|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 March 2007
doi: 10.1242/dev.002212
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Howard Hughes Medical Institute, Department of Molecular Genetics and
Microbiology.
2 Department of Cell Biology, Box 3657, Duke University Medical Center, Durham,
NC 27710, USA.
Author for correspondence (e-mail:
rwharton{at}duke.edu)
Accepted 9 February 2007
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Nanos, Pumilio, Translational regulation, Germ cell, CCR4, Deadenylase
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Irish et al., 1989;
Struhl, 1989). Nos is
recruited into a repressor complex that contains two ubiquitous factors,
Pumilio (Pum) and Brain tumor (Brat). Pum nucleates formation of the complex
by recognizing Nanos Response Elements (NREs) in the 3' UTR of
hb and recruiting Nos (Sonoda and
Wharton, 1999). The subsequent recruitment of Brat to the
Pum-hb NRE-Nos complex (Sonoda
and Wharton, 2001) results in translational inhibition via both
poly(A)-dependent and poly(A)-independent mechanisms
(Chagnovich and Lehmann, 2001).
A transient gradient of Nos is generated by Oskar (Osk)-dependent localization
and translational activation of nos mRNA in the specialized pole
plasm at the posterior of the embryo
(Ephrussi and Lehmann, 1992;
Smith et al., 1992). For
regulation of hb, Nos is thought to be the sole spatially limiting
factor (Gavis and Lehmann,
1992).
In addition to their role in abdominal patterning, Nos and Pum play a
number of roles in the primordial germ cells (PGCs). PGCs that lack Nos or Pum
function enter mitosis prematurely, fail to migrate to the somatic gonad,
undergo apoptosis, and fail to maintain stem cell identity in adults
(Lin and Spradling, 1997;
Asaoka-Taguchi et al., 1999;
Asaoka and Lin, 2004;
Hayashi et al., 2004;
Wang and Lin, 2004). After
dissipation of the Nos gradient in the presumptive somatic cytoplasm (e.g. by
nuclear division cycle 9-10), high levels of Nos are found only in the PGCs
(Wang et al., 1994). The
limited distribution of Nos, coupled with the study of Nos orthologs in
Caenorhabditis elegans and Homo sapiens, suggests that the
ancestral function of Nos is in the germline
(Subramaniam and Seydoux,
1999; Jaruzelska et al.,
2003; Tsuda et al.,
2003).
Although the regulatory targets of Nos and Pum in the PGCs have not yet
been defined, one excellent candidate is maternal Cyclin B
(CycB) mRNA. PGCs cease proliferating shortly after their formation
at the posterior pole of the embryo, emerging from quiescence only after
migrating to, and arriving in, the presumptive gonad in late embryogenesis
(Su et al., 1998). At least
part of this quiescence is thought to be due to Pum- and Nos-dependent
repression of CycB mRNA
(Asaoka-Taguchi et al., 1999).
CycB accumulates prematurely in the PGCs of embryos from nos or
pum mutant females (hereafter, nos and pum mutant
embryos). Conversely, ectopic CycB drives otherwise wild-type PGCs into
premature mitosis, consistent with the idea that repression of CycB
translation limits proliferation. However, the ectopic CycB in these
experiments was derived from a transgene that directs the maternal synthesis
of a chimeric mRNA (consisting of 5' and 3' UTRs from nos
fused to the CycB ORF) under nos transcriptional control
(Asaoka-Taguchi et al., 1999);
the experiment thus provides only modest support for the idea that Pum and Nos
directly target native CycB mRNA.
Recent experiments have provided insight into the likely functions of two
components of the repressor complex assembled on hb-Pum and Brat. Pum
is a founding member of the conserved Puf domain family of RNA-binding
proteins (Zhang et al., 1997).
One of the budding yeast Puf proteins, MPT5, has recently been shown to bind
specific mRNA targets and regulate their stability by interacting with the
Pop2 subunit of the CCR4-Pop2-NOT complex
(Goldstrohm et al., 2006).
This complex contains deadenylation enzymes (CCR4 and Pop2) as well as factors
that promote decapping (Dhh1), and thus is able to regulate either the
stability or translation (or both) of mRNAs to which it is recruited. Based on
the observation that Puf proteins from H. sapiens, C. elegans and
Saccharomyces cerevisiae interact with orthologous Pop2 subunits,
Wickens and colleagues (Goldstrohm et al.,
2006) suggested that Puf proteins generally act by recruiting the
deadenylase complex. Brat appears to repress translation (at least in part) by
recruiting 4E-HP, which inhibits binding of the essential initiation factor
eIF-4E to the mRNA cap (Cho et al.,
2006). Brat is likely to have additional repressor functions,
because mutants that do not bind 4E-HP exhibit relatively minor defects in
hb regulation. The only function attributed to Nos to date has been
to assist Pum in recruiting Brat (Sonoda
and Wharton, 2001).
Regulation of maternal hb and CycB mRNA differs in two
important respects. First, repression of CycB is Brat-independent
(Sonoda and Wharton, 2001). As
the only known function of Nos for regulation of hb is in Brat
recruitment, the role of Nos in regulation of CycB (and presumably
other mRNAs in the PGCs) has been unclear. Second, repression of hb
occurs both in the PGCs and broadly throughout the posterior of the embryo,
whereas repression of CycB is strictly limited to the PGCs
(Tautz, 1988;
Asaoka-Taguchi et al., 1999).
These different spatial domains of repression might be due to differential
sensitivities of the hb and CycB mRNAs to the concentration
of Nos, which persists at high levels only in the PGCs. However, this idea has
not been critically tested.
In this report, we investigate the regulation of maternal CycB mRNA as a model for understanding Nos and Pum action in the germline. We first show that CycB indeed is directly regulated by binding of Nos and Pum to an element in its 3' UTR. We then describe experiments that suggest Nos is primarily responsible for recruiting the CCR4-Pop2-NOT deadenylase complex to CycB. Finally, we show that regulation of CycB in the somatic cytoplasm is deleterious and that it is restricted to the germline by a dual requirement for high levels of Nos and another factor active only in the PGCs.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) were
from C. Lehner (University of Bayreuth, Germany). CycB, hb, nos-bcd
and osk-bcd transgenes were constructed in pCasPeR derivatives and
introduced into w1118 flies by standard methods. The rat
anti-Hb and rabbit anti-Nos antibodies were gifts from P. Macdonald
(University of Texas, Austin, TX) and A. Nakamura (RIKEN, Kobe, Japan),
respectively. The F2F4 anti-CycB developed by P. O'Farrell was obtained from
the Developmental Studies Hybridoma Bank developed under the auspices of the
NICHD and maintained by The University of Iowa. Anti-Xpress antibodies were
from Invitrogen, anti-Histone antibodies from Chemicon International
(Fig. 6), and chicken anti-Vas
from K. Howard (University College London, UK). Secondary antibodies were from
Jackson ImmunoResearch Laboratories. The distributions of CycB, Vasa, Hb and
DNA were detected in fixed embryos with a Zeiss 510 confocal microscope. The
distributions of Hb and Nos were detected with peroxidase-coupled secondary
antibodies with a Zeiss Axiophot microscope using either brightfield or
Nomarski optics and a Spot RT digital camera. CycB mRNA was detected
by standard in situ hybridization methods using digoxigenin-labeled DNA probes
(Roche) and visualized as above for Hb and Nos. To detect transgenic
CycB gene products, transgenes were crossed into either
CycB2/+,CycB3/+, or
CycB2/CycB3 backgrounds so that
embryos did not receive an excess of maternal gene product. For the
pum- embryos in Fig.
4, CycB mRNA or protein from the endogenous genes would
interfere with the detection of transgenic gene product, and so these
experiments were performed in a
CycB2/CycB3 background.
In vitro RNA-binding experiments
RNA for all experiments was prepared by transcription of derivatives of the
plasmid R4685, which contains a SpeI site (underlined) embedded in
hb 3' UTR-coding sequence
(CTAAAAACTATCATAAAGACTAGTCTGGAGAAACATAAGCCCTGCA) that is inserted
into Bluescript II KS-. Oligonucleotides encoding fragments of hb
(ctagTATTATTTTGTTGTCGAAAATTGTACATAAGCC), CycB
(ctagtcgagGCATAAAAAAGAGACGTAGACTATTTGTAATTTATATCATGTATTTCGCACATTCATACgaattcatcgatgat),
or eIF4E
(ctagGCATAATATAAAATCTATCCGCTTTTTGTAATCACTGTCAATAATGGATTAGACGGAAAAGTATATTAA)
were inserted into the SpeI site of R4685. (The 5'
SpeI-overhang and, where relevant, polylinker derived nucleotides are
in lower case.) 32P-labeled RNA was prepared using T7
MEGAShortscript (Ambion).
Plasmids encoding GST-Pum, His6-Nos and His6-Brat are described elsewhere
(Wharton et al., 1998;
Sonoda and Wharton, 1999;
Edwards et al., 2003). A
plasmid encoding the Drosophila Pum RNA-binding domain was
constructed in a derivative of pET-19b in which the thrombin site is replaced
with a Tev cleavage site. Cleavage with Tev liberates the following fragment
of Drosophila Pum from an N-terminal His-tag: gtRSRLL...YYlKITN
(where gt are vector-encoded and l is substituted for the native M near the
C-terminus) (Edwards et al.,
2000). Like the RBD of human Pum, the Drosophila protein
is monomeric at mM concentrations.
Gel mobility shift experiments were performed essentially as described
(Murata and Wharton, 1995),
with the following modifications. Each 10 µl reaction contained purified
protein, reaction buffer [10 mM HEPES (pH 7.4), 20 mM KCl, 1 mM DTT, 0.2 mg/ml
heparin, 0.05 mg/ml poly(U), 5% glycerol], and heat-denatured labeled RNA
(10,000 cpm). Nos and Brat recruitment experiments were performed essentially
as described (Sonoda and Wharton,
1999; Sonoda and Wharton,
2001), with the following modifications: each 40 µl reaction
contained 1.5 µM GST-Pum, 0.6 µM His6-Nos, 2 µM RNA, and, for Brat
recruitment, 0.4 µM His6-Brat, in reaction buffer [20 mM HEPES (pH 7.9), 5
mM MgCl2, 5 µM ZnCl2, 5mM DTT, 100 mM NaCl, 0.5%
Tween 20, 0.1% BSA, 500 U/ml RNase Inhibitor (Roche) and 1xEDTA-free
protease inhibitor (Roche)]. For the experiments shown in Fig. S3 of the
supplementary material, all CycB RNAs were either the wild type
sequence above (i.e. bearing 59 nt from the 3' UTR) or mutant
derivatives thereof.
Transgenes
CycB transgenes were derived from a modified wild-type rescuing
construct (Jacobs et al.,
1998) that bears an XbaI site immediately 3' to
nucleotides encoding the stop codon to facilitate plasmid construction.
Oligonucleotides encoding the 59 nt CycB NRE (above), the 50 nt
CycB NRE
(ctagtAGAGACGTAGACTATTTGTAATTTATATCATGTATTTCGCACATTCATAC),
the inactive 40 nt CycB NRE (underlined nucleotides in the 50 nt
sequence deleted), two copies of the 32 nt hb NRE (above) and either
one or two copies of the MS2hp (ctagAAACATGAGGATCACCCATGTA) were inserted into
a SpeI site that replaces sequences deleted in the 
I portion
of the I+II gene or into the deleted portion of the III gene
(Fig. 1, and see Fig. S2 in the
supplementary material). hb transgenes were derivatives of p2343
(Murata and Wharton, 1995).
Derivatives of a wild-type nos transgene that encode three different
Nos-CP fusions were constructed by inserting sequences encoding wild-type MS2
CP between wild-type Nos residues 3 and 4, residues 197 and 198, and at the
C-terminus. Essentially identical regulation of CycB(2x MS2hp) was
observed with each fusion.
Protein-protein interaction experiments
GST-pulldown experiments were performed as described
(Goldstrohm et al., 2006),
except that Pop2 proteins were labeled with 35S-methionine during
synthesis in vitro. The GST-HsPum fusion protein was as described
(Goldstrohm et al., 2006); the
GST-Dm-Pum protein used in these experiments contains the homologous region
only (i.e. residues 1091-1433 containing the RBD but not the C-terminal tail).
NOT4 clones were isolated in two different yeast interaction screens, a
two-hybrid screen performed by M. Patterson and R.P.W. using DBD-Nos
(full-length) as bait and a four-hybrid screen
(Sonoda and Wharton, 2001).
The NOT4 clones identified in the latter screen proved to interact with the
Nos moiety of the three-hybrid bait. Fusions of Drosophila Pop2 to
the DBD or AD were prepared from cDNA clone RH51274 and plasmids pGBT9,
pGAD424,and pActII. Interaction between various protein pairs was tested by
co-transformation with plasmids encoding Nos, Pum, Cup or NOT4 derivatives
into PJ69-4A (James et al.,
1996). Tethering of Pop2 via the DBD robustly stimulated
transcription of the HIS3 and ADE2 reporters without co-expression of any
AD-fusion, and thus the DBD-Pop2 fusion was not used further.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
However, we found that neither the full-length Pum in embryonic extracts nor a
purified untagged Pum fragment consisting of little more than the RBD
(residues 1092-1433) bound detectably to Fragment D in gel mobility shift
experiments (Fig. 1B).
|
). Two
complexes were detectable in gel mobility shift experiments using a short RNA
substrate bearing the wild-type NRE. Analysis of Pum binding to various mutant
NREs is consistent with the idea that one Pum RBD recognizes each UGUA motif
(plus flanking nts). Mutations in either motif reduced Pum binding in vitro
and abrogated repression in the PGCs, suggesting that normal regulation
requires binding of Pum to both UGUA motifs. Nos was recruited to
Pum-CycB NRE complexes (see Fig. S3 in the supplementary material),
much as it is recruited to Pum-hb NRE complexes
(Sonoda and Wharton, 1999).
However, Brat was recruited only to the Pum-Nos complex assembled on the
hb NRE and not the corresponding complex assembled on the
CycB NRE (see Fig. S3 in the supplementary material); this finding is
consistent with the observation the CycB regulation is
Brat-independent (Sonoda and Wharton,
2001).
|
|
As shown in Fig. 2, the
CycB NRE imparted CycB-like regulation on hb mRNA:
protein accumulation was blocked but only in the PGCs at the posterior extreme
of the embryo. Hb protein accumulated throughout the posterior of
hb(CycB NRE) embryos, a distribution that was
indistinguishable at all stages examined from that in hb(NRE)
embryos. The ectopic Hb in hb(CycB NRE) embryos blocked all
abdominal segmentation, as described previously for hb(NRE)
embryos (Wharton and Struhl,
1991). We conclude that the CycB NRE mediates repression
in the PGCs but is not normally functional in the prospective somatic
cytoplasm, even immediately adjacent to the PGCs, where high levels of Nos
accumulate (albeit transiently).
Interaction of Nos with a deadenylase complex
Although the mechanism by which CycB mRNA is repressed is not yet
known, two lines of evidence suggested that deadenylation catalyzed by the
CCR4-Pop2-NOT complex is likely to be involved. First, CycB mRNA is
de-regulated and hyper-adenylated in ovaries from flies hemizygous for a
partial loss-of-function allele of CCR4 (also known as twin
- Flybase) (Morris et al.,
2005). Consistent with these observations, we find that
CycB was de-repressed in the PGCs of embryos from CCR4
mutant females (Fig. 3A). The
second line of evidence comes from a recent study of budding yeast MPT5
(structurally and functionally related to Pum), which suggested that Puf
domain proteins generally interact with the Pop2 subunit of the deadenylase
complex to regulate mRNA stability or translation
(Goldstrohm et al., 2006).
Consistent with this idea, we found that the Pum RBD bound to
Drosophila Pop2 in GST-pulldown experiments
(Fig. 3B). As is the case for
Puf proteins from H. sapiens, S. cerevisiae and C. elegans
(Goldstrohm et al., 2006),
Drosophila Pum also bound to heterologous Pop2 proteins
(Fig. 3B).
|
).
Binding of NOT4 to Nos was mediated by its N-terminal region
(Fig. 3C), which is essential
for Nos activity, despite being very poorly conserved
(Curtis et al., 1997). Taken
with previous work (Sonoda and Wharton,
1999), these results suggest that Nos acts as a bridge, contacting
Pum with its C-terminal zinc finger and NOT4 with its N-terminal region.
In principle, the Nos-NOT4 interaction might be sufficient to regulate
CycB; alternatively, contacts made by Pum (to Pop2) and Nos (to NOT4)
might both be required to efficiently recruit the deadenylase complex and
regulate translation. To distinguish between these models, we asked whether
tethering Nos via an exogenous RNA-binding domain would repress translation of
CycB mRNA. To do so, we prepared transgenic flies that express a
chimera in which Nos is fused to bacteriophage MS2 coat protein (CP)
(Coller and Wickens, 2002)
under the control of native nos regulatory signals. When crossed into
the appropriate background, these nos-CP transgenes fully rescued
various nos- phenotypes, demonstrating that the fusion
protein is functional when recruited to target mRNAs via Pum. Next, we
prepared transgenic flies expressing a CycB(2x MS2hp) derivative in
which the NRE is replaced with two copies of a short hairpin to which CP binds
with high affinity. We then asked whether tethering of Nos via CP can repress
the CycB(2x MS2hp) mRNA by monitoring CycB accumulation in embryos
from doubly transgenic females.
Binding of the Nos-CP chimera repressed translation of CycB(2x MS2hp) mRNA in the PGCs (Fig. 4A). CycB(2x MS2hp) mRNA was not repressed in the PGCs by wild-type Nos, presumably because its natural binding partner, the Pum-CycB NRE complex, could not form (in the absence of the NRE). However, CycB(2x MS2hp) mRNA was repressed upon co-expression of Nos-CP, even in the absence of pum function. Apparently, the sole role of Pum in regulation of CycB is to recruit Nos.
We considered the possibility that tethering Nos via the highaffinity CP-MS2hp interaction might reveal a weak intrinsic capacity of Nos for translational regulation that is normally significant only with additional contributions from bound Pum. If so, we might expect that Nos-CP would bypass the requirements for both Pum and Brat and regulate an analogous hb(2x MS2hp) chimeric mRNA (bearing a substitution of MS2hp sites for the endogenous NRE). As shown in Fig. 4B, we saw no evidence of such regulation: Hb accumulated uniformly throughout the posterior somatic cytoplasm and in the PGCs of embryos bearing maternal hb(2x MS2hp) mRNA, whether or not Nos-CP was co-expressed. The failure to observe repression of hb(2x MS2hp) even in the PGCs argues against the idea that repression of CycB(2x MS2hp) is artefactual.
In summary, the evidence described above supports the idea that, for regulation of CycB mRNA in the PGCs, the primary role of Pum is to recruit Nos, which subsequently recruits the deadenylase complex via direct interaction with NOT4.
A germline-restricted co-repressor for CycB regulation
Nos and Pum jointly repress CycB and (with the help of Brat)
hb mRNAs in different regions of the embryo. CycB is
repressed only in the PGCs at the posterior extreme, whereas hb is
repressed broadly throughout the posterior 
50% of the embryo. How are
these very different domains established? A priori, it seemed likely that the
spatiotemporal gradient of Nos would be primarily responsible for setting
different domain boundaries, because the other known direct regulators of
either CycB or hb, Pum and Brat, are uniform along the
anteroposterior axis of the early embryo. According to this idea, the
CycB NRE is relatively insensitive, tuned to respond only to the high
levels of Nos that persist in the PGCs; the hb NRE is more sensitive,
tuned to respond to the low levels of Nos present transiently in the somatic
cytoplasm nearer the middle of the embryo. In this model, Nos is the sole
spatially limiting factor that determines the domain of regulation along the
anteroposterior axis of the early embryo.
|
). We
considered the possibility that maternal CycB mRNA is resistant to
repression in the somatic cytoplasm (e.g. by virtue of a cis-acting
activation signal that overrides repressive signals). To test this idea, we
constructed a transgene encoding a chimeric CycB mRNA in which two
copies of the hb NRE are substituted for the native signal. When
embedded in the 3' UTR of either hb or torso mRNAs,
the hb NRE mediates repression broadly throughout the posterior 50%
of the embryo (Wharton and Struhl,
1991).
Expression of CycB(2x hb NRE) mRNA causes no obvious
dominant phenotypes in a wild-type background and rescues the oogenesis
defects associated with CycB null alleles
(Jacobs et al., 1998).
However, we observed profound developmental defects in embryos in which the
sole source of maternal CycB derives from the chimeric transgene. As shown in
Fig. 5A, over 95% of
CycB-; CycB(2x hb NRE) embryos had
defects in the abdominal segments, the posterior terminalia or both. In the
extreme, embryos die with an open posterior hole and no segments following the
third thoracic. These development defects appear to arise during nuclear
cleavage cycles 9-13, when oscillations in Cyclin/Cdk2 activity first regulate
nuclear divisions (Edgar et al.,
1994). As shown in Fig.
5B, somatic nuclei in the posterior of CycB-;
CycB(2x hb NRE) embryos delayed progression through cycles
9-13 and ultimately lost contact with the embryonic cortex, falling into the
yolky interior. Nuclear cycle defects were limited to the posterior and were
not observed during cycles 1-8, when divisions are independent of fluctuation
in Cyclin/Cdk2 activity (Edgar et al.,
1994). Taken together, these observations suggest that CycB
activity can be significantly repressed in the somatic cytoplasm via the
hb NRE.
The hb NRE imparts hb-like regulation on CycB
mRNA by another criterion: during the initial nuclear cleavages, CycB protein
accumulation was repressed in the posterior of 40% of
CycB-; CycB(2x hb NRE) embryos
(Fig. 5C). After nuclear
division cycle 9, however, CycB was uniform along the anteroposterior axis of
all such embryos, except in the PGCs, where accumulation was efficiently
repressed (Fig. 5C). The
apparent difference between the response of hb and CycB
mRNAs to regulation mediated by the hb NRE is probably due to a
number of factors (e.g. the stability of repressed CycB mRNA, nuclear
sequestration of Hb, dissipation of the somatic Nos gradient after cycle 9).
Nevertheless, the salient finding is that repression of CycB can be
observed in the somatic cytoplasm, ruling out the possibility that the mRNA is
intrinsically resistant to regulation.
As repression of CycB in the somatic cytoplasm has a much more dramatic effect on nuclear division than on CycB protein accumulation, we re-examined the question of whether ectopic Nos in the anterior of nos-bcd embryos can repress CycB, which we did by examining nuclear morphology. As shown in Fig. 6, CycB-dependent progression through syncitial nuclear cleavages 9-13 was normal, despite the presence of high levels of persistent Nos in such embryos. The obvious difference between the ectopic Nos in the somatic anterior and the endogenous Nos at the posterior of nos-bcd embryos is that the latter is accompanied by germline factors localized in the PGCs.
Therefore, we asked whether ectopic Nos can repress CycB mRNA in
the presence of pole plasm components. To do so, we examined embryos with a
chimeric oskar-bicoid mRNA
(Ephrussi and Lehmann, 1992).
Translation of this chimera generated sufficient Oskar (Osk) at the anterior
pole to direct the formation of pole cells, the recruitment of nos
mRNA and accumulation of anterior Nos to levels only slightly higher than
those generated in the posterior under native regulatory signals
(Fig. 6). Osk also accumulates
to somewhat lower levels in the adjacent somatic cytoplasm at the anterior, in
contrast to the endogenous Osk at the posterior, which is confined to the PGCs
(Ephrussi and Lehmann, 1992).
We observed significant defects in progression through nuclear cleavages 9-13
near the anterior pole in 20% of osk-bcd embryos
(Fig. 6). These defects were
due to inappropriate repression of CycB mRNA, as they were rescued if
the embryos contained, in addition to the wild-type CycB mRNA, the
unrepressible I+II mRNA that lacks a functional NRE (Figs
1,
6). Evidently, in 20% of
osk-bcd embryos, the level of Osk in the anterior somatic cytoplasm
was sufficient to recruit or stabilize at least one essential co-repressor
that acted in conjunction with Nos (and Pum) to repress CycB
mRNA.
|
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Binding of Pum and Nos to the CycB and hb NREs
The co-crystal structure of human Pum bound to a fragment of the
hb NRE shows that a single Pum RBD directly contacts eight
nucleotides of the RNA (Wang et al.,
2002b). However, Puf proteins bind with essentially wild-type
affinity to many mutant sites (Bernstein et
al., 2005; Cheong and Hall,
2006) (L.K., Y.H., T.L. and R.W., unpublished), suggesting that
all eight nucleotides are not rigidly specified. How, then, do Puf proteins
recognize specific mRNA targets in vivo?
Part of the answer appears to be that, within functional NREs, more than
eight nucleotides are recognized, at least by Drosophila Pum.
Mutations that simultaneously disrupt Pum binding in vitro and regulation in
vivo are spread over 20 nts of the hb NRE
(Wharton et al., 1998) and 18
nts of the CycB NRE (see Fig. S3 in the supplementary material).
These extended Pum mutational `footprints' are too large to be accounted for
by binding of a single RBD; we suggest that two or more Pum RBDs bind each
NRE, an idea supported by the detection of two RNA-protein complexes in gel
mobility shift experiments using both the CycB and hb NREs
(not shown). This model disagrees with earlier experiments that suggested only
a single Pum RBD binds to the hb NRE
(Zamore et al., 1999). Further
biochemical and structural studies will be required to resolve the issue.
The distribution of Pum- and Nos-binding sites within the CycB and
hb NREs is different. In the former, the Nos binding site lies
5' to the Pum-binding site(s), whereas in the latter, the Nos-binding
site is flanked by nucleotides recognized by Pum
(Sonoda and Wharton, 1999). We
assume that the different arrangement of Nos- and Pumbinding sites is
responsible for the assembly of Pum-NRE-Nos complexes with different
topographies, such that Brat is recruited to hb but not to
CycB. Further definition of each RNP structure will ultimately be
required to understand the combinatorial assembly of different repressor
complexes on each NRE.
In addition to the NRE, Pum also binds with high affinity to at least two
other sites in the CycB 3' UTR
(Fig. 1); however, binding to
these sites does not mediate translational repression in the PGCs, perhaps
because neither supports recruitment of Nos. These sites may simply bind Pum
fortuitously, or they may mediate Nosindependent regulation at other stages of
development. Pum has been suggested to destabilize bcd mRNA at the
anterior of the embryo in a Nos-independent manner
(Gamberi et al., 2002).
Another Nos-independent function of Pum is the repression of CycB
translation throughout the prospective somatic cytoplasm during the early
syncitial nuclear cleavages (Tadros et
al., 2007; Vardy and
Orr-Weaver, 2007). These processes might be mediated by elements
in Fragments A and F of the 3' UTR, which bind Pum but not Nos
(Fig. 1, and see Fig. S1 in the
supplementary material).
A molecular function for Nos: recruitment of the CCR4-Pop2-NOT deadenylase complex
Recent work from the Wickens lab has provided a general framework for
understanding how Puf proteins act to control either the translation or
stability of target mRNAs (Goldstrohm et
al., 2006). The yeast Puf protein MPT5 interacts directly with
Pop2, one of the catalytically active subunits of a large deadenylase complex.
Subsequent deadenylation could either silence the mRNA or cause its
degradation, depending on other signals in the transcript or the composition
of the deadenylase complex (or both). The Puf-Pop2 interaction is conserved
across species (including Drosophila,
Fig. 3), supporting the idea
that the mechanism uncovered for MPT5 might generally be applicable to Puf
proteins.
In this context, it is surprising that Pum is dispensable if Nos is
tethered to CycB via MS2 CP. We suggest that yeast Puf proteins both
recognize target mRNAs and recruit the deadenylase, but that in the
Drosophila germline these functions are partitioned, with Pum
primarily responsible for target mRNA recognition and Nos primarily
responsible for effector recruitment (Fig.
7). This model has the attraction of attributing an important role
to Nos, which is essential for Puf-mediated regulation in Drosophila,
and probably other metazoans as well
(Subramaniam and Seydoux,
1999; Jaruzelska et al.,
2003). What, then, might be the role of the conserved interaction
between Pum and Pop2? One possibility is that it acts cooperatively with Nos
to recruit the deadenylase; unlike CycB, other mRNA targets (e.g.
hb) might require recruitment by both Nos and Pum to ensure efficient
deadenylation. Another possibility is that it plays an essential role for
mRNAs regulated by Pum but not Nos.
Deleterious Nos-dependent repression of maternal CycB mRNA in the somatic cytoplasm
Oscillations in CycB activity underlie normal cell cycle progression.
During the early embryonic syncitial nuclear cleavages, degradation in the
vicinity of the nuclei is thought to deplete CycB locally
(Edgar et al., 1994;
Su et al., 1998). Recent work
has shown that Pum can inappropriately repress de novo translation of
CycB mRNA during the initial nuclear cleavages if not antagonized by
the PNG kinase, resulting in mitotic failure
(Tadros et al., 2007;
Vardy and Orr-Weaver, 2007).
This early Pum-dependent repression is thought to be Nos-independent, as it
occurs efficiently in the anterior, where Nos activity is undetectable.
Our results (Figs 5, 6) show that if CycB is inappropriately subjected to Pum+Nos-dependent repression via the hb NRE, CycB is locally depleted, resulting in mitotic failure during nuclear division cycles 10-13. As is thought to be the case during the early cycles (1-7), de novo synthesis of CycB apparently is required to counteract the local degradation that probably occurs during M phase of each cycle. The CycB NRE must therefore be precisely tuned to repress translation only in the PGCs and not in the presumptive somatic cytoplasm.
A germline-restricted co-repressor for regulation of CycB
Osk is the limiting factor for assembly of pole plasm in the embryo
(Ephrussi and Lehmann, 1992;
Smith et al., 1992); our
results suggest that it stimulates the accumulation or activity of at least
one factor in addition to Nos that is required for repression of CycB
in the PGCs. The existence of a co-factor is inferred from the finding that
ectopic Nos can repress CycB in the somatic cytoplasm only in the
presence of ectopic Osk (Fig.
6). Regulation of CycB may depend on more than one
germline-restricted factor to ensure that potentially deleterious repression
does not occur in the somatic cytoplasm.
A germline Nos co-factor might act in a variety of ways. It could bind to
the CycB NRE adjacent to Pum and Nos, substituting functionally for
Brat, which is recruited to the Pum-hb NRE-Nos complex. The 50 nt
CycB NRE is inactivated by a truncation at both ends that leaves the
Pum- and Nos-binding sites intact, consistent with the idea that another
factor binds to the element (see Figs S2 and S3 in the supplementary
material). Another possibility is that the co-factor is a germline-specific
component of the adenylation/deadenylation machinery, as is the case for the
GLD-2 cytoplasmic poly(A)-polymerase in C. elegans
(Wang et al., 2002a).
Distinguishing among these ideas awaits identification of the cofactor.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/8/1519/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Asaoka, M. and Lin, H. (2004). Germline stem
cells in the Drosophila ovary descend from pole cells in the anterior region
of the embryonic gonad. Development
131,5079
-5089.
Asaoka-Taguchi, M., Yamada, M., Nakamura, A., Hanyu, K. and Kobayashi, S. (1999). Maternal Pumilio acts together with Nanos in germline development in Drosophila embryos. Nat. Cell Biol. 1,431 -437.[CrossRef][Medline]
Bernstein, D., Hook, B., Hajarnavis, A., Opperman, L. and
Wickens, M. (2005). Binding specificity and mRNA targets of a
C. elegans PUF protein, FBF-1. RNA
11,447
-458.
Chagnovich, D. and Lehmann, R. (2001).
Poly(A)-independent regulation of maternal hunchback translation in the
Drosophila embryo. Proc. Natl. Acad. Sci. USA
98,11359
-11364.
Cheong, C. G. and Hall, T. M. (2006).
Engineering RNA sequence specificity of Pumilio repeats. Proc.
Natl. Acad. Sci. USA 103,13635
-13639.
Cho, P. F., Gamberi, C., Cho-Park, Y. A., Cho-Park, I. B., Lasko, P. and Sonenberg, N. (2006). Cap-dependent translational inhibition establishes two opposing morphogen gradients in Drosophila embryos. Curr. Biol. 16,2035 -2041.[CrossRef][Medline]
Coller, J. and Wickens, M. (2002). Tethered function assays using 3' untranslated regions. Methods 26,142 -150.[CrossRef][Medline]
Curtis, D., Treiber, D. K., Tao, F., Zamore, P. D., Williamson, J. R. and Lehmann, R. (1997). A CCHC metal-binding domain in Nanos is essential for translational regulation. EMBO J. 16,834 -843.[CrossRef][Medline]
Dalby, B. and Glover, D. M. (1993). Discrete sequence elements control posterior pole accumulation and translational repression of maternal cyclin B RNA in Drosophila. EMBO J. 12,1219 -1227.[Medline]
Edgar, B. A., Sprenger, F., Duronio, R. J., Leopold, P. and
O'Farrell, P. H. (1994). Distinct molecular mechanism
regulate cell cycle timing at successive stages of Drosophila embryogenesis.
Genes Dev. 8,440
-452.
Edwards, T. A., Trincao, J., Escalante, C. R., Wharton, R. P. and Aggarwal, A. K. (2000). Crystallization and characterization of Pumilo: a novel RNA binding protein. J. Struct. Biol. 132,251 -254.[CrossRef][Medline]
Edwards, T. A., Wilkinson, B. D., Wharton, R. P. and Aggarwal,
A. K. (2003). Model of the brain tumor-Pumilio translation
repressor complex. Genes Dev.
17,2508
-2513.
Ephrussi, A. and Lehmann, R. (1992). Induction of germ cell formation by oskar. Nature 358,387 -392.[CrossRef][Medline]
Gamberi, C., Peterson, D. S., He, L. and Gottlieb, E.
(2002). An anterior function for the Drosophila posterior
determinant Pumilio. Development
129,2699
-2710.
Gavis, E. R. and Lehmann, R. (1992). Localization of nanos RNA controls embryonic polarity. Cell 71,301 -313.[CrossRef][Medline]
Gerber, A. P., Luschnig, S., Krasnow, M. A., Brown, P. O. and
Herschlag, D. (2006). Genome-wide identification of mRNAs
associated with the translational regulator PUMILIO in Drosophila
melanogaster. Proc. Natl. Acad. Sci. USA
103,4487
-4492.
Goldstrohm, A. C., Hook, B. A., Seay, D. J. and Wickens, M. (2006). PUF proteins bind Pop2p to regulate messenger RNAs. Nat. Struct. Mol. Biol. 13,533 -539.[CrossRef][Medline]
Hayashi, Y., Hayashi, M. and Kobayashi, S.
(2004). Nanos suppresses somatic cell fate in Drosophila germ
line. Proc. Natl. Acad. Sci. USA
101,10338
-10342.
Hülskamp, M., Schröder, C., Pfeifle, C., Jäckle, H. and Tautz, D. (1989). Posterior segmentation of the Drosophila embryo in the absence of a maternal posterior organizer gene. Nature 338,629 -632.[CrossRef][Medline]
Irish, V., Lehmann, R. and Akam, M. (1989). The Drosophila posterior-group gene nanos functions by repressing hunchback activity. Nature 338,646 -648.[CrossRef][Medline]
Jacobs, H. W., Knoblich, J. A. and Lehner, C. F.
(1998). Drosophila Cyclin B3 is required for female fertility and
is dispensable for mitosis like Cyclin B. Genes Dev.
12,3741
-3751.
James, P., Halladay, J. and Craig, E. A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144,1425 -1436.[Abstract]
Jaruzelska, J., Kotecki, M., Kusz, K., Spik, A., Firpo, M. and Reijo Pera, R. A. (2003). Conservation of a Pumilio-Nanos complex from Drosophila germ plasm to human germ cells. Dev. Genes Evol. 213,120 -126.[Medline]
Lin, H. and Spradling, A. C. (1997). A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124,2463 -2476.[Abstract]
Morris, J. Z., Hong, A., Lilly, M. A. and Lehmann, R.
(2005). twin, a CCR4 homolog, regulates cyclin poly(A) tail
length to permit Drosophila oogenesis. Development
132,1165
-1174.
Murata, Y. and Wharton, R. P. (1995). Binding of Pumilio to maternal hunchback mRNA is required for posterior patterning in Drosophila embryos. Cell 80,747 -756.[CrossRef][Medline]
Smith, J. L., Wilson, J. E. and Macdonald, P. M. (1992). Overexpression of oskar directs ectopic activation of nanos and presumptive pole cell formation in Drosophila embryos. Cell 70,849 -859.[CrossRef][Medline]
Sonoda, J. and Wharton, R. P. (1999).
Recruitment of Nanos to hunchback mRNA by Pumilio. Genes
Dev. 13,2704
-2712.
Sonoda, J. and Wharton, R. P. (2001).
Drosophila Brain Tumor is a translational repressor. Genes
Dev. 15,762
-773.
Struhl, G. (1989). Differing strategies for organizing anterior and posterior body pattern in Drosophila embryos. Nature 338,741 -744.[CrossRef][Medline]
Su, T. T., Sprenger, F., DiGregorio, P. J., Campbell, S. D. and
O'Farrell, P. H. (1998). Exit from mitosis in Drosophila
syncytial embryos requires proteolysis and cyclin degradation, and is
associated with localized dephosphorylation. Genes
Dev. 12,1495
-1503.
Subramaniam, K. and Seydoux, G. (1999). nos-1 and nos-2, two genes related to Drosophila nanos, regulate primordial germ cell development and survival in Caenorhabditis elegans. Development 126,4861 -4871.[Abstract]
Tadros, W., Goldman, A. L., Babak, T., Menzies, F., Vardy, L., Orr-Weaver, T., Hughes, T. R., Westwood, J. T., Smibert, C. A. and Lipshitz, H. D. (2007). SMAUG is a major regulator of maternal mRNA destabilization in Drosophila and its translation is activated by the PAN GU kinase. Dev. Cell 12,143 -155.[CrossRef][Medline]
Tautz, D. (1988). Regulation of the Drosophila segmentation gene hunchback by two maternal morphogenetic centres. Nature 332,281 -284.[CrossRef][Medline]
Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S.,
Kobayashi, S. and Saga, Y. (2003). Conserved role of nanos
proteins in germ cell development. Science
301,1239
-1241.
Vardy, L. and Orr-Weaver, T. L. (2007). The Drosophila PNG kinase complex regulates the translation of cyclin B. Dev. Cell 12,157 -166.[CrossRef][Medline]
Verrotti, A. C. and Wharton, R. P. (2000). Nanos interacts with Cup in the female germline of Drosophila. Development 127,5225 -5232.[Abstract]
Wang, C., Dickinson, L. K. and Lehmann, R. (1994). Genetics of nanos localization in Drosophila. Dev. Dyn. 199,103 -115.[Medline]
Wang, L., Eckmann, C. R., Kadyk, L. C., Wickens, M. and Kimble, J. (2002a). A regulatory cytoplasmic poly(A) polymerase in Caenorhabditis elegans. Nature 419,312 -316.[CrossRef][Medline]
Wang, X., McLachlan, J., Zamore, P. D. and Hall, T. M. T. (2002b). Modular recognition of RNA by a human pumilio-homology domain. Cell 110,501 -512.[CrossRef][Medline]
Wang, Z. and Lin, H. (2004). Nanos maintains
germline stem cell self-renewal by preventing differentiation.
Science 303,2016
-2019.
Wharton, R. P. and Struhl, G. (1991). RNA regulatory elements mediate control of Drosophila body pattern by the posterior morphogen nanos. Cell 67,955 -967.[CrossRef][Medline]
Wharton, R. P., Sonoda, J., Lee, T., Patterson, M. and Murata, Y. (1998). The Pumilio RNA-binding domain is also a translational regulator. Mol. Cell 1, 863-872.[CrossRef][Medline]
Zamore, P. D., Bartel, D. P., Lehmann, R. and Williamson, J. R. (1999). The PUMILIO-RNA interaction: a single RNA-binding domain monomer recognizes a bipartite target sequence. Biochemistry 38,596 -604.[CrossRef][Medline]
Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J. and Wickens, M. P. (1997). A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite germ line. Nature 390,477 -484.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  C. R. Stumpf, J. Kimble, and M. Wickens A Caenorhabditis elegans PUF protein family with distinct RNA binding specificity RNA, August 1, 2008; 14(8): 1550 - 1557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Rendl, M. A. Bieman, and C. A. Smibert S. cerevisiae Vts1p induces deadenylation-dependent transcript degradation and interacts with the Ccr4p-Pop2p-Not deadenylase complex RNA, July 1, 2008; 14(7): 1328 - 1336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Benoit, C. Papin, J. E. Kwak, M. Wickens, and M. Simonelig PAP- and GLD-2-type poly(A) polymerases are required sequentially in cytoplasmic polyadenylation and oogenesis in Drosophila Development, June 1, 2008; 135(11): 1969 - 1979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Abaza and F. Gebauer Trading translation with RNA-binding proteins RNA, March 1, 2008; 14(3): 404 - 409. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. I. Muraro, A. J. Weston, A. P. Gerber, S. Luschnig, K. G. Moffat, and R. A. Baines Pumilio Binds para mRNA and Requires Nanos and Brat to Regulate Sodium Current in Drosophila Motoneurons J. Neurosci., February 27, 2008; 28(9): 2099 - 2109. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Song, L. Fee, T. H. Lee, and R. P. Wharton The Molecular Chaperone Hsp90 Is Required for mRNA Localization in Drosophila melanogaster Embryos Genetics, August 1, 2007; 176(4): 2213 - 2222. [Abstract] [Full Text] [PDF]
< |
