spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 21 February 2007
doi: 10.1242/dev.02813


Development 134, 1279-1289 (2007)
Published by The Company of Biologists 2007


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02813v1
134/7/1279    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Luo, T.
Right arrow Articles by Sargent, T. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luo, T.
Right arrow Articles by Sargent, T. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Inca: a novel p21-activated kinase-associated protein required for cranial neural crest development

Ting Luo1, Yanhua Xu1, Trevor L. Hoffman2,3, Tailin Zhang2, Thomas Schilling2 and Thomas D. Sargent1,*

1 Laboratory of Molecular Genetics, National Institutes of Child Health and Human Development, NIH, Bethesda, MD 20892, USA.
2 Department of Developmental and Cell Biology, Division of Human Genetics and Birth Defects, University of California, Irvine, CA 92697-2300, USA.
3 Department of Pediatrics, Division of Human Genetics and Birth Defects, University of California, Irvine, CA 92697-2300, USA.

* Author for correspondence (e-mail: tsargent{at}nih.gov)

Accepted 18 January 2007


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inca (induced in neural crest by AP2) is a novel protein discovered in a microarray screen for genes that are upregulated in Xenopus embryos by the transcriptional activator protein Tfap2a. It has no significant similarity to any known protein, but is conserved among vertebrates. In Xenopus, zebrafish and mouse embryos, Inca is expressed predominantly in the premigratory and migrating neural crest (NC). Knockdown experiments in frog and fish using antisense morpholinos reveal essential functions for Inca in a subset of NC cells that form craniofacial cartilage. Cells lacking Inca migrate successfully but fail to condense into skeletal primordia. Overexpression of Inca disrupts cortical actin and prevents formation of actin `purse strings', which are required for wound healing in Xenopus embryos. We show that Inca physically interacts with p21-activated kinase 5 (PAK5), a known regulator of the actin cytoskeleton that is co-expressed with Inca in embryonic ectoderm, including in the NC. These results suggest that Inca and PAK5 cooperate in restructuring cytoskeletal organization and in the regulation of cell adhesion in the early embryo and in NC cells during craniofacial development.

Key words: Cartilage, PAK, Cortical actin, Cytoskeleton, Wound healing, Craniofacial, Tfap2a, Ectomesenchyme, Neural crest, Xenopus, Zebrafish


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Neural crest (NC) is a uniquely vertebrate cell type that arises at the boundary between neural plate and epidermis. During neural tube closure, NC cells delaminate from the neuroepithelium and begin to migrate as mesenchyme. This is accompanied by dramatic remodeling of cytoarchitecture and cell-cell adhesion, as NC cells migrate along predetermined pathways throughout the body (Duband et al., 1995Go). When NC cells finish migrating they differentiate into diverse derivatives including cartilage and bones of the skull, neurons and glia of the peripheral nervous system, melanocytes and many other cell types (Le Douarin and Kalcheim, 1999Go). Differentiation requires that many NC cells undergo second transformations in which they stop moving and condense, as in the formation of tightly packed cartilage elements or neuronal ganglia (Duband, 2006Go; Knight and Schilling, 2006Go; Richman and Lee, 2003Go). Although intensive research has focused on early NC induction, few studies have addressed the control of later NC morphogenesis at a molecular level.

NC induction occurs through the combined effects of multiple signaling pathways, including bone morphogenetic proteins (BMP), Wnts, fibroblast growth factors and retinoic acid (Bastidas et al., 2004Go; LaBonne and Bronner-Fraser, 1998Go; Monsoro-Burq et al., 2005Go; Saint-Jeannet et al., 1997Go). These signals regulate expression of transcription factors that specify the NC phenotype (Huang and Saint-Jeannet, 2004Go; Meulemans and Bronner-Fraser, 2004Go; Sargent, 2006Go). Among these, Tfap2a, one member of a family encoding three to five closely related transcriptional activators (Eckert et al., 2005Go), plays an essential role in early specification of both epidermis and NC in Xenopus (Luo et al., 2003Go), and in numerous aspects of NC development in zebrafish (Barrallo-Gimeno et al., 2004Go; Knight et al., 2005Go; Knight et al., 2003Go) and mouse (Brewer et al., 2004Go). In Xenopus, Tfap2a can substitute for BMP signaling in NC induction (Luo et al., 2003Go). Several direct Tfap2a targets act in subsets of NC, such as Hoxa2 in skeletal progenitors (Maconochie et al., 1999Go) and C-kit (kita) in pigment cell precursors (Huang et al., 1998Go; Knight et al., 2003Go), but other downstream NC effector genes are largely unknown.

We previously identified several novel targets of Tfap2a transactivation by microarray (Luo et al., 2005Go). One of these genes, Inca, is conserved among vertebrates, lacks any known structural domains (except for a 14-3-3 binding site of unknown significance) and has no known function. Inca is expressed in early cranial NC cells, and several other embryonic tissues including the presumptive epidermis, suggesting that it could be an important downstream effector of Tfap2a during embryogenesis.

Here we report that Inca is required for morphogenesis of NC-derived cartilage. Expression of Inca in cranial NC is conserved across multiple vertebrate species, including zebrafish, Xenopus and mouse. Knockdown of Inca expression by antisense morpholino oligonucleotides (MOs) in both Xenopus and zebrafish results in dramatic reductions in cranial NC-derived cartilage formation. We show that Inca interacts with PAK5, a p21-activated kinase downstream of the Rho GTPases Cdc42 and Rac1, previously implicated in cytoskeletal organization and apoptosis (Bokoch, 2003Go; Jaffer and Chernoff, 2002Go) as well as control of cell adhesion and convergent extension movements in Xenopus (Cau et al., 2001Go; Faure et al., 2005Go). Consistent with a role in cytoskeletal organization, Inca overexpression disrupts both cortical pigmentation in blastomeres and wound healing in Xenopus embryos. Combined overexpression of PAK5 and Inca enhances these phenotypes compared with either factor alone, suggesting that their association has functional significance for the control of cytoarchitecture. Taken together, our results suggest a novel mechanism by which Inca functions in concert with PAK5 to regulate the morphogenesis of cells in the early embryo, including postmigratory NC that form the craniofacial skeleton.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Embryo manipulation
Xenopus and zebrafish embryos were obtained and maintained according to standard procedures (Sive, 1999Go; Westerfield, 1994Go). Injection and dexamethasone treatments of Xenopus animal caps at the midblastula stage with mRNA encoding chordin (Chd) (Sasai et al., 1994Go), Wnt3a (Wolda et al., 1993Go), a glucocorticoid-responsive Tfap2a fusion protein (GR-AP2) or dominant negative Tfap2a (dnTfap2a) (Luo et al., 2002Go) were performed as described previously (Luo et al., 2005Go). Blastula wound healing assays and rhodamine-conjugated phalloidin staining of animal caps were performed similar to Kofron et al. (Kofron et al., 2002Go), with different healing times (Lloyd et al., 2005Go). Analysis of NC cells in zebrafish embryos was performed using a transgenic strain (sox10:eGFP) expressing enhanced green fluorescent protein (eGFP) in cranial NC precursors (Wada et al., 2005Go). Embryos were fixed, manually dissected, and imaged on a confocal microscope.

DNA constructs and RNA synthesis for injection
Two Xenopus Inca pseudoalleles (IncaA and IncaB) and zebrafish inca1 and inca2 were identified by BLAST searches and full-length expressed sequence tag (EST) clones were obtained (Open Biosystems). GenBank Accession Numbers are given in the legend to Fig. 1. Open reading frames (ORF) of IncaA and IncaB were sub-cloned into the EcoRI-XhoI sites of pCTS (Feledy et al., 1999Go). Full-length sense mRNAs were generated by plasmid digestion with NotI and transcription by SP6 polymerase (Ambion Message Machine). XIncaA-GFP and XPAK5-RFP were generated by PCR and used to create in-frame N-terminal fusions to pCS2+eGFP and pDSRed1-N1 (Clontech), respectively. Xenopus PAK5-GFP and related constructs have been previously described (Cau et al., 2001Go).

Antisense MOs
Translation-blocking antisense MOs were used for both Xenopus and zebrafish embryos (GeneTools). MO sequences (start codon underlined) for Xenopus were: GCGCATCACCCAAGCGGAGGGAGAT (IncaA MO), ATGCGATTTGTGCATCACCCAAGCG (IncaB MO), CAGACAAGCGCAATGGTGCCCGG (IncaA MO2) and AGATGAGACTGGCGCAATGGTCCCC (IncaB MO2). A MO containing five mismatched base pairs from the IncaA MO was used as a control (GCcCATgACCgAAGCGGAGcGAcAT; mismatched nucleotides in lowercase). MOs were injected into one or two blastomeres at the two-cell stage, along with 200 pg lacZ mRNA as a lineage tracer when a single blastomere was injected. The total in all cases was 10 ng of each MO. To assay MO effectiveness in Xenopus, plasmids containing the MO binding site and N-terminus of IncaA (base pairs -30 to +948) and IncaB (base pairs -21 to +402) fused to the N-terminus of GFP were co-injected with MOs into one- and two-cell stage Xenopus embryos. Zebrafish embryos were injected with 10 ng of MO (5'-TGCAGACACAACATTATTCTTAATA-3') at the one- and two-cell stage.

In situ hybridization, Alcian Blue staining and TUNEL staining
Whole-mount in situ hybridization was performed as described previously in Xenopus (Harland, 1991Go), zebrafish (Thisse et al., 1993Go) and mouse (Saga et al., 1996Go). Digoxigenin-labeled antisense probes used for Xenopus were IncaA, Tfap2a (Winning et al., 1991Go), Slug (Mayor et al., 1995Go), Sox2 (Mizuseki et al., 1998Go), Sox9 (Spokony et al., 2002Go), Sox10 (Aoki et al., 2003Go) and Dlx2 (Papalopulu and Kintner, 1993Go), and for zebrafish inca1 (GenBank Accession Number, CK018555). Embryo sections in JB4 followed manufacturer instructions (Polysciences). Alcian Blue cartilage staining was performed as described previously (Pasqualetti et al., 2000Go). The TUNEL assay was performed on whole-mount embryos as described (Hensey and Gautier, 1998Go), except that epidermis was manually removed from tadpoles after fixation to facilitate reagent penetration.

Interaction of Xenopus Inca and PAK5 in yeast
The mouse Inca ORF was used as bait in a two-hybrid screen with a mouse E11-stage cDNA library according to manufacturer instructions (MatchmakerTM Two-Hybrid System; Clontech). Xenopus Inca and PAK5 ORFs were also cloned into pGBKT7 and pGADT7, respectively. Yeast transformation was performed using standard procedures.

Immunoprecipitation and western blotting
HEK293 cells and CHO cells were transiently transfected with the indicated plasmids using Lipofectamine 2000 (Invitrogen). For coimmunoprecipitation, 24 hours after transfection, cells were lysed in lysis buffer [50 mM Tris pH 7.4, 150 mM NaCl, 1% Nonidet P-40 (NP40) with protease inhibitors (Roche)]. The lysates were incubated with a monoclonal antibody for a Myc-epitope (9E-10; Santa Cruz) for 2 hours, followed by protein-G Sepharose beads (Sigma) for another 2 hours at 4°C. The beads were washed three times in lysis buffer and analyzed by western blotting. To immunoprecipitate Inca protein from non-transfected Xenopus A6 cells, a rabbit antibody to the IncaA peptide DLPSDVSPGSCGQRGLE conjugated to keyhole limpet hemocyanin was produced by Open Biosystems. Preimmune serum from the immunized rabbit was used as a negative control. Xenopus PAK5 antibody was a generous gift from N. Morin. Additional antibodies used were anti-phospho-Ser474-PAK4 (Cell Signaling Technology), anti-FLAG (Sigma) and anti-GFP (Sigma). Appropriate secondary antibodies were detected by enhanced chemiluminescence (Pierce).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tfap2a regulates Inca in developing NC
Inca expression is strongly activated in Xenopus animal caps by a hormone-inducible Tfap2a (GR-AP2) (Luo et al., 2002Go). Animal caps isolated from embryos injected with a mixture of Chd (5 ng RNA per embryo), Wnt3a (250 pg per embryo) and GR-AP2 (600 pg RNA per embryo) differentiate as posterior neural plate if left alone, but form NC if dexamethasone is added during blastula stages (Luo et al., 2005Go). This upregulates expression of the NC marker Sox9 (Spokony et al., 2002Go) and reduces expression of the neural plate marker Sox2 (Mizuseki et al., 1998Go) (Fig. 1A). Inca expression is also strongly induced by dexamethasone. Note that there is a significant level of Inca expression in uninjected animal caps that form epidermis.

Inca cannot be assigned to a tentative gene family or function based on its protein sequence, but is the founding member of a group of Inca-related proteins conserved across vertebrates, including fish, frog, mouse and human. Sequence conservation averages 35-40% across species, and clusters near the proteins' center, including one highly conserved domain of 38 residues, the `inca-box' (Fig. 1B). Incas also contain a highly conserved binding site for the scaffolding protein 14-3-3 (Muslin et al., 1996Go), located immediately upstream of the inca-box; however, preliminary evidence suggests that this site is not required for its activity in overexpression assays (see below; data not shown). Of two Inca-related genes in zebrafish, closely linked on chromosome 11, inca1 resembles Xenopus Inca slightly more than inca2 (Fig. 1C). In addition to one clear Inca ortholog in mouse (chromosome 9) and human (chromosome 3), another distantly related gene exists in fish (chromosome 8), frogs and mammals (mouse chromosome 3; human chromosome 1), with unknown function.

Fish, frog and mouse Inca orthologs have similar expression patterns during embryogenesis. Xenopus Inca expression begins shortly after midblastula transition (stage 9; Fig. 2A) and becomes localized to deep mesodermal cells and the inner, sensorial ectoderm layer during gastrulation (Fig. 2B). During neurulation, expression becomes restricted to notochord, epidermis and NC cells but is excluded from the neural plate or neural tube at later stages (Fig. 2C). Expression persists in NC cells during their migration into the pharyngeal arches (Fig. 2D-G), where it is confined to NC-derived head mesenchyme (Fig. 2F,G) (Hausen and Riebesell, 1991Go). By early tadpole stages, Inca is expressed in cranial ganglia and in the dorsal eye vesicle in addition to pharyngeal arch mesenchyme (Fig. 2H). Similarly, in zebrafish, inca1 expression is zygotic and restricted to early ectoderm and notochord during gastrulation, as well as later in the premigratory and migrating cranial NC (Fig. 2I-N). Expression persists in the pharyngeal arches, ventral forebrain, pituitary and olfactory epithelia. Expression was also seen in the hypochord and ventral somites at this time point (data not shown). Mouse Inca transcripts also localize to pharyngeal arch NC (E9.5; Fig. 2O), and to the limb buds and somites by E11.5 (Fig. 2P). Northern blot analysis of mouse tissue RNAs reveal essentially ubiquitous Inca expression in the adult, with particularly high levels in heart (Fig. 2Q). Thus, Inca orthologs all show conserved expression in cranial NC at early stages that require Tfap2a function.


Figure 1
View larger version (37K):
[in this window]
[in a new window]

 
Fig. 1. Inca is a novel Tfap2a target in the NC. (A) Animal caps were injected with Wnt3a, Chd and GR-AP2a mRNA, treated with 10 µM dexamethasone (DEX+) or solvent alone (DEX-), and subjected to northern blot analysis using probes as indicated, with 18S rRNA as a loading control. UI, uninjected. (B) Predicted protein sequence alignment for Xenopus (X), zebrafish (Z), mouse (M) and human (H) Incas. Identical residues are shaded. The conserved 38-residue inca-box is underlined, and the 14-3-3 binding site is indicated with star underline. (C) Dendrogram generated using ClustalW (http://clustalw.genome.jp). Accession Numbers are: Xenopus IncaA, BJ092564. Mouse, AK076092. Human, NM_203370. Zebrafish inca1, CK018555; inca2, BM071087. Human Inca-r, BC031558. Mouse Inca-r, NM_175398. Zebrafish inca-r, BI885065. Xenopus (tropicalis) Inca-r, CR761080. chr, chromosome number.

 
To determine whether Tfap2a is necessary and sufficient to activate Inca expression, animal caps were isolated from Xenopus embryos injected with one of three combinations of RNAs encoding: (1) Chd (at a dose lower than that of Fig. 1A) to trigger neural induction, (2) a mixture of Chd and Wnt3a at concentrations that induce NC, or (3) Chd, Wnt3a and a truncated, dominant negative Tfap2a (dnTfap2a) (Luo et al., 2002Go). Neural induction with Chd inhibited Inca expression compared with baseline levels in uninjected animal caps (which differentiate into epidermis), consistent with the lack of Inca expression in the neural plate in intact embryos (Fig. 3A). By contrast, NC induction by Chd+Wnt3a strongly activated Inca expression, which was blocked by co-injection of dnTfap2a. A similar but less severe effect was observed in zebrafish lockjaw (low) mutants, which lack a functional Tfap2a and demonstrated reduced inca1 expression. low mutants have defects in the NC-derived craniofacial skeleton and pigmentation (Knight et al., 2003Go). This correlates with reduced inca1 expression at the 10-somite stage in premigratory NC (Fig. 3B-F) and at 36 hpf (Fig. 3D,G).

Conserved requirements for Inca in NC development
To investigate the developmental requirements for Inca, MOs were designed to inhibit translation in both Xenopus and zebrafish embryos. These gave similar phenotypes. Two pseudoallelic Inca mRNAs in Xenopus laevis required two Inca MOs, designated IncaA MO and IncaB (GenBank Accession Number, DQ993180) MO. Injection of 10 ng per embryo of either MO efficiently blocked expression of synthetic mRNAs containing the cognate MO-binding sites fused to enhanced GFP (eGFP), whereas a mismatched IncaA control MO did not interfere with either fusion protein (Fig. 4A). Injection of IncaA or IncaB MOs (20 ng per embryo) individually had only a slight effect on 10-15% of embryos (n=83 and n=79, respectively; Fig. 4P), whereas combining the two MOs (10 ng per embryo of each MO) resulted in a severe phenotype in 98% of embryos (Fig. 4P; n=156). This allows us to rule out the possibility of artifacts owing to MO toxicity. All subsequent experiments combined the IncaA and IncaB MOs at equal concentration (Inca MO). Xenopus embryos injected into both cells at the two-cell stage with a total of 20 ng of Inca MO gastrulated normally, but formed smaller heads with periocular swelling by late tadpole stages. Melanocytes, which are NC-derived, were only slightly reduced (stage 45-47; Fig. 4B-E), but later MO-injected larvae had dramatic reductions in all NC-derived craniofacial cartilages (Sadaghiani and Thiebaud, 1987Go) (Fig. 4F,G). These defects were not simply due to a general developmental delay, because other structures, particularly in the trunk region, developed normally in morphants. In addition, two distinct Inca MOs (IncaA MO2 and IncaB MO2) that recognize non-overlapping target sequences yielded indistinguishable phenotypes (Fig. 4H,I). Injection of an inca1 MO into zebrafish caused a very similar, dose-dependent reduction in head size (Fig. 4J,K), as well as cranial cartilage formation in the pharyngeal arches (Fig. 4L,M) and neurocranium (Fig. 4N,O).


Figure 2
View larger version (97K):
[in this window]
[in a new window]

 
Fig. 2. Expression patterns in Xenopus, zebrafish and mouse embryos. (A) Developmental northern blot of Xenopus Inca, with 18S RNA as a loading control. Nieuwkoop-Faber stages are indicated. (B-H) Whole-mount in situ hybridization for Inca in Xenopus embryos at stages 10.5-32. (B) Stage 10.5, sagittal section. d, dorsal. v, ventral. (C) Stage 14, dorsal view of expression in cranial NC (nc) and notochord (n). a, anterior. p, posterior. (D) Stage 19, dorsal view of expression in cranial NC migration streams, labeled as 1-3. (E) Stage 25, lateral view; arrowheads indicate approximate section levels in F and G. NC migration streams into pharyngeal arches 1-3 as indicated. (F,G) Transverse sections of embryo in E show Inca expression in head mesenchyme (hm) and NC (nc). (H) Stage 32, lateral view of the head. White and red arrowheads indicate expression in trigeminal ganglion and eye, respectively. (I-N) Whole-mount in situ hybridization for inca1 in zebrafish embryos. (I) 6 hpf, lateral view, dorsal to the right. Expression is restricted away from the margin (arrows), in future ectoderm (ecto). (J) 8 hpf, dorsal view. noto, notochord. (K,L) 13 hpf, lateral and dorsal views, respectively, of inca1 expression in premigratory NC. Numbers indicate presumptive pharyngeal arches 1-3. (M,N) 36 hpf, dorsal and face-on views, showing expression in the pharyngeal arches (1,2), diencephalon (di), pituitary (pi) and olfactory epithelia (oe). (O,P) Inca expression in mouse embryos at E9.5 (O) and E11.5 (P) in pharyngeal arches (numbered 1-3), somites (s) and fore-limb (fl) and hind-limb buds (hl). (Q) Northern analysis of adult mouse tissue RNAs probed with Inca and beta-actin as control. Scale bars: 500 µm in O; 1 mm in P.

 
To determine which NC cells require Inca and at what stages, we examined molecular markers of premigratory and migrating NC in MO-injected frog and fish embryos. Injection of 20 ng Inca MO into one cell at the two-cell stage caused no defects in expression of neural, epidermal or NC markers at early neurula stages (Fig. 5A-D) or in markers of migrating cranial NC at tailbud stages (data not shown). Both Dlx2 and Sox9 expression appeared slightly reduced as late as stage 32 (Fig. 5E-H). Nevertheless, cartilage development was severely impaired on the injected side (Fig. 5I). Similarly, Inca morphant zebrafish displayed mild reductions in expression of dlx2 and sox9a at 24 hpf, but severe reductions in the pharyngeal arches by 48 hpf (data not shown). These results suggest that cranial NC cells deficient in Inca form and migrate normally but fail to differentiate. TUNEL assays detected no differences in numbers of apoptotic cells in Inca MO and control MO-injected embryos at tailbud stages (Fig. 5K,L), but a significant increase by early tadpole stages, primarily in the eye and epidermis (Fig. 5M,N). By late tadpole stages, TUNEL signal was also detected in the jaw and dorsal cranium (Fig. 5O-R). All of these tissues derive from regions of earlier Inca expression (see Fig. 2).

These results in both fish and frog suggest that Inca is not required for NC induction or early migration, but later in cranial NC cells that form the head skeleton. To investigate requirements for Inca in NC morphogenesis at these later stages, we injected the inca1 MO into transgenic zebrafish that express eGFP under control of 5 kb of the sox10 promoter (sox10:egfp), and used confocal microscopy to follow NC behaviors (Wada et al., 2005Go). Similar to inca1, sox10:egfp expression begins in premigratory cranial NC adjacent to the hindbrain during early somitogenesis, and persists in migrating NC cells (Fig. 5S,U), and craniofacial cartilage in the larvae (Fig. 5W,Y). With injection of 10 ng inca1 MO per embryo, NC cells migrated into the pharyngeal arches (Fig. 5T,V) but failed to condense and extend anteriorly to form normal cartilage (Fig. 5X,Z). These results demonstrate conserved requirements for Inca in NC cells after they migrate.


Figure 3
View larger version (51K):
[in this window]
[in a new window]

 
Fig. 3. Inca expression in NC depends on Tfap2a. (A) Northern analysis of animal cap RNA from embryos injected with Chd, Chd+Wnt3a, or Chd+Wnt3a+dnTfap2a (Chd+Wnt+{Delta}AD) and probed for Xenopus Inca, with 18S rRNA as a loading control. Expression induced by Chd+Wnt is blocked by dnTfap2a. (B-G) Whole-mount in situ hybridizations showing zebrafish inca1 expression in wild type (B-D) and low mutants (E-G). B,E are lateral views and C,F dorsal views at the 10-somite stage. D,G are lateral views at 36 hpf. inca1 expression is reduced at 10 somites and 36 hpf. Numbers indicate presumptive pharyngeal arches. oe, olfactory epithelia.

 
Inca interacts with PAK5
Because Inca shows no sequence similarity to other gene families, we performed a yeast two-hybrid screen to identify potential binding partners that might link Inca to one or more cellular processes. Mouse Inca was used to screen a library of cDNAs from mouse embryos at E11, when Inca is abundantly expressed. Among several candidates, we repeatedly isolated the p21-activated kinase 4 (PAK4). Several truncated cDNAs isolated in this screen indicate that Inca binds to the C-terminal half of PAK4, which contains the kinase domain. Xenopus PAK5, a close relative of mammalian PAK4 (Cau et al., 2001Go), was similarly cotransfected into yeast with Xenopus Inca, and this also allowed robust growth on selective media, indicating similar physical interactions between Inca and PAK4/5 conserved from frog to mouse (Fig. 6A). This interaction was independently confirmed by co-immunoprecipitation (co-IP) of epitope-tagged Xenopus Inca and PAK5 co-expressed in HEK293 cells (Fig. 6B).

Both the two-hybrid and co-IP experiments involve expressing exogenous Inca and PAK4/5 at levels that may exceed physiologically meaningful concentrations, allowing spurious binding. To address this issue, antiserum directed against a synthetic peptide from Xenopus Inca and shown by western blotting to be specific for this protein (Fig. 6C), along with preimmune serum as a negative control, were used to immunoprecipitate proteins from an extract of Xenopus A6 cells, which express both PAK5 and Inca. Western blotting using an antibody for Xenopus PAK5 showed that endogenous Inca protein will co-IP with PAK5 (Fig. 6D). Therefore, Inca and PAK5 naturally exist as a complex in untransfected Xenopus cells.

PAK proteins are effectors of the Rho GTPases Rac1 and Cdc42, and have been implicated in control of cytoskeletal dynamics, including microfilament and microtubule polymerization and stability (Bokoch, 2003Go; Jaffer and Chernoff, 2002Go). PAK5 interacts with both microfilaments and microtubules in the Xenopus embryo, and interference with PAK5 function affects cell adhesion and convergent extension movements, both of which depend upon cytoskeletal integrity and Rho GTPase signaling (Faure et al., 2005Go; Kofron et al., 2002Go; Wunnenberg-Stapleton et al., 1999Go). To determine whether the Inca-PAK5 complex is also associated with the cytoskeleton, CHO cells were transiently cotransfected with Inca fused to GFP and PAK5 fused to red fluorescent protein (RFP) and observed with a confocal microscope. As shown in Fig. 6E, Inca and PAK5 colocalized in punctate bodies and fibers. Some of the endogenous PAK5 distribution pattern is in similar punctate bodies (Cau et al., 2001Go), but could also be due in part to overexpression artifacts. The fibers are likely to be microtubules, because they are sensitive to nocodazole (Fig. 6F).

Ectopic expression of Inca modifies cytoarchitecture
To determine whether misexpression of Inca outside of its normal domains in the NC and epidermis can alter cellular morphogenesis, synthetic IncaA mRNA was injected into Xenopus embryos at the one-cell stage. This disrupted body shape, including a shortened anteroposterior axis, open neural tube and multiple tissue protrusions (Fig. 7A,B). At blastula stages, pigment granules in individual blastomeres of Inca-injected embryos redistributed to the cell periphery, accenting cell-cell boundaries (Fig. 7C,D). These changes suggest a disruption in the cortical actin cytoskeleton in which these granules are embedded.

Inca misexpression also disrupted another process highly dependent on cytoskeletal rearrangements in Xenopus, wound healing. In low to moderate salt concentrations, an embryo from which an ectodermal explant was excised (vegetal explant) healed within approximately 15-20 minutes. This involves changes in cell movements and adhesion that depend on Rho GTPase signaling, plakoglobin and other components (Davidson et al., 2002Go; Kofron et al., 2002Go; Tao et al., 2005Go). Vegetal explants from embryos injected with Inca mRNA healed much more slowly and to a lesser extent than uninjected controls (Fig. 7E,F). Healing explants normally formed a `purse string' of actin filaments at the edge of the wound a few minutes after excision from the blastula (Merriam and Christensen, 1983Go), which is under the control of the Rho GTPases Rac1 (Brock et al., 1996Go) or Cdc42 (Kofron et al., 2002Go). Phalloidin staining never detected purse-string structures in explants from embryos injected with Inca mRNA (Fig. 7G,H). Thus, ectopic Inca in the blastula disrupts multiple cell behaviors dependent on rearrangements of cortical actin.


Figure 4
View larger version (87K):
[in this window]
[in a new window]

 
Fig. 4. Inca is required to form the NC-derived head skeleton in both frog and fish. (A) Western blot analysis showing that Xenopus Inca MOs efficiently inhibit translation of injected Inca-GFP mRNA. (B-I) Stage 45 Xenopus tadpoles injected with control MO (B,D,F) or Inca MO (C,E,G) and shown in dorsal (B,C) and ventral (D-I) views either live (B-E) or stained with Alcian Blue for cartilage (F-I). Similar results were obtained with two independent, non-overlapping sets of Inca MOs (H, 20 ng control MO; I, 20 ng IncaA MO2+IncaB MO2). (J-O) 5-day-old control zebrafish larvae (J,L,N) or inca1 MO morphants (K,M,O) shown live in lateral view (J,K) or Alcian Blue-stained in ventral view (L-O). All cartilage elements are reduced by Inca knockdown in both species. ba, basihyal; br, branchial/gills; cb, ceratobranchial; ch, ceratohyal; ep, ethmoid plate; hs, hyosymplectic; m, Meckel's; nc, notochord; pq, palatoquadrate; t, trabeculae. (P) Frequency of head cartilage phenotype with Xenopus IncaA MO or IncaB MO alone or combined IncaA+IncaB, and Zebrafish inca1-MO injected embryos.

 
To test possible roles for Inca-PAK5 interactions in wound healing, RNAs encoding Inca, and PAK5, as well as a kinase-dead form of PAK5 (PAK5/KR) and a constitutively active form (PAK5/EN), all as eGFP fusions (Cau et al., 2001Go), were injected individually and in combination into Xenopus embryos. Vegetal explants derived from these embryos were cultured for 25 minutes and examined for wound closure. Whereas expression of Inca inhibited healing (Fig. 7M), wild-type PAK5 and PAK5/KR injections had minimal effects (Fig. 7J,K). PAK5/EN injections resulted in some inhibition (Fig. 7L), but less than observed with Inca. By contrast, when Inca and wild-type PAK5 were co-injected, there was a dramatic failure of wounds to heal, accompanied by extensive loss of cell adhesion (Fig. 7N). This effect depended upon the kinase activity of PAK5, because co-injection of Inca and PAK5/KR had a much weaker effect compared with co-injection of Inca and wild-type PAK5 (Fig. 7O). Inca- and PAK5-eGFP fusions allowed simultaneous monitoring of protein levels using anti-GFP antibody (Fig. 7P). PAK5 protein levels were comparable, as were the Inca levels, but in significant molar excess over Inca. The contrast in phenotype between PAK5/EN and PAK5 overexpression with Inca suggests that the PAK-Inca synergism is not because of activation of the PAK5 kinase by Inca. Further evidence for this is that Inca-PAK5 interaction does not enhance PAK5 kinase activity in cotransfected HEK293 cells (Fig. 7Q). PAK5 expression is widespread during early and late development, overlapping with Inca, so both proteins are likely to be present in NC from early stages onward (Fig. 7R). These results indicate that the interaction of Inca and PAK5 has profound effects on adhesive and cytoskeletal functions.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In view of the essential functions of Tfap2a in embryonic vertebrate development, it is important to identify genes that lie downstream from this transcriptional activator. Using a microarray screen based on inducible Tfap2a (Luo et al., 2005Go), we have identified a novel protein, Inca, required for NC development in both Xenopus and zebrafish. Inca interacts with PAK5 to control cytoskeletal rearrangements in the early embryo. Our results lead us to propose that Inca-PAK5 interactions mediate Tfap2a-dependent NC cell behaviors at least in part by regulating their cytoskeleton.

Our screen for Tfap2a targets has also yielded a novel protocadherin, named PCNS, that is required for NC migration (Rangarajan et al., 2006Go), and a surprisingly high proportion of epidermal genes also expressed in the NC (Luo et al., 2005Go). From these results and earlier work, a picture emerges in which Tfap2a mediates BMP signaling, functioning in concert with and downstream of other transcription factors that initiate NC and epidermal specification. In the case of cranial NC, however, Tfap2a appears more important as an early regulator of other `effector' genes that control cell specification and terminal differentiation (Meulemans and Bronner-Fraser, 2004Go). In the NC, these include Tfap2a-dependent genes such as Inca, PCNS, Hoxa2 and C-kit, all of which may control certain aspects of cellular morphogenesis. For example, suppression of both TFAP2A and C-KIT in humans correlates with an invasive, metastatic melanoma phenotype (Huang et al., 1998Go).


Figure 5
View larger version (87K):
[in this window]
[in a new window]

 
Fig. 5. Inca is required for cranial NC specification and survival after migration into the arches in Xenopus and zebrafish. Embryos were co-injected into one cell at the two-cell stage with Inca MO, together with lacZ RNA as a lineage tracer and assayed for gene expression by whole-mount in situ hybridization at stage 14 (A-D, injected sides are on the left) and stage 32 (E-H; E,G, injected sides) with probes indicated in the panels. In no case was any change in gene expression observed on the injected side [(A) Slug, n=83; (B) Sox9, n=42; (C) Sox2, n=47; (D) AP2a, n=54; (E) Dlx2, n=63; (G) Sox9, n=78]. At tadpole stage, cranial cartilage was eliminated on the injected side (left side in I). Control MO injection had no effect (J). (K-R) TUNEL staining of embryos injected with control MO (K,M,O) or Inca MO (L,N,P-R), cultured to stage 21 (K,L), stage 30 (M,N) or stage 45 (O-R). Q and R are dorsal and ventral views, respectively, of the tadpole shown in P. Black arrowheads indicate strong TUNEL signal in neurocranium (Q) and jaw cartilage (R). (S-Z) Confocal images of sox10:egfp expression in cranial NC cells of controls (S,U,W,Y) and inca1 morphants (T,V,X,Z). Lateral views, anterior to the left. Stages are indicated in the panels. First and second pharyngeal arches are indicated in S,T, and derived cartilage elements by arrowheads in Y,Z. Asterisks indicate expression of sox10:eGFP in the otic vesicle.

 
Inca regulates craniofacial cartilage morphogenesis
Knockdown of Inca expression with morpholinos has equivalent endpoints - craniofacial cartilage hypoplasia - in both Xenopus and zebrafish embryos. Controls strongly argue against MO toxicity or off-target effects. Inca morphants show no defects in gene expression during NC induction or early migration, but only later as chondrocytes differentiate. In zebrafish, chondrocyte precursors in the NC condense into cartilage primordia and then stack into linear arrays (Kimmel et al., 2001Go). Our analysis of sox10:egfp has revealed that NC cells migrate into the arches successfully in Inca morphants but fail to condense or organize into stacks, and eventually begin to undergo apoptosis.

Given the early requirements for Tfap2a in NC and the early NC expression of Inca, this relatively late phenotype is unexpected. The skeletal defects seen in low embryos are not as severe as in inca1-morphants, which is consistent with the observed reduction, but not complete loss, of inca1 expression in NC cells that form craniofacial cartilage in low embryos. We argue that the relatively late phenotype reflects requirements for Inca in cytoskeletal regulation in NC cells later in migration. Although morphants may retain some low-level Inca expression masking a complete null phenotype, we have injected much higher doses of Inca MO in Xenopus embryos (up to 80 ng per embryo; data not shown), which gives an identical phenotype. Alternatively, Inca could share redundant functions with other proteins during early NC formation and migration. Vertebrates have an Inca-related gene (Inca-r), but our preliminary analyses suggest that this gene is not expressed in early development (data not shown).

Defects in NC morphogenesis in the absence of Inca function coincide with elevated cell death in tissues that express Inca, including the eye, the epidermis and the NC. By the tadpole stage, cartilage cells become TUNEL+, suggesting that they undergo apoptosis when they would normally differentiate as chondrocytes. PAK4, the mammalian homolog of Xenopus PAK5, can inhibit apoptosis, for example by blocking caspase action (Gnesutta et al., 2001Go). PAK4 also plays an important role in cell survival (Li and Minden, 2005Go). Thus, elevated cell death in Inca morphants may result, in part, from interference with PAK5 function.

Inca modulates cytoskeletal dynamics in association with PAK5
Ectopic overexpression of Inca causes defects in Xenopus blastula-stage embryos that occur much earlier than the loss-of-function phenotypes, probably because of disruption of the microfilament cytoskeleton. Cortical pigment becomes redistributed away from the apical surface of Inca-injected blastomeres. These pigment granules depend specifically on F-actin, as shown by treatment with cytochalasin B, and show no response to anti-microtubule drugs such as taxol or nocodazole (Moreau et al., 1999Go). The Inca-induced pigment redistribution resembles embryos overexpressing FRIED, a protein tyrosine phosphatase that interacts with Frizzled-8 (Itoh et al., 2005Go). Activated GTPase Rac1 rescues effects of FRIED overexpression, consistent with the hypothesis that this restores cortical actin organization. Likewise, ectodermal wound healing in Xenopus embryos depends on restructuring of the cortical actin cytoskeleton. This is regulated by the small GTPase Cdc42 (Kofron et al., 2002Go), and Inca overexpression interferes with assembly of the actin purse-string around wounds. These results suggest that Inca might be involved in the regulation of the Rho GTPase signaling pathway.


Figure 6
View larger version (56K):
[in this window]
[in a new window]

 
Fig. 6. Inca interacts with PAK5. (A) Selective medium streaks of yeast cells expressing Xenopus Inca and PAK5, either alone or together, as indicated. Inca+PAK5 allows growth on medium lacking leucine, tryptophan, histidine and adenine. Positive controls include transfection with vectors containing T antigen and p53 (Clontech). Streaks on -leu/-trp (lower panel) shown as a control for transfection. (B) Extracts prepared from HEK293 cells transfected with expression plasmids encoding a PAK5-GFP fusion or a Myc epitope-tagged Inca separately or together, immunoprecipitated with anti-Myc, followed by western blot with antibody for GFP or Myc. Lanes labeled as total are from lysates prior to immunoprecipitation. PAK5-GFP precipitates with the anti-Myc antibody, but only when Myc-tagged Inca is present in the extract. (C) Anti-IncaA peptide antibody specificity. Fertilized eggs were injected with 1 ng of synthetic mRNA encoding XInca-GFP, and cultured to stage 20. Detergent (1% NP40)-solubilized protein was extracted with 1,1,2-trichlorotrifluoroethane (Freon) to remove yolk and the equivalent of two embryos analyzed by SDS-PAGE/western blot. Both anti-GFP and anti-Inca recognized a single band of the correct molecular weight (~63 kDa). (D) Extract from untransfected Xenopus A6 cells immunoprecipitated with preimmune serum or anti-Inca, followed by western blot using antiserum raised against PAK5 (residues 122-224, a generous gift of N. Morin). Immunoprecipitation with anti-Inca enriches the PAK5 signal several-fold compared with preimmune serum, indicating Inca-PAK5 interaction. (E) Fluorescent images of a CHO cell cotransfected with plasmids encoding a PAK5-RFP fusion and Xenopus Inca-GFP fusion showing extensive overlap. (F) Fibrous structures positive for Inca and PAK5 are nocodazole-sensitive. CHO cells transiently transfected with PAK5-RFP and XInca-GFP were treated for 1 hour with 3 ng/ml nocodazole (Sigma), then fixed with methanol and photographed using an inverted fluorescence microscope. The fibers visible without nocodazole treatment (E) have disappeared.

 
The PAKs are serine-threonine protein kinases that associate with Rac and Cdc42. Xenopus PAK5 is expressed maternally and, by the gastrula stages, expression overlaps that of Inca in the ectoderm, although it is not restricted to the inner, sensorial layer (Faure et al., 2005Go). At later stages, PAK5 expression appears ubiquitous (Fig. 7R). Our results suggest that the tissue-specific distribution of Inca and PAK5, particularly their co-expression in ectoderm, has a significant impact on cytoskeletal organization.

PAK5 localizes to microtubules and actin filaments, in patterns that shift during the cell cycle and do not depend on kinase activity. Constitutive activation of PAK5 prevents its interactions with microtubules (Cau et al., 2001Go). However, PAK5 kinase activity plays an essential role in early Xenopus gastrulation, because overexpression of a kinase-dead mutant form (PAK5/KR) acts as a dominant negative to inhibit convergent extension movements in dorsal mesoderm (Faure et al., 2005Go). PAK5/KR overexpression also enhances calcium-dependent adhesion of ectodermal cells, whereas a constitutively active kinase reduces adhesion. Inca synergizes with an intact PAK5 to disrupt wound healing and cell adhesion when overexpressed in Xenopus embryos. PAK5/KR shows no synergy, suggesting that this interaction requires kinase activity (Fig. 7). However, Inca does not activate the PAK5 kinase, because co-expression of Xenopus Inca and PAK5 in mammalian cells does not increase phosphorylation of the regulatory Ser533 residue (Fig. 7Q). Furthermore, overexpression of constitutively active PAK5 does not mimic combined overexpression of Inca and wild-type PAK5. This suggests the possibility that kinase targets for PAK5 may exist in microtubule or microfilament cytoskeletal components that are only accessible when Inca is associated with the kinase. In other words, Inca might provide a mechanism for regulation of PAK5, which, like other Class II PAKs (PAK 4-6), binds to Cdc42 or Rac1 but is not catalytically activated by this association.


Figure 7
View larger version (92K):
[in this window]
[in a new window]

 
Fig. 7. Inca misexpression disrupts gastrulation, pigmentation and wound healing in Xenopus. (A) Uninjected stage 25 control embryo. (B) Siblings injected with 250 pg IncaA mRNA have shorter body axes and numerous protuberances. (C,D) High-magnification views of ectoderm at stage 8 from uninjected (C) and IncaA mRNA-injected (250 pg; D) embryos showing relocation of cortical pigment to the cell periphery. Scale bar: 100 µm. (E,F) Vegetal explants after animal cap removal and culture for 5 (E) or 25 (F) minutes in 0.3xMMR. Upper row, uninjected; lower row injected with 250 pg IncaA mRNA, showing delayed healing. (G,H) Confocal z-stack images of animal caps from uninjected (G) and IncaA mRNA-injected (H) embryos after 5 minutes of healing in 0.3xMMR. White arrowheads in G indicate purse-string actin-filament structures missing in embryos overexpressing Inca. (I-O) Synergistic effect on wound healing of PAK5 and Inca. Embryos injected with mRNA encoding wild-type PAK5-GFP (J), kinase-dead PAK5-GFP (PAK5/KR; K), constitutively active PAK5-GFP (PAK5/EN; L), IncaA-GFP (M), a mixture of IncaA-GFP and PAK5-GFP (N) or a mixture of IncaA-GFP and PAK5/KR-GFP (O). All PAK5-GFP mRNAs injected at 1 ng, IncaA-GFP mRNA at 250 pg. Vegetal explants were allowed to heal for 25 minutes. Combining Inca+wild-type PAK5 greatly delays wound healing and leads to dissociation (N). PAK5/KR does not exhibit this synergistic effect (O). (I) Uninjected control embryo. Results from these experiments are summarized in Table 1. (P) PAK5-GFP mRNAs were equally translated, as judged by western blot using antibody to GFP. (Q) Co-expression with Inca does not increase PAK5 phosphorylation. Western blots of extracts made from HEK293 cells transfected with 0.5 µg FLAG-tagged XPAK5 plasmid and 0, 0.5 or 1.0 µg of Myc-tagged Xenopus Inca. The ratio of total XPAK5 signal (FLAG antibody) to the level of phosphorylation of regulatory serine residue 474 (phospho-PAK4) was not significantly different in any of the samples. (R) Xenopus PAK5 expression. Whole-mount in situ hybridization at stages 10, 13 and 25. Stage 10 embryos were bisected in the sagittal plane prior to hybridization. PAK5 expression is broad in ectoderm and mesoderm at early stages and essentially ubiquitous later in development.

 


View this table:
[in this window]
[in a new window]

 
Table 1. Summary of data from Fig. 7

 
Interactions of Inca with PAK5 and the cytoskeleton may also help explain why Inca morphants have defects in NC morphogenesis. Requirements for PAK4/5 in later embryogenesis remains unclear because dominant-negative PAK5 in Xenopus disrupts gastrulation (Faure et al., 2005Go), and the mouse PAK4 knockout dies by E11.5 (Qu et al., 2003Go). However, PAK5 modifies cytoskeletal architecture and physically associates with Inca, and both proteins are co-expressed in Xenopus NC cells. The rearrangement of NC cells from the pharyngeal arches into linear arrays that extend anteriorly prior to cartilage differentiation (Kimmel et al., 2001Go) resemble the convergent extension movements that depend on PAK5 (Faure et al., 2005Go) and Rho GTPases during gastrulation (for a review, see Nikolaidou and Barrett, 2005Go). It is attractive to hypothesize that skeletogenic NC cells require Inca to control PAK5-dependent cytoskeletal restructuring and NC cell behaviors that are essential for proper craniofacial morphogenesis.


    ACKNOWLEDGMENTS
 
Special thanks to Nathalie Morin for generously providing Xenopus PAK plasmids and antibody, and to Maria Morasso for mouse embryo samples and northern blot. Thanks to Vincent Shram at the NICHD Microscopy and Imaging Core Facility for assistance with Xenopus confocal microscopy. This work was supported in part by the Intramural Research Program of the National Institute of Child Health and Human Development, NIH, and by grants from the NIH (DE-13828, NS-41353) and March of Dimes (1-FY01-198) to T.F.S. T.L.H. was supported by a postdoctoral fellowship from the American Cancer Society.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y. H., Credidio, C. and Saint-Jeannet, J. P. (2003). Sox10 regulates the development of neural crest-derived melanocytes in Xenopus. Dev. Biol. 259,19 -33.[CrossRef][Medline]
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E. W. (2004). Neural crest survival and differentiation in zebrafish depends on mont blanc/tfap2a gene function. Development 131,1463 -1477.[Abstract/Free Full Text]
Bastidas, F., De Calisto, J. and Mayor, R. (2004). Identification of neural crest competence territory: role of Wnt signaling. Dev. Dyn. 229,109 -117.[CrossRef][Medline]
Bokoch, G. M. (2003). Biology of the p21-activated kinases. Annu. Rev. Biochem. 72,743 -781.[CrossRef][Medline]
Brewer, S., Feng, W., Huang, J., Sullivan, S. and Williams, T. (2004). Wnt1-Cre-mediated deletion of AP-2alpha causes multiple neural crest-related defects. Dev. Biol. 267,135 -152.[CrossRef][Medline]
Brock, J., Midwinter, K., Lewis, J. and Martin, P. (1996). Healing of incisional wounds in the embryonic chick wing bud: characterization of the actin purse-string and demonstration of a requirement for Rho activation. J. Cell Biol. 135,1097 -1107.[Abstract/Free Full Text]
Cau, J., Faure, S., Comps, M., Delsert, C. and Morin, N. (2001). A novel p21-activated kinase binds the actin and microtubule networks and induces microtubule stabilization. J. Cell Biol. 155,1029 -1042.[Abstract/Free Full Text]
Davidson, L. A., Ezin, A. M. and Keller, R. (2002). Embryonic wound healing by apical contraction and ingression in Xenopus laevis. Cell Motil. Cytoskeleton 53,163 -176.[CrossRef][Medline]
Duband, J. L. (2006). Neural crest cell delamination and migration: integrating regulations of cell interactions, locomotion, survival and fate. In Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp.45 -71. Georgetown, TX: Landes Bioscience.
Duband, J. L., Monier, F., Delannet, M. and Newgreen, D. (1995). Epithelium-mesenchyme transition during neural crest development. Acta Anat. Basel 154, 63-78.[Medline]
Eckert, D., Buhl, S., Weber, S., Jager, R. and Schorle, H. (2005). The AP-2 family of transcription factors. Genome Biol. 6,246 .[CrossRef][Medline]
Faure, S., Cau, J., de Santa Barbara, P., Bigou, S., Ge, Q., Delsert, C. and Morin, N. (2005). Xenopus p21-activated kinase 5 regulates blastomeres' adhesive properties during convergent extension movements. Dev. Biol. 277,472 -492.[CrossRef][Medline]
Feledy, J. A., Morasso, M. I., Jang, S. I. and Sargent, T. D. (1999). Transcriptional activation by the homeodomain protein distal-less 3. Nucleic Acids Res. 27,764 -770.[Abstract/Free Full Text]
Gnesutta, N., Qu, J. and Minden, A. (2001). The serine/threonine kinase PAK4 prevents caspase activation and protects cells from apoptosis. J. Biol. Chem. 276,14414 -14419.[Abstract/Free Full Text]
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Hausen, P. and Riebesell, M. (1991). The Early Development of Xenopus laevis: An Atlas of the Histology. Berlin, New York: Springer-Verlag.
Hensey, C. and Gautier, J. (1998). Programmed cell death during Xenopus development: a spatio-temporal analysis. Dev. Biol. 203,36 -48.[CrossRef][Medline]
Huang, S., Jean, D., Luca, M., Tainsky, M. A. and Bar-Eli, M. (1998). Loss of AP-2 results in downregulation of c-KIT and enhancement of melanoma tumorigenicity and metastasis. EMBO J. 17,4358 -4369.[CrossRef][Medline]
Huang, X. and Saint-Jeannet, J. P. (2004). Induction of the neural crest and the opportunities of life on the edge. Dev. Biol. 275,1 -11.[CrossRef][Medline]
Itoh, K., Lisovsky, M., Hikasa, H. and Sokol, S. Y. (2005). Reorganization of actin cytoskeleton by FRIED, a Frizzled-8 associated protein tyrosine phosphatase. Dev. Dyn. 234,90 -101.[CrossRef][Medline]
Jaffer, Z. M. and Chernoff, J. (2002). p21-activated kinases: three more join the Pak. Int. J. Biochem. Cell Biol. 34,713 -717.[CrossRef][Medline]
Kimmel, C. B., Miller, C. T. and Keynes, R. J. (2001). Neural crest patterning and the evolution of the jaw. J. Anat. 199,105 -120.[CrossRef][Medline]
Knight, R. D. and Schilling, T. F. (2006). Cranial neural crest and development of the head skeleton. In Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp. 120-133. Georgetown, TX: Landes Bioscience.
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y., Geisler, R., Rauch, G. J. and Schilling, T. F. (2003). lockjaw encodes a zebrafish tfap2a required for early neural crest development. Development 130,5755 -5768.[Abstract/Free Full Text]
Knight, R. D., Javidan, Y., Zhang, T., Nelson, S. and Schilling, T. F. (2005). AP2-dependent signals from the ectoderm regulate craniofacial development in the zebrafish embryo. Development 132,3127 -3138.[Abstract/Free Full Text]
Kofron, M., Heasman, J., Lang, S. A. and Wylie, C. C. (2002). Plakoglobin is required for maintenance of the cortical actin skeleton in early Xenopus embryos and for cdc42-mediated wound healing. J. Cell Biol. 158,695 -708.[Abstract/Free Full Text]
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two-signal model. Development 125,2403 -2414.[Abstract]
Le Douarin, N. and Kalcheim, C. (1999). The Neural Crest. London: Cambridge University Press.
Li, X. and Minden, A. (2005). PAK4 functions in tumor necrosis factor (TNF) alpha-induced survival pathways by facilitating TRADD binding to the TNF receptor. J. Biol. Chem. 280,41192 -41200.[Abstract/Free Full Text]
Lloyd, B., Tao, Q., Lang, S. and Wylie, C. (2005). Lysophosphatidic acid signaling controls cortical actin assembly and cytoarchitecture in Xenopus embryos. Development 132,805 -816.[Abstract/Free Full Text]
Luo, T., Matsuo-Takasaki, M., Thomas, M. L., Weeks, D. L. and Sargent, T. D. (2002). Transcription factor AP-2 is an essential and direct regulator of epidermal development in Xenopus. Dev. Biol. 245,136 -144.[CrossRef][Medline]
Luo, T., Lee, Y. H., Saint-Jeannet, J. P. and Sargent, T. D. (2003). Induction of neural crest in Xenopus by transcription factor AP2alpha. Proc. Natl. Acad. Sci. USA 100,532 -537.[Abstract/Free Full Text]
Luo, T., Zhang, Y., Khadka, D., Rangarajan, J., Cho, K. W. and Sargent, T. D. (2005). Regulatory targets for transcription factor AP2 in Xenopus embryos. Dev. Growth Differ. 47,403 -413.[CrossRef][Medline]
Maconochie, M., Krishnamurthy, R., Nonchev, S., Meier, P., Manzanares, M., Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural crest cells involves members of the AP-2 family. Development 126,1483 -1494.[Abstract]
Mayor, R., Morgan, R. and Sargent, M. G. (1995). Induction of the prospective neural crest of Xenopus. Development 121,767 -777.[Abstract]
Merriam, R. W. and Christensen, K. (1983). A contractile ring-like mechanism in wound healing and soluble factors affecting structural stability in the cortex of Xenopus eggs and oocytes. J. Embryol. Exp. Morphol. 75,11 -20.[Medline]
Meulemans, D. and Bronner-Fraser, M. (2004). Gene-regulatory interactions in neural crest evolution and development. Dev. Cell 7,291 -299.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai, Y. (1998). Xenopus Zic-related-1 and Sox-2, two factors induced by chordin, have distinct activities in the initiation of neural induction. Development 125,579 -587.[Abstract]
Monsoro-Burq, A. H., Wang, E. and Harland, R. (2005). Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction. Dev. Cell 8, 167-178.[CrossRef][Medline]
Moreau, J., Lebreton, S., Iouzalen, N. and Mechali, M. (1999). Characterization of Xenopus RalB and its involvement in F-actin control during early development. Dev. Biol. 209,268 -281.[CrossRef][Medline]
Muslin, A. J., Tanner, J. W., Allen, P. M. and Shaw, A. S. (1996). Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell 84,889 -897.[CrossRef][Medline]
Nikolaidou, K. K. and Barrett, K. (2005). Getting to know your neighbours; a new mechanism for cell intercalation. Trends Genet. 21,70 -73.[CrossRef][Medline]
Papalopulu, N. and Kintner, C. (1993). Xenopus Distal-less related homeobox genes are expressed in the developing forebrain and are induced by planar signals. Development 117,961 -975.[Abstract]
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M. (2000). Ectopic Hoxa2 induction after neural crest migration results in homeosis of jaw elements in Xenopus. Development 127,5367 -5378.[Abstract]
Qu, J., Li, X., Novitch, B. G., Zheng, Y., Kohn, M., Xie, J. M., Kozinn, S., Bronson, R., Beg, A. A. and Minden, A. (2003). PAK4 kinase is essential for embryonic viability and for proper neuronal development. Mol. Cell. Biol. 23,7122 -7133.[Abstract/Free Full Text]
Rangarajan, J., Luo, T. and Sargent, T. D. (2006). PCNS: a novel protocadherin required for cranial neural crest migration and somite morphogenesis in Xenopus. Dev. Biol. 295,206 -218.[CrossRef][Medline]
Richman, J. M. and Lee, S. H. (2003). About face: signals and genes controlling jaw patterning and identity in vertebrates. BioEssays 25,554 -568.[CrossRef][Medline]
Sadaghiani, B. and Thiebaud, C. H. (1987). Neural crest development in the Xenopus laevis embryo, studied by interspecific transplantation and scanning electron microscopy. Dev. Biol. 124,91 -110.[CrossRef][Medline]
Saga, Y., Hata, N., Kobayashi, S., Magnuson, T., Seldin, M. F. and Taketo, M. M. (1996). MesP1: a novel basic helix-loop-helix protein expressed in the nascent mesodermal cells during mouse gastrulation. Development 122,2769 -2778.[Abstract]
Saint-Jeannet, J. P., He, X., Varmus, H. E. and Dawid, I. B. (1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and Wnt-3a. Proc. Natl. Acad. Sci. USA 94,13713 -13718.[Abstract/Free Full Text]
Sargent, T. D. (2006). Transcriptional regulation and the neural plate border. In Neural Crest Induction and Differentiation (ed. J. Saint-Jeannet), pp.32 -44. Georgetown, TX: Landes Bioscience.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K. and De Robertis, E. M. (1994). Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79,779 -790.[CrossRef][Medline]
Sive, H. (1999). Early Development of Xenopus laevis: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and Saint-Jeannet, J. P. (2002). The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development 129,421 -432.
Tao, Q., Lloyd, B., Lang, S., Houston, D., Zorn, A. and Wylie, C. (2005). A novel G protein-coupled receptor, related to GPR4, is required for assembly of the cortical actin skeleton in early Xenopus embryos. Development 132,2825 -2836.[Abstract/Free Full Text]
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119,1203 -1215.[Abstract]
Wada, N., Javidan, Y., Nelson, S., Carney, T. J., Kelsh, R. N. and Schilling, T. F. (2005). Hedgehog signaling is required for cranial neural crest morphogenesis and chondrogenesis at the midline in the zebrafish skull. Development 132,3977 -3988.[Abstract/Free Full Text]
Westerfield, M. (1994). The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio Rerio). Eugene, OR: University of Oregon Press.
Winning, R. S., Shea, L. J., Marcus, S. J. and Sargent, T. D. (1991). Developmental regulation of transcription factor AP-2 during Xenopus laevis embryogenesis. Nucleic Acids Res. 19,3709 -3714.[Abstract/Free Full Text]
Wolda, S. L., Moody, C. J. and Moon, R. T. (1993). Overlapping expression of Xwnt-3A and Xwnt-1 in neural tissue of Xenopus laevis embryos. Dev. Biol. 155, 46-57.[CrossRef][Medline]
Wunnenberg-Stapleton, K., Blitz, I. L., Hashimoto, C. and Cho, K. W. (1999). Involvement of the small GTPases XRhoA and XRnd1 in cell adhesion and head formation in early Xenopus development. Development 126,5339 -5351.[Abstract]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
H. Zhao, K. Tanegashima, H. Ro, and I. B. Dawid
Lrig3 regulates neural crest formation in Xenopus by modulating Fgf and Wnt signaling pathways
Development, April 1, 2008; 135(7): 1283 - 1293.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O. Ossipova, J. Tabler, J. B. A. Green, and S. Y. Sokol
PAR1 specifies ciliated cells in vertebrate ectoderm downstream of aPKC
Development, December 1, 2007; 134(23): 4297 - 4306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02813v1
134/7/1279    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Luo, T.
Right arrow Articles by Sargent, T. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luo, T.
Right arrow Articles by Sargent, T. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?