|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 February 2007
doi: 10.1242/dev.02813
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Laboratory of Molecular Genetics, National Institutes of Child Health and
Human Development, NIH, Bethesda, MD 20892, USA.
2 Department of Developmental and Cell Biology, Division of Human Genetics and
Birth Defects, University of California, Irvine, CA 92697-2300, USA.
3 Department of Pediatrics, Division of Human Genetics and Birth Defects,
University of California, Irvine, CA 92697-2300, USA.
* Author for correspondence (e-mail: tsargent{at}nih.gov)
Accepted 18 January 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Cartilage, PAK, Cortical actin, Cytoskeleton, Wound healing, Craniofacial, Tfap2a, Ectomesenchyme, Neural crest, Xenopus, Zebrafish
| INTRODUCTION |
|---|
|
|
|---|
NC induction occurs through the combined effects of multiple signaling
pathways, including bone morphogenetic proteins (BMP), Wnts, fibroblast growth
factors and retinoic acid (Bastidas et al.,
2004
; LaBonne and
Bronner-Fraser, 1998
;
Monsoro-Burq et al., 2005
;
Saint-Jeannet et al., 1997
).
These signals regulate expression of transcription factors that specify the NC
phenotype (Huang and Saint-Jeannet,
2004
; Meulemans and
Bronner-Fraser, 2004
; Sargent,
2006
). Among these, Tfap2a, one member of a family encoding three
to five closely related transcriptional activators
(Eckert et al., 2005
), plays
an essential role in early specification of both epidermis and NC in
Xenopus (Luo et al.,
2003
), and in numerous aspects of NC development in zebrafish
(Barrallo-Gimeno et al., 2004
;
Knight et al., 2005
;
Knight et al., 2003
) and mouse
(Brewer et al., 2004
). In
Xenopus, Tfap2a can substitute for BMP signaling in NC induction
(Luo et al., 2003
). Several
direct Tfap2a targets act in subsets of NC, such as Hoxa2 in skeletal
progenitors (Maconochie et al.,
1999
) and C-kit (kita) in pigment cell
precursors (Huang et al.,
1998
; Knight et al.,
2003
), but other downstream NC effector genes are largely
unknown.
We previously identified several novel targets of Tfap2a transactivation by
microarray (Luo et al., 2005
).
One of these genes, Inca, is conserved among vertebrates, lacks any
known structural domains (except for a 14-3-3 binding site of unknown
significance) and has no known function. Inca is expressed in early
cranial NC cells, and several other embryonic tissues including the
presumptive epidermis, suggesting that it could be an important downstream
effector of Tfap2a during embryogenesis.
Here we report that Inca is required for morphogenesis of NC-derived
cartilage. Expression of Inca in cranial NC is conserved across
multiple vertebrate species, including zebrafish, Xenopus and mouse.
Knockdown of Inca expression by antisense morpholino oligonucleotides (MOs) in
both Xenopus and zebrafish results in dramatic reductions in cranial
NC-derived cartilage formation. We show that Inca interacts with PAK5, a
p21-activated kinase downstream of the Rho GTPases Cdc42 and Rac1, previously
implicated in cytoskeletal organization and apoptosis
(Bokoch, 2003
;
Jaffer and Chernoff, 2002
) as
well as control of cell adhesion and convergent extension movements in
Xenopus (Cau et al.,
2001
; Faure et al.,
2005
). Consistent with a role in cytoskeletal organization, Inca
overexpression disrupts both cortical pigmentation in blastomeres and wound
healing in Xenopus embryos. Combined overexpression of PAK5 and Inca
enhances these phenotypes compared with either factor alone, suggesting that
their association has functional significance for the control of
cytoarchitecture. Taken together, our results suggest a novel mechanism by
which Inca functions in concert with PAK5 to regulate the morphogenesis of
cells in the early embryo, including postmigratory NC that form the
craniofacial skeleton.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA constructs and RNA synthesis for injection
Two Xenopus Inca pseudoalleles (IncaA and IncaB)
and zebrafish inca1 and inca2 were identified by BLAST
searches and full-length expressed sequence tag (EST) clones were obtained
(Open Biosystems). GenBank Accession Numbers are given in the legend to
Fig. 1. Open reading frames
(ORF) of IncaA and IncaB were sub-cloned into the
EcoRI-XhoI sites of pCTS (Feledy
et al., 1999
). Full-length sense mRNAs were generated by plasmid
digestion with NotI and transcription by SP6 polymerase (Ambion
Message Machine). XIncaA-GFP and XPAK5-RFP were generated by
PCR and used to create in-frame N-terminal fusions to pCS2+eGFP and pDSRed1-N1
(Clontech), respectively. Xenopus PAK5-GFP and related constructs
have been previously described (Cau et al.,
2001
).
Antisense MOs
Translation-blocking antisense MOs were used for both Xenopus and
zebrafish embryos (GeneTools). MO sequences (start codon underlined) for
Xenopus were: GCGCATCACCCAAGCGGAGGGAGAT (IncaA
MO), ATGCGATTTGTGCATCACCCAAGCG (IncaB MO),
CAGACAAGCGCAATGGTGCCCGG (IncaA MO2) and AGATGAGACTGGCGCAATGGTCCCC
(IncaB MO2). A MO containing five mismatched base pairs from the
IncaA MO was used as a control (GCcCATgACCgAAGCGGAGcGAcAT; mismatched
nucleotides in lowercase). MOs were injected into one or two blastomeres at
the two-cell stage, along with 200 pg lacZ mRNA as a lineage tracer
when a single blastomere was injected. The total in all cases was 10 ng of
each MO. To assay MO effectiveness in Xenopus, plasmids containing
the MO binding site and N-terminus of IncaA (base pairs -30 to +948) and IncaB
(base pairs -21 to +402) fused to the N-terminus of GFP were co-injected with
MOs into one- and two-cell stage Xenopus embryos. Zebrafish embryos
were injected with 10 ng of MO
(5'-TGCAGACACAACATTATTCTTAATA-3') at the one- and
two-cell stage.
In situ hybridization, Alcian Blue staining and TUNEL staining
Whole-mount in situ hybridization was performed as described previously in
Xenopus (Harland,
1991
), zebrafish (Thisse et
al., 1993
) and mouse (Saga et
al., 1996
). Digoxigenin-labeled antisense probes used for
Xenopus were IncaA, Tfap2a
(Winning et al., 1991
),
Slug (Mayor et al.,
1995
), Sox2 (Mizuseki
et al., 1998
), Sox9
(Spokony et al., 2002
),
Sox10 (Aoki et al.,
2003
) and Dlx2
(Papalopulu and Kintner,
1993
), and for zebrafish inca1 (GenBank Accession Number,
CK018555). Embryo sections in JB4 followed manufacturer instructions
(Polysciences). Alcian Blue cartilage staining was performed as described
previously (Pasqualetti et al.,
2000
). The TUNEL assay was performed on whole-mount embryos as
described (Hensey and Gautier,
1998
), except that epidermis was manually removed from tadpoles
after fixation to facilitate reagent penetration.
Interaction of Xenopus Inca and PAK5 in yeast
The mouse Inca ORF was used as bait in a two-hybrid screen with a
mouse E11-stage cDNA library according to manufacturer instructions
(MatchmakerTM Two-Hybrid System; Clontech). Xenopus Inca and
PAK5 ORFs were also cloned into pGBKT7 and pGADT7, respectively.
Yeast transformation was performed using standard procedures.
Immunoprecipitation and western blotting
HEK293 cells and CHO cells were transiently transfected with the indicated
plasmids using Lipofectamine 2000 (Invitrogen). For coimmunoprecipitation, 24
hours after transfection, cells were lysed in lysis buffer [50 mM Tris pH 7.4,
150 mM NaCl, 1% Nonidet P-40 (NP40) with protease inhibitors (Roche)]. The
lysates were incubated with a monoclonal antibody for a Myc-epitope (9E-10;
Santa Cruz) for 2 hours, followed by protein-G Sepharose beads (Sigma) for
another 2 hours at 4°C. The beads were washed three times in lysis buffer
and analyzed by western blotting. To immunoprecipitate Inca protein from
non-transfected Xenopus A6 cells, a rabbit antibody to the IncaA
peptide DLPSDVSPGSCGQRGLE conjugated to keyhole limpet hemocyanin was produced
by Open Biosystems. Preimmune serum from the immunized rabbit was used as a
negative control. Xenopus PAK5 antibody was a generous gift from N.
Morin. Additional antibodies used were anti-phospho-Ser474-PAK4 (Cell
Signaling Technology), anti-FLAG (Sigma) and anti-GFP (Sigma). Appropriate
secondary antibodies were detected by enhanced chemiluminescence (Pierce).
| RESULTS |
|---|
|
|
|---|
Inca cannot be assigned to a tentative gene family or function
based on its protein sequence, but is the founding member of a group of
Inca-related proteins conserved across vertebrates, including fish, frog,
mouse and human. Sequence conservation averages 35-40% across species, and
clusters near the proteins' center, including one highly conserved domain of
38 residues, the `inca-box' (Fig.
1B). Incas also contain a highly conserved binding site for the
scaffolding protein 14-3-3 (Muslin et al.,
1996
), located immediately upstream of the inca-box; however,
preliminary evidence suggests that this site is not required for its activity
in overexpression assays (see below; data not shown). Of two
Inca-related genes in zebrafish, closely linked on chromosome 11,
inca1 resembles Xenopus Inca slightly more than
inca2 (Fig. 1C). In
addition to one clear Inca ortholog in mouse (chromosome 9) and human
(chromosome 3), another distantly related gene exists in fish (chromosome 8),
frogs and mammals (mouse chromosome 3; human chromosome 1), with unknown
function.
Fish, frog and mouse Inca orthologs have similar expression
patterns during embryogenesis. Xenopus Inca expression begins shortly
after midblastula transition (stage 9; Fig.
2A) and becomes localized to deep mesodermal cells and the inner,
sensorial ectoderm layer during gastrulation
(Fig. 2B). During neurulation,
expression becomes restricted to notochord, epidermis and NC cells but is
excluded from the neural plate or neural tube at later stages
(Fig. 2C). Expression persists
in NC cells during their migration into the pharyngeal arches
(Fig. 2D-G), where it is
confined to NC-derived head mesenchyme
(Fig. 2F,G)
(Hausen and Riebesell, 1991
).
By early tadpole stages, Inca is expressed in cranial ganglia and in
the dorsal eye vesicle in addition to pharyngeal arch mesenchyme
(Fig. 2H). Similarly, in
zebrafish, inca1 expression is zygotic and restricted to early
ectoderm and notochord during gastrulation, as well as later in the
premigratory and migrating cranial NC (Fig.
2I-N). Expression persists in the pharyngeal arches, ventral
forebrain, pituitary and olfactory epithelia. Expression was also seen in the
hypochord and ventral somites at this time point (data not shown). Mouse
Inca transcripts also localize to pharyngeal arch NC (E9.5;
Fig. 2O), and to the limb buds
and somites by E11.5 (Fig. 2P).
Northern blot analysis of mouse tissue RNAs reveal essentially ubiquitous
Inca expression in the adult, with particularly high levels in heart
(Fig. 2Q). Thus, Inca
orthologs all show conserved expression in cranial NC at early stages that
require Tfap2a function.
|
Conserved requirements for Inca in NC development
To investigate the developmental requirements for Inca, MOs were designed
to inhibit translation in both Xenopus and zebrafish embryos. These
gave similar phenotypes. Two pseudoallelic Inca mRNAs in Xenopus
laevis required two Inca MOs, designated IncaA MO and
IncaB (GenBank Accession Number, DQ993180) MO. Injection of 10 ng per
embryo of either MO efficiently blocked expression of synthetic mRNAs
containing the cognate MO-binding sites fused to enhanced GFP (eGFP), whereas
a mismatched IncaA control MO did not interfere with either fusion
protein (Fig. 4A). Injection of
IncaA or IncaB MOs (20 ng per embryo) individually had only
a slight effect on 10-15% of embryos (n=83 and n=79,
respectively; Fig. 4P), whereas
combining the two MOs (10 ng per embryo of each MO) resulted in a severe
phenotype in 98% of embryos (Fig.
4P; n=156). This allows us to rule out the possibility of
artifacts owing to MO toxicity. All subsequent experiments combined the
IncaA and IncaB MOs at equal concentration (Inca
MO). Xenopus embryos injected into both cells at the two-cell stage
with a total of 20 ng of Inca MO gastrulated normally, but formed
smaller heads with periocular swelling by late tadpole stages. Melanocytes,
which are NC-derived, were only slightly reduced (stage 45-47;
Fig. 4B-E), but later
MO-injected larvae had dramatic reductions in all NC-derived craniofacial
cartilages (Sadaghiani and Thiebaud,
1987
) (Fig. 4F,G).
These defects were not simply due to a general developmental delay, because
other structures, particularly in the trunk region, developed normally in
morphants. In addition, two distinct Inca MOs (IncaA MO2 and
IncaB MO2) that recognize non-overlapping target sequences yielded
indistinguishable phenotypes (Fig.
4H,I). Injection of an inca1 MO into zebrafish caused a
very similar, dose-dependent reduction in head size
(Fig. 4J,K), as well as cranial
cartilage formation in the pharyngeal arches
(Fig. 4L,M) and neurocranium
(Fig. 4N,O).
|
These results in both fish and frog suggest that Inca is not required for
NC induction or early migration, but later in cranial NC cells that form the
head skeleton. To investigate requirements for Inca in NC morphogenesis at
these later stages, we injected the inca1 MO into transgenic
zebrafish that express eGFP under control of 5 kb of the sox10
promoter (sox10:egfp), and used confocal microscopy to follow NC
behaviors (Wada et al., 2005
).
Similar to inca1, sox10:egfp expression begins in premigratory
cranial NC adjacent to the hindbrain during early somitogenesis, and persists
in migrating NC cells (Fig.
5S,U), and craniofacial cartilage in the larvae
(Fig. 5W,Y). With injection of
10 ng inca1 MO per embryo, NC cells migrated into the pharyngeal
arches (Fig. 5T,V) but failed
to condense and extend anteriorly to form normal cartilage
(Fig. 5X,Z). These results
demonstrate conserved requirements for Inca in NC cells after they
migrate.
|
Both the two-hybrid and co-IP experiments involve expressing exogenous Inca and PAK4/5 at levels that may exceed physiologically meaningful concentrations, allowing spurious binding. To address this issue, antiserum directed against a synthetic peptide from Xenopus Inca and shown by western blotting to be specific for this protein (Fig. 6C), along with preimmune serum as a negative control, were used to immunoprecipitate proteins from an extract of Xenopus A6 cells, which express both PAK5 and Inca. Western blotting using an antibody for Xenopus PAK5 showed that endogenous Inca protein will co-IP with PAK5 (Fig. 6D). Therefore, Inca and PAK5 naturally exist as a complex in untransfected Xenopus cells.
PAK proteins are effectors of the Rho GTPases Rac1 and Cdc42, and have been
implicated in control of cytoskeletal dynamics, including microfilament and
microtubule polymerization and stability
(Bokoch, 2003
;
Jaffer and Chernoff, 2002
).
PAK5 interacts with both microfilaments and microtubules in the
Xenopus embryo, and interference with PAK5 function affects cell
adhesion and convergent extension movements, both of which depend upon
cytoskeletal integrity and Rho GTPase signaling
(Faure et al., 2005
;
Kofron et al., 2002
;
Wunnenberg-Stapleton et al.,
1999
). To determine whether the Inca-PAK5 complex is also
associated with the cytoskeleton, CHO cells were transiently cotransfected
with Inca fused to GFP and PAK5 fused to red fluorescent protein (RFP) and
observed with a confocal microscope. As shown in
Fig. 6E, Inca and PAK5
colocalized in punctate bodies and fibers. Some of the endogenous PAK5
distribution pattern is in similar punctate bodies
(Cau et al., 2001
), but could
also be due in part to overexpression artifacts. The fibers are likely to be
microtubules, because they are sensitive to nocodazole
(Fig. 6F).
Ectopic expression of Inca modifies cytoarchitecture
To determine whether misexpression of Inca outside of its normal
domains in the NC and epidermis can alter cellular morphogenesis, synthetic
IncaA mRNA was injected into Xenopus embryos at the one-cell stage.
This disrupted body shape, including a shortened anteroposterior axis, open
neural tube and multiple tissue protrusions
(Fig. 7A,B). At blastula
stages, pigment granules in individual blastomeres of Inca-injected embryos
redistributed to the cell periphery, accenting cell-cell boundaries
(Fig. 7C,D). These changes
suggest a disruption in the cortical actin cytoskeleton in which these
granules are embedded.
Inca misexpression also disrupted another process highly dependent
on cytoskeletal rearrangements in Xenopus, wound healing. In low to
moderate salt concentrations, an embryo from which an ectodermal explant was
excised (vegetal explant) healed within approximately 15-20 minutes. This
involves changes in cell movements and adhesion that depend on Rho GTPase
signaling, plakoglobin and other components
(Davidson et al., 2002
;
Kofron et al., 2002
;
Tao et al., 2005
). Vegetal
explants from embryos injected with Inca mRNA healed much more slowly and to a
lesser extent than uninjected controls
(Fig. 7E,F). Healing explants
normally formed a `purse string' of actin filaments at the edge of the wound a
few minutes after excision from the blastula
(Merriam and Christensen,
1983
), which is under the control of the Rho GTPases Rac1
(Brock et al., 1996
) or Cdc42
(Kofron et al., 2002
).
Phalloidin staining never detected purse-string structures in explants from
embryos injected with Inca mRNA
(Fig. 7G,H). Thus, ectopic Inca
in the blastula disrupts multiple cell behaviors dependent on rearrangements
of cortical actin.
|
| DISCUSSION |
|---|
|
|
|---|
Our screen for Tfap2a targets has also yielded a novel protocadherin, named
PCNS, that is required for NC migration
(Rangarajan et al., 2006
), and
a surprisingly high proportion of epidermal genes also expressed in the NC
(Luo et al., 2005
). From these
results and earlier work, a picture emerges in which Tfap2a mediates BMP
signaling, functioning in concert with and downstream of other transcription
factors that initiate NC and epidermal specification. In the case of cranial
NC, however, Tfap2a appears more important as an early regulator of other
`effector' genes that control cell specification and terminal differentiation
(Meulemans and Bronner-Fraser,
2004
). In the NC, these include Tfap2a-dependent genes such as
Inca, PCNS, Hoxa2 and C-kit, all of which may control
certain aspects of cellular morphogenesis. For example, suppression of both
TFAP2A and C-KIT in humans correlates with an invasive,
metastatic melanoma phenotype (Huang et
al., 1998
).
|
Given the early requirements for Tfap2a in NC and the early NC expression of Inca, this relatively late phenotype is unexpected. The skeletal defects seen in low embryos are not as severe as in inca1-morphants, which is consistent with the observed reduction, but not complete loss, of inca1 expression in NC cells that form craniofacial cartilage in low embryos. We argue that the relatively late phenotype reflects requirements for Inca in cytoskeletal regulation in NC cells later in migration. Although morphants may retain some low-level Inca expression masking a complete null phenotype, we have injected much higher doses of Inca MO in Xenopus embryos (up to 80 ng per embryo; data not shown), which gives an identical phenotype. Alternatively, Inca could share redundant functions with other proteins during early NC formation and migration. Vertebrates have an Inca-related gene (Inca-r), but our preliminary analyses suggest that this gene is not expressed in early development (data not shown).
Defects in NC morphogenesis in the absence of Inca function coincide with
elevated cell death in tissues that express Inca, including the eye, the
epidermis and the NC. By the tadpole stage, cartilage cells become TUNEL+,
suggesting that they undergo apoptosis when they would normally differentiate
as chondrocytes. PAK4, the mammalian homolog of Xenopus PAK5, can
inhibit apoptosis, for example by blocking caspase action
(Gnesutta et al., 2001
). PAK4
also plays an important role in cell survival
(Li and Minden, 2005
). Thus,
elevated cell death in Inca morphants may result, in part, from interference
with PAK5 function.
Inca modulates cytoskeletal dynamics in association with PAK5
Ectopic overexpression of Inca causes defects in Xenopus
blastula-stage embryos that occur much earlier than the loss-of-function
phenotypes, probably because of disruption of the microfilament cytoskeleton.
Cortical pigment becomes redistributed away from the apical surface of
Inca-injected blastomeres. These pigment granules depend specifically on
F-actin, as shown by treatment with cytochalasin B, and show no response to
anti-microtubule drugs such as taxol or nocodazole
(Moreau et al., 1999
). The
Inca-induced pigment redistribution resembles embryos overexpressing FRIED, a
protein tyrosine phosphatase that interacts with Frizzled-8
(Itoh et al., 2005
). Activated
GTPase Rac1 rescues effects of FRIED overexpression, consistent with the
hypothesis that this restores cortical actin organization. Likewise,
ectodermal wound healing in Xenopus embryos depends on restructuring
of the cortical actin cytoskeleton. This is regulated by the small GTPase
Cdc42 (Kofron et al., 2002
),
and Inca overexpression interferes with assembly of the actin purse-string
around wounds. These results suggest that Inca might be involved in the
regulation of the Rho GTPase signaling pathway.
|
PAK5 localizes to microtubules and actin filaments, in patterns that shift
during the cell cycle and do not depend on kinase activity. Constitutive
activation of PAK5 prevents its interactions with microtubules
(Cau et al., 2001
). However,
PAK5 kinase activity plays an essential role in early Xenopus
gastrulation, because overexpression of a kinase-dead mutant form (PAK5/KR)
acts as a dominant negative to inhibit convergent extension movements in
dorsal mesoderm (Faure et al.,
2005
). PAK5/KR overexpression also enhances calcium-dependent
adhesion of ectodermal cells, whereas a constitutively active kinase reduces
adhesion. Inca synergizes with an intact PAK5 to disrupt wound healing and
cell adhesion when overexpressed in Xenopus embryos. PAK5/KR shows no
synergy, suggesting that this interaction requires kinase activity
(Fig. 7). However, Inca does
not activate the PAK5 kinase, because co-expression of Xenopus Inca
and PAK5 in mammalian cells does not increase phosphorylation of the
regulatory Ser533 residue (Fig.
7Q). Furthermore, overexpression of constitutively active PAK5
does not mimic combined overexpression of Inca and wild-type PAK5. This
suggests the possibility that kinase targets for PAK5 may exist in microtubule
or microfilament cytoskeletal components that are only accessible when Inca is
associated with the kinase. In other words, Inca might provide a mechanism for
regulation of PAK5, which, like other Class II PAKs (PAK 4-6), binds to Cdc42
or Rac1 but is not catalytically activated by this association.
|
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y. H., Credidio, C. and Saint-Jeannet, J. P. (2003). Sox10 regulates the development of neural crest-derived melanocytes in Xenopus. Dev. Biol. 259,19 -33.[CrossRef][Medline]
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Bastidas, F., De Calisto, J. and Mayor, R. (2004). Identification of neural crest competence territory: role of Wnt signaling. Dev. Dyn. 229,109 -117.[CrossRef][Medline]
Bokoch, G. M. (2003). Biology of the p21-activated kinases. Annu. Rev. Biochem. 72,743 -781.[CrossRef][Medline]
Brewer, S., Feng, W., Huang, J., Sullivan, S. and Williams, T. (2004). Wnt1-Cre-mediated deletion of AP-2alpha causes multiple neural crest-related defects. Dev. Biol. 267,135 -152.[CrossRef][Medline]
Brock, J., Midwinter, K., Lewis, J. and Martin, P.
(1996). Healing of incisional wounds in the embryonic chick wing
bud: characterization of the actin purse-string and demonstration of a
requirement for Rho activation. J. Cell Biol.
135,1097
-1107.
Cau, J., Faure, S., Comps, M., Delsert, C. and Morin, N.
(2001). A novel p21-activated kinase binds the actin and
microtubule networks and induces microtubule stabilization. J. Cell
Biol. 155,1029
-1042.
Davidson, L. A., Ezin, A. M. and Keller, R. (2002). Embryonic wound healing by apical contraction and ingression in Xenopus laevis. Cell Motil. Cytoskeleton 53,163 -176.[CrossRef][Medline]
Duband, J. L. (2006). Neural crest cell delamination and migration: integrating regulations of cell interactions, locomotion, survival and fate. In Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp.45 -71. Georgetown, TX: Landes Bioscience.
Duband, J. L., Monier, F., Delannet, M. and Newgreen, D. (1995). Epithelium-mesenchyme transition during neural crest development. Acta Anat. Basel 154, 63-78.[Medline]
Eckert, D., Buhl, S., Weber, S., Jager, R. and Schorle, H. (2005). The AP-2 family of transcription factors. Genome Biol. 6,246 .[CrossRef][Medline]
Faure, S., Cau, J., de Santa Barbara, P., Bigou, S., Ge, Q., Delsert, C. and Morin, N. (2005). Xenopus p21-activated kinase 5 regulates blastomeres' adhesive properties during convergent extension movements. Dev. Biol. 277,472 -492.[CrossRef][Medline]
Feledy, J. A., Morasso, M. I., Jang, S. I. and Sargent, T.
D. (1999). Transcriptional activation by the homeodomain
protein distal-less 3. Nucleic Acids Res.
27,764
-770.
Gnesutta, N., Qu, J. and Minden, A. (2001). The
serine/threonine kinase PAK4 prevents caspase activation and protects cells
from apoptosis. J. Biol. Chem.
276,14414
-14419.
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Hausen, P. and Riebesell, M. (1991). The Early Development of Xenopus laevis: An Atlas of the Histology. Berlin, New York: Springer-Verlag.
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Huang, S., Jean, D., Luca, M., Tainsky, M. A. and Bar-Eli, M. (1998). Loss of AP-2 results in downregulation of c-KIT and enhancement of melanoma tumorigenicity and metastasis. EMBO J. 17,4358 -4369.[CrossRef][Medline]
Huang, X. and Saint-Jeannet, J. P. (2004). Induction of the neural crest and the opportunities of life on the edge. Dev. Biol. 275,1 -11.[CrossRef][Medline]
Itoh, K., Lisovsky, M., Hikasa, H. and Sokol, S. Y. (2005). Reorganization of actin cytoskeleton by FRIED, a Frizzled-8 associated protein tyrosine phosphatase. Dev. Dyn. 234,90 -101.[CrossRef][Medline]
Jaffer, Z. M. and Chernoff, J. (2002). p21-activated kinases: three more join the Pak. Int. J. Biochem. Cell Biol. 34,713 -717.[CrossRef][Medline]
Kimmel, C. B., Miller, C. T. and Keynes, R. J. (2001). Neural crest patterning and the evolution of the jaw. J. Anat. 199,105 -120.[CrossRef][Medline]
Knight, R. D. and Schilling, T. F. (2006). Cranial neural crest and development of the head skeleton. In Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp. 120-133. Georgetown, TX: Landes Bioscience.
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y.,
Geisler, R., Rauch, G. J. and Schilling, T. F. (2003).
lockjaw encodes a zebrafish tfap2a required for early neural crest
development. Development
130,5755
-5768.
Knight, R. D., Javidan, Y., Zhang, T., Nelson, S. and Schilling,
T. F. (2005). AP2-dependent signals from the ectoderm
regulate craniofacial development in the zebrafish embryo.
Development 132,3127
-3138.
Kofron, M., Heasman, J., Lang, S. A. and Wylie, C. C.
(2002). Plakoglobin is required for maintenance of the cortical
actin skeleton in early Xenopus embryos and for cdc42-mediated wound healing.
J. Cell Biol. 158,695
-708.
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two-signal model. Development 125,2403 -2414.[Abstract]
Le Douarin, N. and Kalcheim, C. (1999). The Neural Crest. London: Cambridge University Press.
Li, X. and Minden, A. (2005). PAK4 functions in
tumor necrosis factor (TNF) alpha-induced survival pathways by facilitating
TRADD binding to the TNF receptor. J. Biol. Chem.
280,41192
-41200.
Lloyd, B., Tao, Q., Lang, S. and Wylie, C.
(2005). Lysophosphatidic acid signaling controls cortical actin
assembly and cytoarchitecture in Xenopus embryos.
Development 132,805
-816.
Luo, T., Matsuo-Takasaki, M., Thomas, M. L., Weeks, D. L. and Sargent, T. D. (2002). Transcription factor AP-2 is an essential and direct regulator of epidermal development in Xenopus. Dev. Biol. 245,136 -144.[CrossRef][Medline]
Luo, T., Lee, Y. H., Saint-Jeannet, J. P. and Sargent, T. D.
(2003). Induction of neural crest in Xenopus by transcription
factor AP2alpha. Proc. Natl. Acad. Sci. USA
100,532
-537.
Luo, T., Zhang, Y., Khadka, D., Rangarajan, J., Cho, K. W. and Sargent, T. D. (2005). Regulatory targets for transcription factor AP2 in Xenopus embryos. Dev. Growth Differ. 47,403 -413.[CrossRef][Medline]
Maconochie, M., Krishnamurthy, R., Nonchev, S., Meier, P., Manzanares, M., Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural crest cells involves members of the AP-2 family. Development 126,1483 -1494.[Abstract]
Mayor, R., Morgan, R. and Sargent, M. G. (1995). Induction of the prospective neural crest of Xenopus. Development 121,767 -777.[Abstract]
Merriam, R. W. and Christensen, K. (1983). A contractile ring-like mechanism in wound healing and soluble factors affecting structural stability in the cortex of Xenopus eggs and oocytes. J. Embryol. Exp. Morphol. 75,11 -20.[Medline]
Meulemans, D. and Bronner-Fraser, M. (2004). Gene-regulatory interactions in neural crest evolution and development. Dev. Cell 7,291 -299.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai, Y. (1998). Xenopus Zic-related-1 and Sox-2, two factors induced by chordin, have distinct activities in the initiation of neural induction. Development 125,579 -587.[Abstract]
Monsoro-Burq, A. H., Wang, E. and Harland, R. (2005). Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction. Dev. Cell 8, 167-178.[CrossRef][Medline]
Moreau, J., Lebreton, S., Iouzalen, N. and Mechali, M. (1999). Characterization of Xenopus RalB and its involvement in F-actin control during early development. Dev. Biol. 209,268 -281.[CrossRef][Medline]
Muslin, A. J., Tanner, J. W., Allen, P. M. and Shaw, A. S. (1996). Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84,889 -897.[CrossRef][Medline]
Nikolaidou, K. K. and Barrett, K. (2005). Getting to know your neighbours; a new mechanism for cell intercalation. Trends Genet. 21,70 -73.[CrossRef][Medline]
Papalopulu, N. and Kintner, C. (1993). Xenopus Distal-less related homeobox genes are expressed in the developing forebrain and are induced by planar signals. Development 117,961 -975.[Abstract]
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M. (2000). Ectopic Hoxa2 induction after neural crest migration results in homeosis of jaw elements in Xenopus. Development 127,5367 -5378.[Abstract]
Qu, J., Li, X., Novitch, B. G., Zheng, Y., Kohn, M., Xie, J. M.,
Kozinn, S., Bronson, R., Beg, A. A. and Minden, A. (2003).
PAK4 kinase is essential for embryonic viability and for proper neuronal
development. Mol. Cell. Biol.
23,7122
-7133.
Rangarajan, J., Luo, T. and Sargent, T. D. (2006). PCNS: a novel protocadherin required for cranial neural crest migration and somite morphogenesis in Xenopus. Dev. Biol. 295,206 -218.[CrossRef][Medline]
Richman, J. M. and Lee, S. H. (2003). About face: signals and genes controlling jaw patterning and identity in vertebrates. BioEssays 25,554 -568.[CrossRef][Medline]
Sadaghiani, B. and Thiebaud, C. H. (1987). Neural crest development in the Xenopus laevis embryo, studied by interspecific transplantation and scanning electron microscopy. Dev. Biol. 124,91 -110.[CrossRef][Medline]
Saga, Y., Hata, N., Kobayashi, S., Magnuson, T., Seldin, M. F. and Taketo, M. M. (1996). MesP1: a novel basic helix-loop-helix protein expressed in the nascent mesodermal cells during mouse gastrulation. Development 122,2769 -2778.[Abstract]
Saint-Jeannet, J. P., He, X., Varmus, H. E. and Dawid, I. B.
(1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and
Wnt-3a. Proc. Natl. Acad. Sci. USA
94,13713
-13718.
Sargent, T. D. (2006). Transcriptional regulation and the neural plate border. In Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp.32 -44. Georgetown, TX: Landes Bioscience.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Sive, H. (1999). Early Development of Xenopus laevis: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and Saint-Jeannet, J. P. (2002). The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development 129,421 -432.
Tao, Q., Lloyd, B., Lang, S., Houston, D., Zorn, A. and Wylie,
C. (2005). A novel G protein-coupled receptor, related to
GPR4, is required for assembly of the cortical actin skeleton in early Xenopus
embryos. Development
132,2825
-2836.
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]
Wada, N., Javidan, Y., Nelson, S., Carney, T. J., Kelsh, R. N.
and Schilling, T. F. (2005). Hedgehog signaling is required
for cranial neural crest morphogenesis and chondrogenesis at the midline in
the zebrafish skull. Development
132,3977
-3988.
Westerfield, M. (1994). The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio Rerio). Eugene, OR: University of Oregon Press.
Winning, R. S., Shea, L. J., Marcus, S. J. and Sargent, T.
D. (1991). Developmental regulation of transcription factor
AP-2 during Xenopus laevis embryogenesis. Nucleic Acids
Res. 19,3709
-3714.
Wolda, S. L., Moody, C. J. and Moon, R. T. (1993). Overlapping expression of Xwnt-3A and Xwnt-1 in neural tissue of Xenopus laevis embryos. Dev. Biol. 155, 46-57.[CrossRef][Medline]
Wunnenberg-Stapleton, K., Blitz, I. L., Hashimoto, C. and Cho, K. W. (1999). Involvement of the small GTPases XRhoA and XRnd1 in cell adhesion and head formation in early Xenopus development. Development 126,5339 -5351.[Abstract]
This article has been cited by other articles:
![]() |
H. Zhao, K. Tanegashima, H. Ro, and I. B. Dawid Lrig3 regulates neural crest formation in Xenopus by modulating Fgf and Wnt signaling pathways Development, April 1, 2008; 135(7): 1283 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Ossipova, J. Tabler, J. B. A. Green, and S. Y. Sokol PAR1 specifies ciliated cells in vertebrate ectoderm downstream of aPKC Development, December 1, 2007; 134(23): 4297 - 4306. [Abstract] [Full Text] [PDF] |
||||
|
|