|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 21 November 2007
doi: 10.1242/dev.010892
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Molecular, Cell and Developmental Biology, University of California Santa Barbara, Santa Barbara CA, 93106, USA.
Author for correspondence (e-mail:
w_smith{at}lifesci.ucsb.edu)
Accepted 30 September 2007
| SUMMARY |
|---|
|
|
|---|
3/4/5 is
highly expressed in the developing notochord, and Cs-lam
3/4/5
protein is specifically localized to the outer border of the notochord.
Notochord convergence and extension, reduced but not absent in both
chm and aim, are essentially abolished in the
aim/aim; chm/chm double mutant, indicating
that laminin-mediated boundary formation and PCP-dependent mediolateral
intercalation are each able to drive a remarkable degree of tail morphogenesis
in the absence of the other. These mechanisms therefore initially act in
parallel, but we also find that PCP signaling has an important later role in
maintaining the perinotochordal/intranotochordal polarity of
Cs-lam
3/4/5 localization.
Key words: Ciona, Morphogenesis, Notochord, Planar cell polarity
| INTRODUCTION |
|---|
|
|
|---|
We use the ascidian Ciona savignyi as a model for chordate axial
morphogenesis, both for the morphological simplicity of its body plan and the
genetic simplicity of its compact genome. Ascidian notochord morphogenesis
takes place without cell division and involves the intercalation of only 40
notochord cells from an initially isodiametric grouping into a single-file
column of flat, disk-shaped cells (Cloney,
1964
; Miyamoto and Crowther,
1985
; Munro et al.,
2006
; Munro and Odell,
2002b
). This intercalation involves mediolaterally-biased tractive
cell protrusions, as has also been described in Xenopus
(Shih and Keller, 1992a
;
Shih and Keller, 1992b
), and
may involve a ventrally oriented invagination movement that helps round the
notochord in cross section (Munro and
Odell, 2002b
). While this intercalation is essential, a
considerable degree of tail extension is also driven by cell-shape changes and
vacuolization after intercalation is complete
(Miyamoto and Crowther, 1985
).
Although notochord intercalation appears broadly similar between ascidians and
vertebrates, there are likely to be important differences between ascidian and
vertebrate CE movements. For example, ascidian muscle and neural cells do not
obviously play as active and independent a role in CE as they do in
vertebrates.
The Ciona mutation aimless (aim) is an allele of
the PCP pathway component Prickle (Pk)
(Jiang et al., 2005
).
aim notochord cells have severe defects in mediolateral cell polarity
and, although fully motile, they converge and extend extremely slowly and
incompletely, such that most of the notochord remains roughly two cells wide.
The notochord-specific RNA expression
(Hotta et al., 2000
;
Jiang et al., 2005
) and mutant
phenotype of aim suggest that the ascidian PCP pathway is involved
only in notochord morphogenesis and not in gastrulation or neural tube
closure. Although aim is probably a null mutation and has a severe
defect in notochord cell behavior, the notochord cells do form a rod-like
structure and the tail does show considerable elongation. These observations
suggest that multiple mechanisms are important in the overall convergence and
extension of the ascidian tail.
A second mutation, chongmague (chm), causes a distinct
and profound defect in notochord morphogenesis. All 40 notochord cells are
present and express notochord-specific genes such as brachyury
(bra), forkhead and tropomyosin
(Deschet et al., 2003
;
Nakatani et al., 1999
), but
the notochord cells appear rounded and fail to adopt the wild-type 1x40
`stack of coins' morphology. Markers for other embryonic tissues, including
tail muscle, nervous system and epidermis, are correctly expressed within the
context of a short and aberrant tail
(Deschet et al., 2003
;
Nakatani et al., 1999
). Here
we use high-resolution 3D confocal imaging to show that chm has a
novel and severe defect in the formation of a morphological boundary around
the developing notochord. Unlike in aim, early intercalation is
relatively normal, but the notochord cells lose their polarized morphology and
become widely dispersed in the tail.
We hypothesized that the dispersed notochord cells seen in chm
reflect a failure in boundary capture or some similar behavior at the
notochord border. Wild-type ascidian embryos exhibit a suite of complex
behaviors at the notochord border, including a surprisingly dynamic boundary
capture-like behavior in which notochord cells rapidly spread out on surfaces
contacting the boundary. chm notochord cells show persistent and
undirected motility that is consistent with a failure in this behavior. We
have identified chm as a mutation in Cs-lam
3/4/5, an
extracellular matrix (ECM) molecule highly expressed in the notochord and
specifically localized to perinotochordal cell surfaces.
Although the notochord boundary can be perturbed by genetic manipulations
that transform notochord cells into muscle and vice-versa
(Fujiwara et al., 1998
;
Reintsch et al., 2005
),
chm is, to the best of our knowledge, the only perturbation with a
strong, early and direct effect on the formation of the notochord boundary.
chm thus provides a unique tool to functionally test the relationship
between notochord boundary formation and PCP-dependent cell intercalation.
Epistasis analysis suggests that these two mechanisms initially act largely in
parallel. The considerable convergence and extension remaining in aim
is dependent on chm function, suggesting that the notochord boundary
does not merely support the structural integrity of the notochord and help
maintain polarized cell behaviors, but that it can itself drive a significant
amount of CE. The relationship between PCP signaling and laminin-mediated
boundary formation is not strictly independent, however, as we also observe
that the PCP pathway has a role in maintaining the
perinotochordal/intranotochordal polarity of Cs-lam
3/4/5
localization.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibody and phalloidin staining
Embryos were fixed in either 2% paraformaldehyde in seawater or Munro's
Ascidian Cytoskeletal Fix (2% paraformaldehyde, 0.1 M Hepes pH 7.0, 0.05 M
EGTA, 0.4 M dextrose, 0.01 M MgSO4, 0.2% Triton X-100), rinsed
several times in PBT (PBS+0.2% Triton-X) and fixed in 5% heat-inactivated goat
serum in PBT. Bodipy-FL phallacidin (Invitrogen) was used at 1 unit/100 µl,
antiCs-lam
3/4/5 at 1:250-1:500, rabbit polyclonal anti-GFP at
1:500 and mouse monoclonal anti-GFP at 1:250. The Cs-lam
3/4/5
antibody was raised against a bacterially produced recombinant protein
containing amino acids 1330 to 1494 of Cs-lam
3/4/5(lam13)
fused to an N-terminal His tag. Cs-lam
3/4/5 staining required
an antigen retrieval step (Kirkpatrick and
d'Ardenne, 1984
) with 20-40 µg/ml proteinase K in PBT for 4
minutes at 37°C followed by several brief washes in PBT on ice. Primary
and secondary antibody incubations were overnight at 4°C, followed by
several washes in PBT. Bodipy-FL phallacidin was used for 1 hour at room
temperature in PBT, followed by several washes in PBT. Two-color
GFP/phalloidin staining used a rabbit polyclonal anti-GFP antibody and a red
fluorescent Alexa 594 secondary antibody to detect GFP in combination with the
green fluorescent Bodipy-FL phallicidin (direct GFP fluorescence is killed by
the clearing process). Embryos were cleared and mounted as described
(Munro and Odell, 2002b
).
Electroporations were as described (Corbo
et al., 1997
).
Imaging
An Olympus Fluoview 500 was used for confocal imaging, using 40x
1.2NA and 60x 1.4NA oil immersion lenses for fixed samples and a
20x 0.7NA air lens for live imaging. Image stacks were at 0.4-0.5 µm
spacing for fixed embryos. ImageJ (Wayne Rasband, NIH) was used to reconstruct
z-sections across the axis of the notochord, and for maximum
intensity projections. Slidebook 4.1 (Intelligent Imaging Innovations) was
used for volume renderings of confocal stacks. Widefield images were collected
using a Leica DMRB compound microscope with a shutter-controlled
epifluorescence light path and either a SPOT-2 or a Hamamatsu ERAG CCD
camera.
Mapping the chm mutation
Bulked segregant analysis (BSA) was performed on DNA isolated from
triplicate pools of 15 embryos each from mutant (chm/chm) and
phenotypically wild-type (wt/wt and wt/chm) progeny of a
self-fertilized heterozygous chm adult, as described previously
(Jiang et al., 2005
). AFLP
reactions on the pooled genomic DNAs were performed using the Small Genome Kit
from Invitrogen. The AFLP reactions were resolved on sequencing gels and
autoradiographed. Linked bands were eluted from the gels, reamplified, and
sequenced using standard fluorescent sequencing methods. Nucleotide sequences
of the linked bands were used to search the partially assembled C.
savignyi genomic sequence.
Cs-lam
3/4/5 nucleotide sequence analysis
Cs-lam
3/4/5 genomic sequences predicted by paired scaffolds
312 and 44 were used to search protein and nucleic acid databases, including
the C. intestinalis EST database
(Imai et al., 2004
). We were
able to identify with high confidence N- and C-terminal ESTs for the C.
intestinalis ortholog of Cs-Lam
3/4/5. These C.
intestinalis EST sequences were then used as guides with the C.
savignyi genomic sequence to design oligonucleotides to the 5' and
3' ends of the Cs-Lam
3/4/5 transcript
(GAAATATTAGAGTCGCAAAAAACTAGTCAATGACC and GGTCTATGGCGATATTACGACAAATAACTGTCC,
respectively).
The oligonucleotides were used to amplify an
11 kbp PCR product using
LaTaq (Takara) with cDNA synthesized from RNA extracted from pooled clutches
of wild-type C. savignyi larvae. Two separate alleles of the
wild-type Cs-lam
3/4/5 cDNA clones of 11,354 bp (clone
lam13) and 11,605 bp (clone lam33) were sequenced in their
entirety, and two conceptual cDNAs were derived from the C. savignyi
genomic sequence (haplo1 and haplo2).
Cs-lam
3/4/5 cDNAs from pools of homozygous chm and
chm35 larvae were PCR-amplified in three overlapping
fragments. Genomic fragments containing the frameshift mutation identified in
the chm35 cDNA were PCR-amplified from individual larvae
using the oligonucleotides 5'-GGAAATGTGCAACCACACG-3' and
5'-TCTGTTCTTAAGGTCATTGGCAT-3' and directly sequenced.
Cs-lam
3/4/5 in situ hybridization
For late-tailbud-stage embryos, in situ hybridization was as described
(Arenas-Mena et al., 2000
),
using a 986 bp internal cDNA fragment from base 4427 to base 5413 of the lam13
cDNA. For neurula-stage embryos, a 2032 bp probe from the 3' end of the
full-length transcript was used as described
(Hotta et al., 1999
).
Morpholino oligonucleotide knockdown
Fertilized eggs were injected with either sense or anti-sense morpholino
oligonucleotides (MOs) corresponding to the predicted start codon and flanking
3' nucleotides of the Cs-lam
3/4/5 gene (sense:
TCAATGACCAAAATGCTGCGCTTAG; antisense: CTAAGCGCAGCATTTTGGTCATTGA). Eggs were
injected with
15 pl MO solutions at 0.5 or 0.67 mM (final dose
10
fmol), as described previously (Imai et
al., 2002
).
Single tadpole DNA prep
Tadpole larvae were fixed in 3.7% formaldehyde in seawater. After several
days in fixative, the test cells sloughed off, thus removing any potential
maternal DNA contamination. The larvae were then rinsed in distilled water and
transferred individually to tubes containing 10 µl of 1% Triton X-100, 100
mM NaCl, 20 mM Tris pH 7.8, 1 mM EDT, and 1 mg/ml proteinase K. The samples
were incubated overnight at 55°C, followed by a 10 minute incubation at
95°C to inactivate the protease.
|
| RESULTS |
|---|
|
|
|---|
By mid-tailbud stage, the wild-type notochord has fully intercalated into a compact rod of 40 disk-shaped cells (Fig. 1D,F). In chm, however, notochord morphology had become completely aberrant, with rounded, loosely adherent cells forming a dispersed mass in the tail (Fig. 1E,G,H,I). The wild-type notochord is located centrally in the tail, flanked by the dorsal nerve cord, the ventral endodermal strand and the lateral muscle cells (inset in Fig. 1F). In chm, however, notochord cells could be found invading these flanking tissues, most frequently the nerve cord (Fig. 1H) and endodermal strand (Fig. 1I), and occasionally the muscle cells. For rotating 3D renderings of these confocal stacks, see Movies 1 and 2 in the supplementary material. chm embryos also showed a characteristic epidermal protrusion at the tip of the tail (yellow bracket in Fig. 1E and see Movie 3 in the supplementary material).
Ascidian embryos exhibit complex and dynamic behaviors at the notochord boundary
The failure of chm notochord cells to either form or respect a
morphological boundary between themselves and the flanking tissues is
reminiscent of the process of boundary capture that has been described in
Xenopus embryos, whereby intercalating axial and paraxial mesodermal
cells become quiescent on surfaces contacting the nascent notochord/somite
boundary (Keller et al., 1989
;
Shih and Keller, 1992a
;
Wallingford et al., 2002
).
Although time-lapse studies of ascidian notochord morphogenesis have been
reported, none have focused on the morphogenetic processes at the notochord
boundary (Miyamoto and Crowther,
1985
; Munro and Odell,
2002b
). To better characterize these processes in wild-type
ascidians, we made use of the strikingly transparent embryos of Ascidiella
aspersa (Berrill, 1930
),
which allow much higher quality DIC imaging than in Ciona (see Movie
4 in the supplementary material).
At the beginning of intercalation, the notochord primordium was difficult to distinguish from the surrounding cells, but as intercalation proceeded it became increasingly distinct (Fig. 2A). This is largely a result of the notochord cells each forming a neat, flat edge with the flanking muscle cells. Tracking of individual notochord cells revealed that they did not simply become quiescent on surfaces contacting the boundary, but that they actively and rapidly spread out as they made contact (e.g. the yellow cell as it approached and contacted the boundary in Fig. 2B). A cell newly contacting the boundary often partially displaced its neighbors before they re-established an equilibrium of boundary contact (e.g. the green cell displaced its yellow neighbor on contact with the boundary in Fig. 2B). We also note that notochord cell nuclei became polarized away from the notochord boundary (Fig. 2B).
|
We also observed rhythmic pulsatile behaviors at the lateral edges of the
notochord cells that persisted long after intercalation (see Movie 4 in the
supplementary material). Miyamoto and Crowther observed a similar behavior in
Ciona, which they suggested might be a form of blebbing involved in
secreting the perinotochordal basement membrane
(Miyamoto and Crowther, 1985
).
In our high-resolution recordings, these pulsatile movements did not appear to
be blebbiform in nature, and we hypothesize that they may be involved in
breaking and reforming adhesions as the boundary remodels itself during
post-intercalation tail extension.
chm shows persistent notochord cell motility
Although Ciona is not as well suited to live imaging as
Ascidiella, we were previously able to use time-lapse microscopy of
the bra:GFP transgene to show persistent notochord cell motility in
chm (Deschet et al.,
2003
) (see Movie 5 in the supplementary material). Those
wide-field images were unable, however, to resolve individual notochord cells.
Here we used confocal microscopy to image GFP-expressing chm
notochord cells as they migrated to the periphery of the tail (see Movie 6 in
the supplementary material). In the time-lapse sequence shown in
Fig. 2D, one small group of
cells that was initially contiguous with the main mass of the notochord (blue
arrowhead) broke away and migrated toward the tip of the tail (red arrowhead).
These cells showed rapid and largely undirected lamelliform protrusions that
were absent at this stage in the notochord cells of wild-type siblings
(Fig. 2E).
chm is Cs-lam
3/4/5
The aberrant cell morphology and movement of the chm notochord
cells suggests two main hypotheses: chm might represent a defect in
adhesion between notochord cells or it might reflect a failure to form a
basement membrane or other barrier between the notochord and flanking tissues.
To distinguish between these and other possibilities, we used amplified
fragment length polymorphism analysis on bulked pools of segregants (AFLP-BSA)
to map chm, initially finding two potentially linked markers on
paired scaffold 44 (now part of reftig 96) and one on paired scaffold 312 (now
part of reftig 19) of the partially assembled C. savignyi genome
(Fig. 3A). An examination of
potential open reading frames revealed that these two genomic scaffolds
encoded the C- and N-terminal regions, respectively, of a predicted alpha
laminin gene. An alpha laminin cDNA that spans these two scaffolds confirmed
that they were contiguous. Single-strand confirmation polymorphism (SSCP)
confirmed tight genetic linkage at the alpha laminin locus (SSCP2;
Fig. 3A) and partial linkage
near the most distant AFLP marker (SSCP1;
Fig. 3A).
Laminins are polymeric heterotrimers of large alpha, beta and gamma chains
that are important components of the basement membranes (basal laminae) that
serve to adhere cells and separate tissues
(Sasaki et al., 2004
). Given
that chm is defective in forming a morphological boundary between the
notochord and its flanking tissues, a basement membrane component such as a
laminin was a strong candidate gene. A phylogenetic analysis revealed that
this gene was one of only two C. savignyi alpha laminins, and was
most closely related to vertebrate alpha 3, 4 and 5 laminins (see Fig. S1 in
the supplementary material). Accordingly, we named it
Cs-lam
3/4/5.
|
3/4/5 message showed
that it was strongly expressed in the notochord during tail extension
(Fig. 3B,C,D). There was also
faint expression throughout the tail and the epidermis at later stages. In
chm, Cs-lam
3/4/5 RNA expression was greatly reduced and the
strong notochord-specific expression was eliminated
(Fig. 3F). Both the strong
notochordal expression and the decreased expression in chm mutant
embryos are consistent with Cs-lam
3/4/5 being
chm.
To further investigate Cs-lam
3/4/5 as a candidate for
chm, fertilized eggs were injected with either sense or antisense MOs
corresponding to the predicted start codon and adjacent 3' nucleotides
of Cs-lam
3/4/5. The majority of embryos injected with the
antisense MO showed a short tail and epidermal protrusion phenotype
characteristic of chm [74% (n=23) and 83% (n=24),
for two independent experiments]. The two larvae presented in
Fig. 3H,I show the range of
phenotypes observed, which closely mirrored the range of phenotypes seen in
chm/chm embryos. By contrast, none of the embryos injected
with the control sense MO showed this chm-like phenotype
(n=62 and 99, for the two experiments, and
Fig. 3G). To further examine
the morphant phenotype, we also injected the Cs-lam
3/4/5
antisense morpholino into eggs fertilized with sperm carrying the
bra:GFP transgene. This revealed an irregular notochord boundary with
notochord cells widely dispersed in the tail
(Fig. 3J), exactly as seen in
the chm mutant (Fig.
1E). Other aspects of chm were also closely phenocopied,
including the formation of a long epidermal protrusion at the tip of the
tail.
Sequencing of Cs-lam
3/4/5 cDNAs from chm and two
wild-type alleles revealed multiple non-synonymous polymorphisms, and a
splicing variation found only in chm that created a 9 amino acid
insertion (Fig. 3K). A second
non-complementing allele, chm35, was isolated in a screen
for spontaneous mutations in the wild C. savignyi population
(Hendrickson et al., 2004
).
chm35 was phenotypically indistinguishable from
chm, and also showed tight genetic linkage to Cs-lam
3/4/5 (see
Fig. S2 in the supplementary material). Nucleotide sequence analysis of
Cs-lam
3/4/5 cDNA and genomic DNA from
chm35 identified a frameshift mutation early in the
laminin I domain predicted to cause truncation of nearly half the protein
(Fig. 3K,L). The tight genetic
linkage, expression pattern, reduced expression in chm, morpholino
phenocopy and definitive frameshift mutation in chm35 all
support the conclusion that the two alleles of chm both have lesions
in the Cs-lam
3/4/5 gene.
Cs-lam
3/4/5 protein is localized to perinotochordal surfaces
Given the chm phenotype, we hypothesized that
Cs-lam
3/4/5 might be a component of a perinotochordal ECM.
Perinotochordal basement membranes have been described in the mature
notochords of many species, where they are thought to form an inelastic sheath
that opposes the turgor pressure generated by vacuolization
(Stemple, 2005
). Earlier
developmental roles for perinotochordal ECM molecules are not as well
established. Perinotochordal ECM has been observed in Ciona embryos
by electron microscopy as early as tailbud stage, but does not form a thick,
multilayered basement membrane until much later, during vacuolization
(Cloney, 1964
). Although the
molecular composition of the ascidian perinotochordal ECM is unknown, laminins
are known to be important components of the zebrafish perinotochordal basement
membrane (Scott and Stemple,
2005
).
We raised a rabbit polyclonal antibody against a bacterially expressed
segment of Cs-lam
3/4/5 that is not conserved in the second
C. savignyi alpha laminin gene. Staining was first evident at neurula
stage as a faint, irregular outline around the outside of the notochord
primordium (Fig. 4A). By early
tailbud stage there was robust staining around the notochord primordium as
well as expression between the epidermis and the underlying tissues
(Fig. 4B). By late tail
extension stage the perinotochordal staining was stronger yet
(Fig. 4C). In tangential
optical sections, longitudinal fibers could be seen along the notochord
surface (Fig. 4D). In
reconstructed z-sections, the strongest staining was around the notochord, but
it also demarcated all of the major tissues in the tail: notochord, muscle,
epidermis, nerve cord and endodermal strand
(Fig. 4E). There was also
peripheral epidermal staining that was somewhat variable dependent on the
proteinase treatment necessary to unmask the laminin epitope.
|
3/4/5 by electroporation
also gave rise to increased staining in the expressing cells
(Fig. 4L,M). We conclude that
the antibody is a faithful probe for Cs-lam
3/4/5 protein
localization and that the perinotochordal staining observed is fully
consistent with a role as a perinotochordal basement membrane component
involved in notochord boundary formation. The subectodermal staining is also
consistent with the epidermal tail protrusion phenotype, which may involve
decreased adhesion between the ectoderm and underlying tissues.
Cs-lam
3/4/5 polarity is perturbed in the PCP mutant aim
To examine potential interactions between the PCP pathway and
laminin-mediated boundary formation, we stained aim embryos with the
Cs-lam
3/4/5 antibody. The perinotochordal staining remained
robust, but we also observed large patches of staining deep within the
notochord, between adjacent cells (Fig.
4G-J). This internal laminin expression was typically quite mild
at early stages and became progressively more severe over time, suggesting
that PCP signaling is involved in maintenance rather than establishment of
Cs-lam
3/4/5 polarization.
Laminin-mediated boundary formation can drive considerable tail elongation in the absence of PCP signaling
The observation of ectopic intranotochordal laminin in aim embryos
caused us to reconsider aspects of the aim phenotype. It was
previously shown that aim notochord cells have a near-complete loss
of the mediolateral bias in actin-rich cell protrusions thought to drive
intercalation (Jiang et al.,
2005
; Munro and Odell,
2002b
). Such measurements were made, however, only very early in
the process of intercalation, and the aim notochord does continue to
intercalate, albeit very slowly, such that it eventually becomes approximately
two cells wide.
In Fig. 5A,B, we compare an
early-tailbud-stage wild-type embryo with a considerably (
2 hours) older
aim embryo, in order to compare embryos at a similar degree of
intercalation. (A wild-type embryo of identical age to
Fig. 5B has already completed
intercalation, as shown in Fig.
1D,F.) Although they had notochords of roughly comparable length
and width, the aim notochord cells were less mediolaterally elongated
than in wild type, and they failed to polarize their nuclei away from the
notochord boundary. Despite these differences, the aim notochord
cells were, in many respects, relatively normal: they formed a neat, flat edge
with the flanking muscle cells; they showed a degree of mediolateral
elongation; and they typically showed concentrations of actin on medial cell
surfaces opposite the notochord boundary and not on their anterior and
posterior edges (white arrowheads in Fig.
5B).
|
|
3/4/5-mediated
boundary formation, given that aim embryos form a smooth and compact
notochord boundary. To test this hypothesis, we constructed the
aim/aim;chm/chm double mutant. Unlike
either single mutant, the double mutant showed essentially no tail extension
(Fig. 5C), but still had the
normal number of brachyury-expressing notochord cells
(Fig. 5D and data not shown;
for molecular genotyping of these phenotypic classes, see Fig. S3 in the
supplementary material). With the exception of a small number of notochord
cells that migrated between the two blocks of muscle cells (probably the
secondary notochord lineage), the majority of notochord cells remained in an
isodiametric group comparable to the wild-type notochord primordium before the
onset of intercalation (compare Fig.
5D with
5E). Having shown that
laminin-mediated boundary formation is sufficient to drive considerable tail
elongation in the absence of PCP signaling, one question that remains is why
aim embryos fail to complete intercalation, given that they do slowly
develop polarized cell morphologies. We suggest that this may reflect the
observed failure to maintain the perinotochordal/intranotochordal polarity of
ECM proteins such as laminin, giving rise to an ectopic basement membrane on
intranotochordal surfaces and preventing further intercalation. See
Fig. 6 for a diagram of this
model. | DISCUSSION |
|---|
|
|
|---|
While numerous genetic, pharmacological and embryological approaches have
been used to study notochord development in many model systems, the severe
phenotype seen in chm has not been described in other contexts. In
Xenopus embryos, perturbations of perinotochordal ECM molecules such
as fibrillin and fibronectin cause convergent extension phenotypes that may
reflect defects in boundary capture, but do not cause a wholesale disruption
of the notochord boundary as seen in chm
(Davidson et al., 2006
;
Skoglund and Keller, 2006
). We
suggest that laminins be considered candidate vertebrate boundary capture
signals.
The 3D tissue architecture of the converging and extending ascidian
notochord is quite complex. As it narrows and lengthens, it not only
intercalates but also undergoes a ventrally-oriented invagination movement
that transforms it from a sheet to a rod
(Munro and Odell, 2002b
).
Although it is clear that morphogenetic processes at the notochord boundary
are of great importance in shaping the ascidian notochord, it is not clear if
there is a morphologically distinct population of border cells. It is possible
that all notochord cells are, at some dorsoventral position, in partial
contact with the nascent perinotochordal boundary from the earliest stages,
and that what is presented in Fig.
6 as cells being trapped de novo by the boundary actually
represents cells expanding the fraction of their periphery in contact with the
boundary. Competition for an initially limiting expanse of bounding surfaces
may help explain the extreme length-to-width ratios
(Munro and Odell, 2002b
) of
the disk-shaped cells in the just-intercalated notochord.
Laminins in notochord morphogenesis
Although it is possible that a specific role for laminin in notochord
boundary formation is unique to the ascidians, we argue that the novelty of
the chm phenotype is likely to reflect the morphological simplicity
of the ascidian embryo and the genomic simplicity of its complement of ECM
components. In vertebrates, for example, there are typically five alpha, four
beta and three gamma laminin subunits (Li
et al., 2003
), as opposed to two alpha, one beta and one gamma in
ascidians (Sasakura et al.,
2003
). Analysis of the large set of murine laminins has been
complicated by essential early roles in preimplantation development in
addition to considerable redundancy and compensation between various family
members (Li et al., 2003
).
Laminins are clearly important for vertebrate notochord development, as
indicated by the zebrafish mutations bashful (lam
1),
grumpy (lamβ1) and sleepy (lam
1), which have
later roles in notochord differentiation
(Parsons et al., 2002
;
Pollard et al., 2006
). While
grumpy and sleepy mutants show a nearly complete absence of
reactivity to a mouse laminin-1 antibody
(Parsons et al., 2002
), it is
likely that there is still considerable functional redundancy between the
zebrafish laminins that may mask a more chm-like phenotype. For
example, injection of lam
5 morpholino into bashful causes a
severe disruption of notochord and other tissues that has not been
characterized in detail (Pollard et al.,
2006
). A convergent extension phenotype has also been seen in
zebrafish embryos depleted of a galactosyl-transferase important in
post-translational modifications of laminin
(Machingo et al., 2006
).
PCP signaling and the ECM
Recent work suggests that there may be important interactions between
vertebrate PCP signaling and the extracellular matrix. The PCP proteins
Prickle, Strabismus and Dishevelled have been shown to be important in
restricting fibronectin protein localization to the outer surfaces of the
Xenopus notochord (Goto et al.,
2005
), similar to what we observe with laminin localization in the
Cs-pk mutation aim. Tissue separation defects have also been
described in Xenopus and zebrafish embryos with perturbed
non-canonical Wnt/PCP signaling (Ulrich et
al., 2003
; Winklbauer et al.,
2001
). It may be of considerable interest to look for defects in
polarized ECM deposition in zebrafish PCP mutants and other contexts that have
previously been interpreted strictly in terms of perturbed cell motility.
Interactions between PCP signaling and laminin-mediated boundary formation
Unlike in aim mutants, early notochord intercalation in
chm is relatively normal and then becomes progressively more
aberrant, suggesting that one role of the notochord boundary is to maintain
polarized cell behaviors initiated by PCP signaling.
Cs-lam
3/4/5-mediated boundary formation is able, however, to
cause considerable narrowing and lengthening of the notochord even in the
absence of a functional PCP pathway, as indicated by the near-complete loss of
convergence and extension in the
aim/aim;chm/chm double mutant compared
with aim/aim. As prickle and Cs-lam
3/4/5 are
predominantly expressed in the notochord, the severity of this phenotype
suggests that the ascidian muscle and neural plate do not have a strong
ability to autonomously converge and extend as seen in vertebrates.
Although the double mutant phenotype indicates that aim and
chm act largely in parallel, the observation of intranotochordal
laminin in aim embryos suggests that there is a more complex
relationship. As this intranotochordal staining is initially minimal and
becomes progressively stronger over time, it appears that PCP signaling is
involved in the maintenance rather than the initial establishment of
perinotochordal ECM polarity. The aim mutation truncates much of the
Cs-Pk protein, causes a complete loss of membrane localization of the
PCP effector molecule Dishevelled, and shows no maternal effect
(Jiang et al., 2005
), so the
aim phenotype probably reflects a complete loss of Pk function. We
cannot fully exclude, however, that there may be residual function in
chm or aim that might confound epistasis analysis. It will
be of great interest to determine whether perinotochordal laminin localization
involves polarized secretion, stabilization or degradation, and how later
perinotochordal/intranotochordal polarity relates to earlier mediolateral
polarity. We suggest that PCP signaling has multiple distinct functions in
ascidian notochord morphogenesis, including an early role in the mediolateral
polarity of tractive cell protrusions
(Jiang et al., 2005
), a
subsequent role in maintaining polarized ECM localization (this study), a role
in polarizing cell nuclei away from the boundary late in intercalation (this
study), and a role in anteroposterior polarity after intercalation is complete
(Jiang et al., 2005
). Advanced
imaging methods will probably be of great importance in supporting and
extending these models of notochord morphogenesis.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/1/33/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Arenas-Mena, C., Cameron, A. R. and Davidson, E. H.
(2000). Spatial expression of Hox cluster genes in the ontogeny
of a sea urchin. Development
127,4631
-4643.[Abstract]
Berrill, N. J. (1930). Studies in tunicate
development. Part I. General physiology of development of simple Ascidians.
Philos. Trans. R. Soc. Lond. B Biol. Sci.
218, 37-78.
Cloney, R. A. (1964). Development of the
ascidian notochord. Acta Embryol. Morphol. Exp.
7, 111-130.
Corbo, J. C., Levine, M. and Zeller, R. W.
(1997). Characterization of a notochord-specific enhancer from
the Brachyury promoter region of the ascidian, Ciona intestinalis.
Development 124,589
-602.
Davidson, L. A., Marsden, M., Keller, R. and Desimone, D. W.
(2006). Integrin alpha5beta1 and fibronectin regulate polarized
cell protrusions required for Xenopus convergence and extension.
Curr. Biol. 16,833
-844.[CrossRef][Medline]
Deschet, K., Nakatani, Y. and Smith, W. C.
(2003). Generation of Ci-Brachyury-GFP stable transgenic lines in
the ascidian Ciona savignyi. Genesis
35,248
-259.
Fujiwara, S., Corbo, J. C. and Levine, M.
(1998). The snail repressor establishes a muscle/notochord
boundary in the Ciona embryo. Development
125,2511
-2520.[Abstract]
Goto, T., Davidson, L., Asashima, M. and Keller, R.
(2005). Planar cell polarity genes regulate polarized
extracellular matrix deposition during frog gastrulation. Curr.
Biol. 15,787
-793.[CrossRef][Medline]
Hendrickson, C., Christiaen, L., Deschet, K., Jiang, D., Joly,
J. S., Legendre, L., Nakatani, Y., Tresser, J. and Smith, W. C.
(2004). Culture of adult ascidians and ascidian genetics.
Methods Cell Biol. 74,143
-170.[Medline]
Hotta, K., Takahashi, H., Erives, A., Levine, M. and Satoh,
N. (1999). Temporal expression patterns of 39
Brachyury-downstream genes associated with notochord formation in the
Ciona intestinalis embryo. Dev. Growth
Differ. 41,657
-664.[CrossRef][Medline]
Hotta, K., Takahashi, H., Asakura, T., Saitoh, B., Takatori, N.,
Satou, Y. and Satoh, N. (2000). Characterization of
Brachyury-downstream notochord genes in the Ciona intestinalis
embryo. Dev. Biol. 224,69
-80.[CrossRef][Medline]
Imai, K. S., Satou, Y. and Satoh, N. (2002).
Multiple functions of a Zic-like gene in the differentiation of notochord,
central nervous system and muscle in Ciona savignyi embryos.
Development 129,2723
-2732.
Imai, K. S., Hino, K., Yagi, K., Satoh, N. and Satou, Y.
(2004). Gene expression profiles of transcription factors and
signaling molecules in the ascidian embryo: towards a comprehensive
understanding of gene networks. Development
131,4047
-4058.
Jiang, D., Munro, E. M. and Smith, W. C.
(2005). Ascidian prickle regulates both mediolateral and
anterior-posterior cell polarity of notochord cells. Curr.
Biol. 15,79
-85.[CrossRef][Medline]
Keller, R. (2002). Shaping the vertebrate body
plan by polarized embryonic cell movements. Science
298,1950
-1954.
Keller, R., Cooper, M. S., Danilchik, M., Tibbetts, P. and
Wilson, P. A. (1989). Cell intercalation during notochord
development in Xenopus laevis. J. Exp. Zool.
251,134
-154.[CrossRef][Medline]
Kirkpatrick, P. and d'Ardenne, A. J. (1984).
Effects of fixation and enzymatic digestion on the immunohistochemical
demonstration of laminin and fibronectin in paraffin embedded tissue.
J. Clin. Pathol. 37,639
-644.
Li, S., Edgar, D., Fassler, R., Wadsworth, W. and Yurchenco, P.
D. (2003). The role of laminin in embryonic cell polarization
and tissue organization. Dev. Cell
4, 613-624.[CrossRef][Medline]
Machingo, Q. J., Fritz, A. and Shur, B. D.
(2006). A beta1, 4-galactosyltransferase is required for
convergent extension movements in zebrafish. Dev.
Biol. 297,471
-482.[CrossRef][Medline]
Marsden, M. and DeSimone, D. W. (2006).
Integrin-ECM interactions regulate cadherin-dependent cell adhesion and are
required for convergent extension in Xenopus. Curr.
Biol. 13,1182
-1191.[CrossRef]
Miyamoto, D. M. and Crowther, R. J. (1985).
Formation of the notochord in living ascidian embryos. J. Embryol.
Exp. Morphol. 86,1
-17.[Medline]
Munro, E. M. and Odell, G. (2002a).
Morphogenetic pattern formation during ascidian notochord formation is
regulative and highly robust. Development
129, 1-12.
Munro, E. M. and Odell, G. M. (2002b).
Polarized basolateral cell motility underlies invagination and convergent
extension of the ascidian notochord. Development
129, 13-24.
Munro, E., Robin, F. and Lemaire, P. (2006).
Cellular morphogenesis in ascidians: how to shape a simple tadpole.
Curr. Opin. Genet. Dev.
16,399
-405.[CrossRef][Medline]
Nakatani, Y., Moody, R. and Smith, W. C.
(1999). Mutations affecting tail and notochord development in the
ascidian Ciona savignyi. Development
126,3293
-3301.[Abstract]
Parsons, M. J., Pollard, S. M., Saude, L., Feldman, B.,
Coutinho, P., Hirst, E. M. and Stemple, D. L. (2002).
Zebrafish mutants identify an essential role for laminins in notochord
formation. Development
129,3137
-3146.
Pollard, S. M., Parsons, M. J., Kamei, M., Kettleborough, R. N.,
Thomas, K. A., Pham, V. N., Bae, M. K., Scott, A., Weinstein, B. M. and
Stemple, D. L. (2006). Essential and overlapping roles for
laminin alpha chains in notochord and blood vessel formation. Dev.
Biol. 289,64
-76.[CrossRef][Medline]
Reintsch, W. E., Habring-Mueller, A., Wang, R. W., Schohl, A.
and Fagotto, F. (2005). Beta-catenin controls cell sorting at
the notochord-somite boundary independently of cadherin-mediated adhesion.
J. Cell Biol. 170,675
-686.
Sasaki, T., Fassler, R. and Hohenester, E.
(2004). Laminin: the crux of basement membrane assembly.
J. Cell Biol. 164,959
-963.
Sasakura, Y., Shoguchi, E., Takatori, N., Wada, S.,
Meinertzhagen, I. A., Satou, Y. and Satoh, N. (2003). A
genomewide survey of developmentally relevant genes in Ciona
intestinalis. X. Genes for cell junctions and extracellular matrix.
Dev. Genes Evol. 213,303
-313.[CrossRef][Medline]
Scott, A. and Stemple, D. L. (2005). Zebrafish
notochordal basement membrane: signaling and structure. Curr. Top.
Dev. Biol. 65,229
-253.[Medline]
Shih, J. and Keller, R. (1992a). Cell motility
driving mediolateral intercalation in explants of Xenopus laevis.
Development 116,901
-914.
Shih, J. and Keller, R. (1992b). Patterns of
cell motility in the organizer and dorsal mesoderm of Xenopus laevis.
Development 116,915
-930.[Abstract]
Skoglund, P. and Keller, R. (2006).
Xenopus fibrillin regulates directed convergence and extension.
Dev. Biol. 301,404
-416.[CrossRef][Medline]
Stemple, D. L. (2005). Structure and function
of the notochord: an essential organ for chordate development.
Development 132,2503
-2512.
Ulrich, F., Concha, M. L., Heid, P. J., Voss, E., Witzel, S.,
Roehl, H., Tada, M., Wilson, S. W., Adams, R. J., Soll, D. R. et al.
(2003). Slb/Wnt11 controls hypoblast cell migration and
morphogenesis at the onset of zebrafish gastrulation.
Development 130,5375
-5384.
Veeman, M. T., Axelrod, J. D. and Moon, R. T.
(2003). A second canon. Functions and mechanisms of
beta-catenin-independent Wnt signaling. Dev. Cell
5, 367-377.[CrossRef][Medline]
Wallingford, J. B., Fraser, S. E. and Harland, R. M.
(2002). Convergent extension: the molecular control of polarized
cell movement during embryonic development. Dev. Cell
2, 695-706.[CrossRef][Medline]
Wang, Y. and Nathans, J. (2007). Tissue/planar
cell polarity in vertebrates: new insights and new questions.
Development 134,647
-658.
Winklbauer, R., Medina, A., Swain, R. K. and Steinbeisser,
H. (2001). Frizzled-7 signalling controls tissue separation
during Xenopus gastrulation. Nature
413,856
-860.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Tao, M. Suzuki, H. Kiyonari, T. Abe, T. Sasaoka, and N. Ueno Mouse prickle1, the homolog of a PCP gene, is essential for epiblast apical-basal polarity PNAS, August 25, 2009; 106(34): 14426 - 14431. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li and A. T. Dudley Noncanonical frizzled signaling regulates cell polarity of growth plate chondrocytes Development, April 1, 2009; 136(7): 1083 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chiba, D. Jiang, N. Satoh, and W. C. Smith brachyury null mutant-induced defects in juvenile ascidian endodermal organs Development, January 1, 2009; 136(1): 35 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Hill, K. W. Broman, E. Stupka, W. C. Smith, D. Jiang, and A. Sidow The C. savignyi genetic map and its integration with the reference sequence facilitates insights into chordate genome evolution Genome Res., August 1, 2008; 18(8): 1369 - 1379. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||