm the microarray data, we performed RT-PCR of the genes identified by cDNA chips between larvae treated with MAPK inhibitors or with DMSO (control), including three Vwa1 genes (Ci-Vwa1a, Ci-Vwa1b and Ci-Vwa1c), dehydrogenase (Ci-Dhg), matrix metalloprotease (Ci-Mx), gonadotropin releasing hormone (GNRH; Ci-GNRH), lysil oxidase (Ci-LyOx), ets (Ci-ets) and organic anion transporting polypeptide 14 (oatp14; Ci-oatp) (Fig. 4A,B).
Due to the substantial EST programme coupled with extensive in situ data
(Satou et al., 2002)
(http://ghost.zool.kyoto-u.ac.jp/indexr1.html),
many of the genes identified by our screen had already been described. For
example, genes under the control of Ci-ERK, such as rev-erb, are
expressed exclusively in the palps
(Kusakabe et al., 2002) (see
also
http://ghost.zool.kyoto-u.ac.jp/cgibin3/photoget2.cgi?CLSTR03308).
Selectin, which is also controlled by Ci-ERK, was observed in the
palps of competent and attached larvae during metamorphosis of the ascidian
Boltenia villosa (Davidson and
Swalla, 2002). Among genes that we identified to be controlled by
Ci-JNK, Vwa1 had already been detected in the tadpole brain
(Satou et al., 2001) (see also
http://ghost.zool.kyoto-u.ac.jp/cgi-bin3/photoget2.cgi?CLSTR01650),
and Emc in the nervous system and the nerve corde
(Imai et al., 2004) (see also
http://ghost.zool.kyoto-u.ac.jp/cgi-bin3/photoget2.cgi?cicl010f24).
We also conducted a series of whole-mount in situ hybridizations for several
of the genes identified by our screen, including Ci-GNRH, Ci-endoglucanase
(Ci-endogl), NTKL (Ci-NTKL), Ci-ets, Ci-Vwa1a, Ci-Vwa1ac,
Ci-metalloprotease (Ci-Mx) and Ci-oatp (Tables
1,
2). An overview of the results
for each MAPK pathway is displayed in Fig.
4.
Silencing of the JNK-controlled gene sushi inhibits apoptosis in tail cells
We previously demonstrated that JNK activation is required for apoptosis
induction in tail cells and for tail regression during metamorphosis. In order
to identify candidate genes involved in the initiation of the wave of
apoptosis, we next identified, by cDNA microarray analysis, genes that are
controlled by the JNK pathway. To address this issue, we examined the effect
of the functional suppression of JNK-controlled genes on apoptosis induction
at the onset of metamorphosis. Among the many genes identified,
Ci-Sccpb and Ci-sushi
(Table 1) showed, respectively,
expression at the tip of the tail and in tail epithelia
(Fig. 5A). Out of these two
genes, we choose Ci-sushi (Table
1) for gene silencing for two reasons. First, based on its EST
count (Satou et al., 2002) and
RT-PCR (5Ci-sushi is
expressed between 24 and 26 hpf only, just before the initiation of apoptosis
and the onset of metamorphosis; therefore, the Ci-sushi knockdown
avoids possible lethal phenotypes due to Ci-sushi having a role in
earlier steps of Ciona development. Second, we confirmed the
microarray data by RT-PCR and found that Ci-sushi expression is
downregulated by Ci-JNK inhibitor (Fig.
5B and Table 1). By
contrast, Ci-Sccpb expression is upregulated by SP600125
(Table 1). These data thus
suggested that Ci-sushi would be an ideal candidate for a functional
suppression experiment.
When a morpholino against Ci-sushi was injected into chorionated
fertilized eggs, all larvae examined (18/18) were unable to initiate apoptosis
in tail cells at the onset of metamorphosis
(Fig. 5C). At this stage, most
(22/25) of the control larva exhibited TUNEL-positive cells at the tip of the
tail, and began tail regression (Fig.
5C). Moreover, as a control for synchronization and methodology,
the tunic cells in both morpholino-injected and control larvae were apoptotic
at this time (Chambon et al.,
2002) (Fig. 5C).
These data demonstrate that Ci-sushi is necessary to induce apoptosis
in cells that compose the tail of C. intestinalis larvae at the onset
of metamorphosis.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Moreno et al., 2002) and
Caenorhabditis elegans (Gumienny
et al., 1999), and, in the mouse, double knockout of the two MAPK
family members JNK1 (also known as MAPK8 - Mouse Genome Informatics) and JNK2
(also known as MAPK9 - Mouse Genome Informatics) leads to embryonic lethality
associated with severe dysregulation in the control of cell death in the
hindbrain and forebrain (Kuan et al.,
1999; Sabapathy et al.,
1999). There are also indications that the MAPK signalling cascade
mediated via the ERK family plays a role in the onset of apoptosis during
embryogenesis (Kling et al.,
2002; Yao et al.,
2003). Although the role of JNK (and to a lesser extent ERK) is
well established in many experimental systems, it is less clear what the gene
targets of JNK (or ERK) are that trigger the onset of apoptosis. We addressed
this issue by initially measuring the dynamics of the gene-expression network
during the onset of metamorphosis in Ciona. By exploiting the
observation that inhibition of the MAPK signalling cascade specifically blocks
the onset of apoptosis (Chambon et al.,
2002) (this study), we used these pharmacological tools together
with a microarray-based approach to identify the subset of genes, controlled
by either Ci-ERK or Ci-JNK, that are involved in triggering the onset of
apoptosis. This strategy revealed 50 potential target genes that were
upregulated and 63 that were downregulated when the MAPK signalling cascades,
and therefore apoptosis, were inhibited.
Apoptosis in the ascidian tadpole larvae
At the end of the period of swimming, ascidian tadpole larvae undergo
metamorphosis, which usually begins with settlement through adhesive papillae
and subsequent tail regression and loss of adhesive papillae
(Cloney, 1978;
Cloney, 1982). A larva capable
of undergoing these metamorphic changes successfully is termed competent, and
the acquisition of metamorphic competence during the larval period has been
shown to occur in response to a wide variety of external and endogenous
signals (Jackson and Strathmann,
1981; Cloney,
1982; Davidson and Swalla,
2002; Jackson et al.,
2002). The Ci-JNK cascade is activated at the time of competence
in the tadpole CNS; more specifically, in the pharyngeal rudiment, anterior
sensory vesicle, neck, internal neurons of the posterior sensory vesicle,
visceral ganglion and nerve corde (Tarallo
and Sordino, 2004; Chambon et
al., 2002) (this study). More importantly, inhibition of the JNK
pathway completely blocked metamorphosis. Similarly, Ci-ERK activation
correlates with the time of metamorphic competence. Ci-ERK is activated in:
tail muscle, the cytoplasm of proximal palp cells, the stomodeum, the anterior
and posterior sensory vesicle, the epidermis overlying the sensory vesicle,
the neck region, atrial primordia, the notochord and in the epidermis of the
tail (Tarallo and Sordino,
2004; Chambon et al.,
2002) (this study). Similarly, blocking activation of Ci-ERK
inhibited metamorphosis in a significant percentage of the tadpole larvae
(Chambon et al., 2002) (this
study).
|
;
Davidson and Swalla, 2002;
Nakayama et al., 2002), such
as Ci-meta5, which is downregulated in response to JNK-inhibitor
treatment. Ci-meta5 was previously identified by differential
screening of a cDNA library of swimming larvae and metamorphosing juveniles
(Nakayama et al., 2002). We
also identified three genes (glutathione S-transferase, Cytochrome
p450 and Gluthathione-requiring prostaglandin D synthase) that
are under the control of Ci-ERK and are orthologues of or closely related to
genes expressed in papillae of the ascidians
Herdmania curvata that have been implicated in metamorphosis and
are downstream genes of the EGF-like Hemps pathway
(Woods et al., 2004;
Arnold et al., 1997). Although
it is not known whether Hemps activates ERK, it is tempting to speculate that
it does, because activation of the Ras/Raf/ERK pathway by EGF is well
described in many species (Hornstein et
al., 2003). Moreover, our identification of genes controlled by
Ci-ERK in papillae, the observation that metamorphosis does not occur with MEK
inhibition and data on Hemps in H. curvata that shows that it induces
settlement and metamorphosis (Eri et al.,
1999) are consistent with our observations that one of the effects
of the Hemps pathway is to activate the ERK cascade in papillae cells.
Innate immunity
In our screen, 20 genes known to be involved in innate immunity were
identified. It has been suggested that the activation of innate immunity genes
during metamorphosis may represent the maturation of the adult immune system,
and may be necessary for phagocytosis and for the re-structuring of larval
tissues (Davidson and Swalla,
2002). Among the genes controlled by activation of Ci-ERK in
papillae, Ci-Vwa1c and Ci-polydom could coordinate papillae
resorption during metamorphosis. In the same way, Ci-Pgly, Ci-ficolin
and the five genes similar to Vwa1 (Ci-Vwa1a, Ci-Vwa1b, Ci-Vwa1d,
Ci-Vwa1e and Ci-Vwa1f) that are controlled by phosphorylation of
Ci-JNK in the CNS, could lead to phagocytosis of the visceral ganglion and
sensory organs, which has been observed during metamorphosis of many ascidian
species (Cloney, 1978). It is
also of interest that the modulation of expression of genes such as
Ci-Sccp could also enhance cell-cell communication before the
extended period of cell reorganization and the co-ordinated massive wave of
apoptosis that occurs during tail regression.
Hormone signalling
Among the genes identified that are controlled by the JNK pathway, two are
interesting: Ci-GNRH and Ci-oatp, which are involved,
respectively, in the reproductive and thyroid axes. The mouse Oatp14
(also known as Slco1c1) was described in the transport of thyroxine
across the blood-brain barrier (Tohyama et
al., 2004). It is interesting to notice that the role of thyroid
hormones in metamorphosis had been reported previously in ascidians
(Patricolo et al., 1981;
Patricolo et al., 2001), and
also in amphibians (Dodd and Dodd,
1976; Nakajima et al.,
2005) and lamprey (Youson and
Sower, 2001). Moreover, in four ascidian species, thyroxin is
present in larval mesenchyme and seems to be involved in the control of
metamorphosis (D'Agati and Cammarata,
2005). The expression of Ci-oatp via JNK activation in
the CNS may enhance thyroid signalling in larvae. Concerning GNRH, no report
describes any function of this hormone in invertebrate metamorphosis. However,
it is possible that GNRH may have a role in lamprey metamorphosis because, in
sea lamprey, the level of GNRH increases throughout the stage of spontaneous
metamorphosis (Youson and Sower,
2001; Youson et al.,
2006).
Cell-cell communication
In addition to identifying genes involved in the immune system and hormonal
signalling, we also identified a number of genes coding for proteins involved
in the composition or processing of the ECM. For example, we identified
Ci-LyOx (Table 1,
Fig. 4B), which is responsible
for the cross linking and deposition of collagen fibres, elastin fibres and
Ci-Mx, a matrix metalloprotease
(Table 2,
Fig. 4A). The regulation of
matrix metalloprotease and the ECM remodelling have been shown to affect
apoptosis in different systems, including the apoptotic remodelling of the
intestine during Xenopus laevis metamorphosis and post-lactation
involution of the mouse mammary gland
(Nakajima et al., 2005;
Fata et al., 2004). Anoikis is
apoptosis induced by the loss of, or inappropriate, cell adhesion. It is
tempting to hypothesize that one of the inductive signals from Ci-JNK in the
CNS controls apoptosis by changing ECM composition. The role of JNK in ECM
degradation has already been reported in rat aortic walls
(Yoshimura et al., 2005). In
the tail of the tadpole, nerve corde is surrounded by matrix, which leads us
to speculate that remodelling the ECM could provide a means to coordinate the
response of tail cells in promoting either cell death or survival. In support
of such a scenario, it was reported that, after a modification in ECM
components, activation of the MAPK ERK leads to anoikis-type death
(Zugasti et al., 2001).
Because Ci-ERK activation precedes apoptosis in tail cells
(Chambon et al., 2002), this
cell death could be regulated by JNK-controlled anoikis in the tail of
ascidian tadpoles.
Diverse genes
In addition, we also observed that 45.5% of the identified genes controlled
by the ERK pathway had no significant identity or similarity with any sequence
in the GenBank Database, or matched with hypothetical proteins from different
organisms. This observation might be explained by the highly specialized
adhesive organs (papillae) in which these genes are expressed. For example,
there are eight types of adhesive papillae among ascidians species, which
could explain these species-specific components
(Cloney, 1978).
JNK activation and Ci-sushi expression are both required for apoptosis induction
We identified Ci-sushi as a target gene of the JNK pathway through
the microarray-based approach. Ci-Sushi expression decreased
following inhibition of the JNK pathway (SP600125 treatment). Moreover, under
physiological conditions, Ci-sushi was only expressed in tail
epithelia at 26 hpf, just before the onset of metamorphosis and of apoptosis
at the tail extremity. Ci-Sushi encodes a protein containing domains
known as complement control protein (CCP) modules, or short consensus repeats
(SCR), which exist in a wide variety of complement and adhesion proteins. The
abolition of apoptosis initiation by silencing of Ci-sushi with an
antisense morpholino oligonucleotide demonstrates that JNK-induced activation
of Ci-sushi expression in the tail is required to trigger the onset
of apoptosis in tail tissues. This result strengthens the hypothesis that
cross-talk exists between the different tail tissues and the CNS before the
onset of metamorphosis.
Ascidians as a model for apoptosis
Here, we observed that activation of ERK in the papillae and JNK in the CNS
are able to control, either directly or indirectly, apoptosis of different
tissues composing the tail. Because the papillae are innervated in C.
intestinalis (Manni et al.,
2004), it is possible that the coordination of settlement with
tail regression is controlled by the CNS. The potential role of the CNS in
metamorphosis was previously raised in a review and analysis of ascidian
metamorphosis in 1978 by R. A. Cloney. He proposed a preponderant role for the
larval nervous system and sensory organs in selecting sites for settlement and
in the onset of metamorphosis (Cloney,
1978; Cloney,
1982). Moreover, he hypothesized that the nervous system, and
conduction and diffusion of one or more humoral factors are likely to be
involved in metamorphosis (Satoh,
1994). Taken together with our previous results on
apoptosis-dependent tail regression
(Chambon et al., 2002), and
with the activation of JNK in the CNS that we report here, these results raise
two interesting questions: (1) How can JNK signalling in the CNS control
apoptosis of the different tissues composing the tail during its regression?
and (2) What is the nature of the JNK inductive signal that leads to
apoptosis?
We propose a model (Fig. 5D)
whereby the CNS enhances cell-cell communication in adjacent tissues through
the expression of genes, such as Ci-sushi or Ci-Sccpb, that
are essential for apoptosis-dependent tail regression. In addition, the CNS
may also modify ECM composition trough Ci-JNK activation, thus leading to the
induction of apoptosis in adjacent tissues that are receptive (the CNS and the
endoderm escape apoptosis) (Chambon et al.,
2002). The model we propose places the CNS centrally in the
coordination of the wave of apoptosis that precedes tail regression during
Ciona metamorphosis
Investigation of these questions in C. intestinalis is
particularly interesting because this organism contains the genetic rudiments
of many vertebrate characteristics and the larvae represent the basic chordate
body plan (Satoh, 1994;
Satoh, 2003). It is
interesting to notice that, during development in humans, cell death has been
shown to be an important morphogenetic mechanism for the formation of the
vertebral column. For example, some of the notochord exhibits cell death while
the remaining cells contribute to the formation of the nucleus pulposus in the
human inter-vertebral disc (Saraga-Babic
et al., 1994). An excess of cell death in these structures leads
to neural tube defects or tailless mutants in mouse
(Alles and Sulik, 1990;
Grüneberg, 1963).
Ciona may therefore provide a pertinent model to study in vivo
regulation of apoptosis in these different tissues.
By contrast, apoptosis in mammalian skeletal muscle is a rather rare event.
It has been reported as a mechanism for removal of undesired myotubes
(mononucleated cells) during development
(Sandri and Carraro, 1999).
Additionally, apoptotic death of single nuclei in otherwise normal muscle
fibre has been shown with an incidence of 0.1%
(Sandri et al., 1998) to 0.3%
(Migheli et al., 1997)
TUNEL-positive nuclei. Muscle satellite cells are believed to form a stable,
self-renewing pool of stem cells in adult muscle, where they function in
tissue growth and repair. A regulatory disruption of growth, differentiation
and apoptosis of these cells is assumed to result in tumour formation
(Koleva et al., 2005).
The future use of microarray technology coupled with a gene-silencing strategy should permit a better understanding of apoptosis regulation in the tail of Ciona larvae during metamorphosis and could create avenues of investigation that lead towards a better understanding of cell death regulation during development in mammals.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/6/1203/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Alles, A. J. and Sulik, K. K. (1990). Retinoic
acid-induced spina bifida, evidence for a pathological mechanism.
Development 108,73
-81.[Abstract]
Arnold, J. M., Eri, R., Degnan, B. M. and Lavin, M. F.
(1997). Novel gene containing multiple epidermal growth
factor-like motifs transiently expressed in the papillae of the ascidian
tadpole larvae. Dev. Dyn.
210,264
-273.[CrossRef][Medline]
Ashkenazi, A. and Dixit, V. M. (1998). Death
receptors: signaling and modulation. Science
281,1305
-1308.
Azumi, K., Takahashi, H., Miki, Y., Fujie, M., Usami, T.,
Ishikawa, H., Kitayama, A., Satou, Y., Ueno, N. and Satoh, N.
(2003). Construction of a cDNA microarray derived from the
ascidian Ciona intestinalis. Zool. Sci.
20,1223
-1229.[CrossRef][Medline]
Butler, M. J., Jacobsen, T. L., Cain, D. M., Jarman, M. G.,
Hubank, M., Whittle, J. R., Phillips, R. and Simcox, A.
(2003). Discovery of genes with highly restricted expression
patterns in the Drosophila wing disc using DNA oligonucleotide microarrays.
Development 130,659
-670.
Chambon, J. P., Soule, J., Pomies, P., Fort, P., Sahuquet, A.,
Alexandre, D., Mangeat, P. H. and Baghdiguian, S. (2002).
Tail regression in Ciona intestinalis (Prochordate) involves a
Caspase-dependent apoptosis event associated with ERK activation.
Development 129,3105
-3114.
Chang, L. and Karin, M. (2001). Mammalian MAP
kinase signalling cascades. Nature
410, 37-40.[CrossRef][Medline]
Chen, Y. F., Shin, S. J. and Lin, S. R. (2005).
Ets1 was significantly activated by ERK1/2 in mutant K-ras stably transfected
human adrenocortical cells. DNA Cell Biol.
24,126
-132.[CrossRef][Medline]
Cikala, M., Wilm, B., Hobmayer, E., Bottger, A. and David, C.
N. (1999). Identification of caspases and apoptosis in the
simple metazoan Hydra. Curr. Biol.
9, 959-962.[CrossRef][Medline]
Cloney, R. A. (1978). Ascidian metamorphosis:
review and analysis. In Settlement and Metamorphosis of Marine
Invertebrate Larvae (ed. F.-S. Chia and M. E. Rice), pp.255
-282. Amesterdam: Elsevier.
Cloney, R. A. (1982). Ascidian larvae and the
events of metamorphosis. Am. Zool.
22,817
-826.
D'Agati, P. and Cammarata, M. (2005).
Comparative analysis of thyroxine distribution in ascidian larvae.
Cell Tissue Res. 323,529
-535.
Davidson, B. and Swalla, B. J. (2002). A
molecular analysis of ascidian metamorphosis reveals activation of an innate
immune response. Development
129,4739
-4751.
Davis, R. J. (2000). Signal transduction by the
JNK group of MAP kinases. Cell
103,239
-252.[CrossRef][Medline]
Dehal, P., Satou, Y., Campbell, R. K., Chapman, J., Degnan, B.,
De Tomaso, A., Davidson, B., Di Gregorio, A., Gelpke, M., Goodstein, D. M. et
al. (2002). The draft genome of Ciona intestinalis: insights
into chordate and vertebrate origins. Science
298,2157
-2167.
Deng, Y., Ren, X., Yang, L., Lin, Y. and Wu, X.
(2003). A JNK-dependent pathway is required for TNFalpha-induced
apoptosis. Cell 115,61
-70.[CrossRef][Medline]
Dodd, M. H. I. and Dodd, J. M. (1976). The
biology of metamorphosis. In Physiology of the
Amphibia (ed. B. Lofts), pp. 467-599.
New York: Academic Press.
Eisen, M. B., Spellman, P. T., Brown, P. O. and Botstein, D.
(1998). Cluster analysis and display of genome-wide expression
patterns. Proc. Natl. Acad. Sci. USA
95,14863
-14868.
Ellis, R. E., Jacobson, D. M. and Horvitz, H. R.
(1991). Genes required for the engulfment of cell corpses during
programmed cell death in Caenorhabditis elegans.
Genetics 129,79
-94.[Abstract]
Eri, R., Arnold, J. M., Hinman, V. F., Green, K. M., Jones, M.
K., Degnan, B. M. and Lavin, M. F. (1999). Hemps, a novel
EGF-like protein, plays a central role in ascidian metamorphosis.
Development 126,5809
-5818.[Abstract]
Fata, J. E., Werb, Z. and Bissell, M. J.
(2004). Regulation of mammary gland branching morphogenesis by
the extracellular matrix and its remodeling enzymes. Breast Cancer
Res. 6,1
-11.[Medline]
Gomez, A. R., Lopez-Varea, A., Molnar, C., de la
Calle-Mustienes, E., Ruiz-Gomez, M., Gomez-Skarmeta, J. L. and de Celis, J.
F. (2005). Conserved cross-interactions in Drosophila and
Xenopus between Ras/MAPK signaling and the dual-specificity phosphatase
MKP3. Dev. Dyn. 232,695
-708.[CrossRef][Medline]
Grüneberg, H. (1963). The
Pathology of Development. A Study of Inherited Skeletal Disorders in
Animal. Oxford: Blackwell.
Gumienny, T. L., Lambie, E., Hartwieg, E., Horvitz, H. R. and
Hengartner, M. O. (1999). Genetic control of programmed cell
death in the Caenorhabditis elegans hermaphrodite germline.
Development 126,1001
-1022.
Hornstein, I., Mortin, M. A. and Katzav, S.
(2003). DroVav, the Drosophila melanogaster homologue of the
mammalian Vav proteins, serves as a signal transducer protein in the Rac and
DER pathways. Oncogene
22,6774
-6784.[CrossRef][Medline]
Hotta, K., Takahashi, H., Ueno, N. and Gojobori, T.
(2003). A genome-wide survey of the genes for planar polarity
signaling or convergent extension-related genes in Ciona intestinalis and
phylogenetic comparisons of evolutionary conserved signaling components.
Gene 317,165
-185.[CrossRef][Medline]
Imai, K. S., Hino, K., Yagi, K., Satoh, N. and Satou, Y.
(2004). Gene expression profiles of transcription factors and
signaling molecules in the ascidian embryo: towards a comprehensive
understanding of gene networks. Development
131,4047
-4058.
Ishibashi, T., Usami, T., Fujie, M., Azumi, K., Satoh, N. and
Fujiwara, S. (2005). Oligonucleotide-based microarray
analysis of retinoic acid target genes in the protochordate, Ciona
intestinalis. Dev. Dyn.
233,1571
-1578.[CrossRef][Medline]
Jackson, D., Leys, S. P., Hinman, V. F., Woods, R., Lavin, M. F.
and Degnan, B. M. (2002). Ecological regulation of
development: induction of marine invertebrate metamorphosis. Int.
J. Dev. Biol. 46,679
-686.[Medline]
Jackson, G. A. and Strathmann, R. R. (1981).
Larval mortality from offshore mixing as a link beween precompetent and
competent period of development. Am. Nat.
118, 16-25.
Jacobson, M. D., Weil, M. and Raff, M. C.
(1997). Programmed cell death in animal development.
Cell 88,347
-354.[CrossRef][Medline]
Jeffery, W. R. (2002). Programmed cell death in
the ascidian embryo: modulation by FoxA5 and Manx and roles in the evolution
of larval development. Mech. Dev.
118,111
-124.[CrossRef][Medline]
Johnson, G. L. and Lapadat, R. (2002).
Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38
protein kinases. Science
298,1911
-1912.
Kanehisa, M. (2002). The KEGG database.
Novartis Found. Symp.
247, 91-101; discussion
101-103, 119-128, 244-252.[Medline]
Kanehisa, M. and Goto, S. (2000). KEGG: kyoto
encyclopedia of genes and genomes. Nucleic Acids Res.
28, 27-30.
Kasza, A., O'Donnell, A., Gascoigne, K., Zeef, L. A., Hayes, A.
and Sharrocks, A. D. (2005). The ETS domain transcription
factor Elk-1 regulates the expression of its partner protein, SRF.J. Biol. Chem. 280,1149
-1155.
Kling, D. E., Lorenzo, H. K., Trbovich, A. M., Kinane, T. B.,
Donahoe, P. K. and Schnitzer, J. J. (2002). MEK-1/2
inhibition reduces branching morphogenesis and causes mesenchymal cell
apoptosis in fetal rat lungs. Am. J. Physiol. Lung Cell. Mol.
Physiol. 282,L370
-L378.
Koleva, M., Kappler, R., Vogler, M., Herwig, A., Fulda, S. and
Hahn, H. (2005). Pleiotropic effects of sonic hedgehog on
muscle satellite cells. Cell Mol. Life Sci.
62,1863
-1870.[CrossRef][Medline]
Kuan, C. Y., Yang, D. D., Samanta Roy, D. R., Davis, R. J.,
Rakic, P. and Flavell, R. A. (1999). The Jnk1 and Jnk2
protein kinases are required for regional specific apoptosis during early
brain development. Neuron
22,667
-676.[CrossRef][Medline]
Kuranaga, E., Kanuka, H., Igaki, T., Sawamoto, K., Ichijo, H.,
Okano, H. and Miura, M. (2002). Reaper-mediated inhibition of
DIAP1-induced DTRAF1 degradation results in activation of JNK in Drosophila.
Nat. Cell Biol. 4,705
-710.[CrossRef][Medline]
Kusakabe, T., Yoshida, R., Kawakami, I., Kusakabe, R.,
Mochizuki, Y., Yamada, L., Shin-i, T., Kohara, Y., Satoh, N., Tsuda, M. et
al. (2002). Gene expression profiles in tadpole larvae of
Ciona intestinalis. Dev. Biol.
242,188
-203.[CrossRef][Medline]
Laemmli, U. K. (1970). Cleavage of structural
proteins during the assembly of the head of bacteriophage T4.
Nature 227, 680-685.
Lee, Y. H., Huang, G. M., Cameron, R. A., Graham, G., Davidson,
E. H., Hood, L. and Britten, R. J. (1999). EST analysis of
gene expression in early cleavagestage sea urchin embryos.
Development 126,3857
-3867.[Abstract]
Lin, A. and Dibling, B. (2002). The true face
of JNK activation in apoptosis. Aging Cell
1, 112-116.[CrossRef][Medline]
Liu, J. and Lin, A. (2005). Role of JNK
activation in apoptosis: a double-edged sword. Cell
Res. 15,36
-42.[CrossRef][Medline]
Manni, L., Lane, N. J., Joly, J. S., Gasparini, F., Tiozzo, S.,
Caicci, F., Zaniolo, G. and Burighel, P. (2004). Neurogenic
and non-neurogenic placodes in ascidians. J. Exp. Zool. B Mol. Dev.
Evol. 302,483
-504.
Meier, P., Finch, A. and Evan, G. (2000).
Apoptosis in development. Nature
407,796
-801.[CrossRef][Medline]
Migheli, A., Mongini, T., Doriguzzi, C., Chiado-Piat, L., Piva,
R., Ugo, I. and Palmucci, L. (1997). Muscle apoptosis in
humans occurs in normal and denervated muscle, but not in myotonic dystrophy,
dystrophinopathies or inflammatory disease.
Neurogenetics 1,81
-87.[CrossRef][Medline]
Minet, E., Michel, G., Mottet, D., Piret, J. P., Barbieux, A.,
Raes, M. and Michiels, C. (2001). c-JUN gene induction and
AP-1 activity is regulated by a JNK-dependent pathway in hypoxic HepG2 cells.
Exp. Cell Res. 265,114
-124.[CrossRef][Medline]
Moreno, E., Yan, M. and Basler, K. (2002).
Evolution of TNF signaling mechanisms: JNK-dependent apoptosis triggered by
Eiger, the Drosophila homolog of the TNF superfamily. Curr.
Biol. 12,1263
-1268.[CrossRef][Medline]
Munoz-Sanjuan, I., Bell, E., Altmann, C. R., Vonica, A. and
Brivanlou, A. H. (2002). Gene profiling during neural
induction in Xenopus laevis: regulation of BMP signaling by
post-transcriptional mechanisms and TAB3, a novel TAK1-binding protein.
Development 129,5529
-5540.
Nakajima, K., Fujimoto, K. and Yaoita, Y.
(2005). Programmed cell death during amphibian metamorphosis.
Semin. Cell Dev. Biol.
16,271
-280.[CrossRef][Medline]
Nakayama, A., Satou, Y. and Satoh, N. (2001).
Isolation and characterization of genes that are expressed during Ciona
intestinalis metamorphosis. Dev. Genes Evol.
211,184
-189.[CrossRef][Medline]
Nakayama, A., Satou, Y. and Satoh, N. (2002).
Further characterization of genes expressed during Ciona intestinalis
metamorphosis. Differentiation
70,429
-437.[CrossRef][Medline]
Patricolo, E., Ortolani, G. and Cascio, A.
(1981). The effect of l-thyroxine on the metamorphosis of Ascidia
malaca. Cell Tissue Res.
214,289
-301.[Medline]
Patricolo, E., Cammarata, M. and D'Agati, P.
(2001). Presence of thyroid hormones in ascidian larvae and their
involvement in metamorphosis. J. Exp. Zool.
290,426
-430.[CrossRef][Medline]
Sabapathy, K., Jochum, W., Hochedlinger, K., Chang, L., Karin,
M. and Wagner, E. F. (1999). Defective neural tube
morphogenesis and altered apoptosis in the absence of both JNK1 and JNK2.
Mech. Dev. 89,115
-124.[CrossRef][Medline]
Sandri, M. and Carraro, U. (1999). Apoptosis of
skeletal muscles during development and disease. Int. J. Biochem.
Cell Biol. 31,1373
-1390.[CrossRef][Medline]
Sandri, M., Minetti, C., Pedemonte, M. and Carraro, U.
(1998). Apoptotic myonuclei in human Duchenne muscular
dystrophy. Lab. Invest.
78,1005
-1016.[Medline]
Saraga-Babic, M., Lehtonen, E., Svajger, A. and Wartiovaara,
J. (1994). Morphological and immunohistochemical
characteristics of axial structures in the transitory human tail.
Ann. Anat. 176,277
-286.[Medline]
Sarkar, D., Su, Z. Z., Lebedeva, I. V., Sauane, M.,
Gopalkrishnan, R. V., Valerie, K., Dent, P. and Fisher, P. B.
(2002). mda-7 (IL-24) Mediates selective apoptosis in human
melanoma cells by inducing the coordinated overexpression of the GADD family
of genes by means of p38 MAPK. Proc. Natl. Acad. Sci.
USA 99,10054
-10059.
Satoh, N. (1994). Developmental
Biology of Ascidians. New York: Cambridge University
Press.
Satoh, N. (2003). The ascidian tadpole larva:
comparative molecular development and genomics. Nat. Rev.
Genet. 4,285
-295.[Medline]
Satou, Y. (1999). posterior end mark 3 (pem-3),
an ascidian maternally expressed gene with localized mRNA encodes a protein
with Caenorhabditis elegans MEX-3-like KH domains. Dev.
Biol. 212,337
-350.[CrossRef][Medline]
Satou, Y., Imai, K. S. and Satoh, N. (2001).
Early embryonic expression of a LIM-homeobox gene Cs-lhx3 is downstream of
beta-catenin and responsible for the endoderm differentiation in Ciona
savignyi embryos. Development
128,3559
-3570.
Satou, Y., Takatori, N., Fujiwara, S., Nishikata, T., Saiga, H.,
Kusakabe, T., Shin-i, T., Kohara, Y. and Satoh, N. (2002).
Ciona intestinalis cDNA projects: expressed sequence tag analyses and gene
expression profiles during embryogenesis. Gene
287, 83-96.[Medline]
Satou, Y., Sasakura, Y., Yamada, L., Imai, K. S., Satoh, N. and
Degnan, B. (2003). A genomewide survey of developmentally
relevant genes in Ciona intestinalis. V. Genes for receptor tyrosine kinase
pathway and Notch signaling pathway. Dev. Genes Evol.
213,254
-263.[CrossRef][Medline]
Seger, R. and Krebs, E. G. (1995). The MAPK
signaling cascade. FASEB J.
9, 726-735.[Abstract]
Steller, H. (1995). Mechanisms and genes of
cellular suicide. Science
267,1445
-1449.
Subramaniam, S., Zirrgiebel, U., von Bohlen und Halbach, O.,
Strelau, J., Laliberté, C., Kaplan, D. R. and Unsicker, K.
(2004). ERK activation promotes neuronal degeneration
predominantly through plasma membrane damage and independently of caspase-3.
J. Cell Biol. 165,357
-369.
Tarallo, R. and Sordino, P. (2004). Time course
of programmed cell death in Ciona intestinalis in relation to mitotic activity
and MAPK signaling. Dev. Dyn.
230,251
-262.[CrossRef][Medline]
Thornberry, N. A. and Lazebnik, Y. (1998).
Caspases: enemies within. Science
281,1312
-1316.
Tibbles, L. A. and Woodgett, J. R. (1999). The
stress-activated protein kinase pathways. Cell. Mol. Life
Sci. 55,1230
-1254.[CrossRef][Medline]
Tohyama, K., Kusuhara, H. and Sugiyama, Y.
(2004). Involvement of multispecific organic anion transporter,
Oatp14 (Slc21a14), in the transport of thyroxine across the blood-brain
barrier. Endocrinology
145,4384
-4391.
Vaux, D. L. and Korsmeyer, S. J. (1999). Cell
death in development. Cell
96,245
-254.[CrossRef][Medline]
Vincent, S., Marty, L. and Fort, P. (1993). S26
ribosomal protein RNA: an invariant control for gene regulation experiments in
eukaryotic cells and tissues. Nucleic Acids Res.
21, 1498.
Wada, T. and Penninger, J. M. (2004).
Mitogen-activated protein kinases in apoptosis regulation.
Oncogene 23,2838
-2849.[CrossRef][Medline]
Waskiewicz, A. J. and Cooper, J. A. (1995).
Mitogen and stress response pathways: MAP kinase cascades and phosphatase
regulation in mammals and yeast. Curr. Opin. Cell
Biol. 7,798
-805.[CrossRef][Medline]
Woods, R. G., Roper, K. E., Gauthier, M., Bebell, L. M., Sung,
K., Degnan, B. M. and Lavin, M. F. (2004). Gene expression
during early ascidian metamorphosis requires signalling by Hemps, an EGF-like
protein. Development
131,2921
-2933.
Yamada, L., Kobayashi, K., Satou, Y. and Satoh, N.
(2005). Microarray analysis of localization of maternal
transcripts in eggs and early embryos of the ascidian, Ciona intestinalis.Dev. Biol. 284,536
-550.[Medline]
Yao, Y., Li, W., Wu, J., Germann, U. A., Su, M. S., Kuida, K.
and Boucher, D. M. (2003). Extracellular signal-regulated
kinase 2 is necessary for mesoderm differentiation. Proc. Natl.
Acad. Sci. USA 100,12759
-12764.
Yoshimura, K., Aoki, H., Ikeda, Y., Fujii, K., Akiyama, N.,
Furutani, A., Hoshii, Y., Tanaka, N., Ricii, R., Ishihara, T. et al.
(2005). Regression of abdominal aortic aneurysm by inhibition of
c-jun N-terminal kinase. Nat. Med.
11,1330
-1338.[CrossRef][Medline]
Youson, J. H. and Sower, S. A. (2001). Theory
on the evolutionary history of lamprey metamorphosis: role of reproductive and
thyroid axes. Comp. Biochem. Physiol. B Biochem. Mol.
Biol. 129,337
-345.[CrossRef][Medline]
Youson, J. H., Heinig, J. A., Khanam, S. F., Sower, S. A.,
Kawauchi, H. and Keeley, F. W. (2006). Patterns of
proopiomelanocortin and proopiocortin gene expression and of
immunohistochemistry for gonadotropin-releasing hormones (lGnRH-I and III)
during the life cycle of a nonparasitic lamprey: relationship to this adult
life history type. Gen. Comp. Endocrinol.
148, 54-71.[CrossRef][Medline]
Zugasti, O., Rul, W., Roux, P., Peyssonnaux, C., Eychene, A.,
Francke, T. F., Fort, P. and Hibner, U. (2001). Raf-MEK-Erk
cascade in anoikis is controlled by Rac 1 and Cdc42 via Akt. Mol.
Cell. Biol. 21,6706
-6717.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
