DEV010892 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure S1 -

  Fig. S1. Phylogeny of Ciona savignyi alpha laminin genes. Neighbor-joining tree depicting the relationships of C. savignyi alpha laminin genes. Bootstrap values are indicated at the appropriate nodes. Branch lengths are drawn to scale; scale bar indicates changes per amino acid position. Clustal W was used to make an amino acid alignment of the known or predicted alpha laminins from C. savignyi, D. melanogaster, M. musculus and H. sapiens. A phylogenetic analysis was performed using the neighbor-joining (Saitou and Nei, 1987) option of PAUP 4.0 beta 10 Swofford, D. L. (2002). PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4. Sinauer Associates, Sunderland, Massachusetts, USA, using the midpoint rooting function. A 1000-replicate bootstrap of the dataset was performed using the neighbor-joining/upgma function with bootstrap values greater than 50% indicated on the neighbor-joining tree.

  Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425.

• Supplemental Figure S2 -

  Fig. S2. Cs-lamα3/4/5 expression and linkage in chm³⁵. (A) RT-PCR for Cs-lamα3/4/5 and cellulose synthase (control), showing decreased Cs-lamα3/4/5 expression in chm³⁵. (B) Cs-lamα3/4/5 SNP mapping in chm³⁵. A region of Cs-lamα3/4/5 was PCR amplified and directly sequenced from pools of chm³⁵ tadpole larvae and their wild-type siblings. Only a single allele is seen in the mutant pool at two sites that are polymorphic in the wild-type pool, indicating tight linkage between chm³⁵ and Cs-lamα3/4/5.

• Supplemental Figure S3 -

  Fig. S3. Confirmatory genotyping of the phenotypes segregating in an aim/+;chm/+ intercross. Single larva genotyping of the progeny from a cross between aim/+;chm/+ parents. Five larvae from each of the phenotypic classes shown in Fig. 5C were genotyped to confirm that the most severe phenotype is indeed the aim/aim;chm/chm double mutant. chm was genotyped by a SNP in an intron of Cs-lamα3/4/5 (lam). aim was genotyped by an intronic amplification length polymorphism in Cs-pk (pk). Embryos from the most severe phenotypic class always showed the mutant allele for both genes, confirming that they were the double homozygotes. No obvious dominant suppression or enhancement was observed. Oligos: Cs-pk, TACCACAAATCGCAGGACTACTCAT and CCAAACACTTCCGCAACCGGGACCGAGGTT; Cs-lamα3/4/5, GTGCGCGGTAGAGTGTCAGATGGGTGCAAC and CGGAGTGAGCAGCAGCTGCACCCCAACACAGT.

• Movie 1 -

  Movie 1. Wild-type notochord morphology. Three-dimensional confocal volume rendering of a wild-type mid-tailbud stage embryo. The notochord is shown in green using a stable brachyury:GFP transgene and cell peripheries are shown in red by phalloidin staining.

• Movie 2 -

  Movie 2. chongmague notochord morphology. Three-dimensional confocal volume rendering of a chongmague mid-tailbud stage embryo. The notochord is shown in green using a stable brachyury:GFP transgene and cell peripheries are shown in red by phalloidin staining.

• Movie 3 -

  Movie 3. Formation of the chongmague epidermal protrusion. Timelapse of a chongmague tailbud stage embryo showing the epidermal phenotype. The epidermis progressively extends posteriorly from the tail in the absence of elongating mesoderm underneath.

• Movie 4 -

  Movie 4. Timelapse of ascidian notochord morphogenesis. Differential interference contrast timelapse of notochord morphogenesis in an Ascidiella aspersa embryo from neurula to late tailbud stages. Many complex cell behaviors are apparent, including cell intercalation, rapid spreading as notochord cells contact the boundary, shearing between the notochord and muscle cell layers, and persistent lateral protrusive behaviors.

• Movie 5 -

  Movie 5. Aberrant notochord cell behaviors in chongmague (widefield). Widefield timelapse of notochord-specific brachyury:GFP in several embryos from a chongmague heterozygote intercross. Two homozygous chm embryos are present in the field and are evident by their failure to elongate and the persistent motility of the notochord cells.

• Movie 6 -

  Movie 6. Aberrant notochord cell behaviors in chongmague (confocal). Confocal timelapse of GFP-expressing notochord cells in a chongmague embryo. Anterior is to the left and posterior to the right. Note the persistent and undirected protrusive activity of many cells and the separation of two cells away from the main mass of the notochord at its posterior tip.