|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 28 November 2007
doi: 10.1242/dev.004713
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biological Sciences, University of Iowa, Iowa City, IA 52242,
USA.
2 Department of Anatomy and Cell Biology, University of Iowa, Iowa City, IA
52242, USA.
* Author for correspondence (e-mail: diane-slusarski{at}uiowa.edu)
Accepted 10 October 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Calcium, Laterality, β-catenin, Zebrafish, Xenopus, Dorsal forerunner cells
| INTRODUCTION |
|---|
|
|
|---|
In the zebrafish, a structure called Kuppfer's Vesicle (KV) is structurally
and functionally homologous to the node, and cilia in the KV are thought to
generate critical laterality signals that are propagated to the LPM. The KV is
derived from a cluster of non-involuting cells called the dorsal forerunner
cells (DFCs), which migrate ahead of the dorsal blastoderm during
gastrulation. These cells contribute to both the tailbud and the KV during
somite stages (Cooper and D'Amico,
1996
; Melby et al.,
1996
). Furthermore, the DFCs express several genes required for LR
patterning and ablation of DFCs disrupts LR patterning
(Amack and Yost, 2004
;
Essner et al., 2005
).
Studies in several vertebrate model organisms implicated a requirement for
Ca2+ signals in LR asymmetry, downstream of fluid flow in the node
(Hirokawa et al., 2006
) and/or
of H+/K+ ATPase activity (reviewed by
Tabin, 2006
). Leftward fluid
flow within the node, generated by left-right dynein containing cilia, is
thought to stimulate mechanosensory cilia at the node periphery. These cilia
contain polycystin-2/PKD-2, a Ca2+-permeable cation channel, and
their stimulation triggers elevated intracellular Ca2+ levels at
the left edge of the mouse node (McGrath
et al., 2003
). In zebrafish, Ca2+ fluxes near the
zebrafish KV have been reported and are proposed to be required for normal LR
patterning (Sarmah et al.,
2005
). Additionally, zebrafish embryos mutant for pkd2
have disrupted expression of laterality markers and organ laterality defects
(Schottenfeld et al., 2007
).
Although the mouse and zebrafish loss-of-function phenotypes are not
identical, both models implicate a role for Ca2+ release. In an
alternative mouse model, the leftward flow of vesicular particles containing
sonic hedgehog (shh) has been postulated to act in a
distinct atypical signaling pathway to activate Ca2+ on the left
side of the node (Tanaka et al.,
2005
). Elevated Ca2+, in either case, is thought to act
via an unknown mechanism, to induce left-sided gene expression
(Brennan et al., 2002
;
Hashimoto et al., 2004
;
Marques et al., 2004
).
In contrast to intracellular Ca2+ release, a role for left-sided
elevation of extracellular Ca2+ has also been proposed. In the
chick, differential H+/K+ ATPase activity is thought to
set up a spatial gradient of extracellular Ca2+ by the end of
gastrulation, which may be sensed by Notch to activate asymmetrical gene
expression (Raya et al.,
2004
). In zebrafish, disruption of H+/K+
ATPase activity also leads to LR asymmetry defects
(Kawakami et al., 2005
) and
disrupts KV cilia number and length (Adams
et al., 2006
). However, in these studies, it was unclear whether
intracellular Ca2+ was also increased on the left side of the
node/KV. Also, in the case of H+/K+ ATPase inhibition,
shh was induced ectopically, an event which could influence
laterality.
Thus, several vertebrate models implicate a role for Ca2+
signaling in LR asymmetry (Shimeld,
2004
), and the data are consistent with a function downstream of
H+/K+ ATPase or node/KV cilia during somitogenesis.
However, it has not been determined whether Ca2+ release also has a
role in parallel or upstream to KV/node formation and function. In this study,
we identified endogenous Ca2+ release in the DFC region after the
onset of gastrulation, distinct from the events described above and prior to
cilia and KV formation. We show that transient inhibition of this
Ca2+ release results in altered expression of asymmetric markers
such as southpaw, lefty1/2 and pitx2, randomized placement
of organs relative to the LR axis, all preceded by the reduction/loss of KV
formation. We further provide several lines of evidence to suggest that the
regulation of β-catenin activity is a critical target of Ca2+
in the DFCs. First, we show that inhibition of Ca2+ release in the
DFC region causes a marked increase in nuclear β-catenin and
β-catenin transcriptional activity. Second, targeted activation of
β-catenin in the DFCs is sufficient to alter laterality. Finally, we
describe cells with DFC-like properties in Xenopus and establish that
the epiboly/gastrula Ca2+-sensitive event is conserved in frogs, as
a pulse of Ca2+ inhibition in Xenopus leads to altered
organ laterality and nodal expression as well as ectopic accumulation of
β-catenin. Thus, in addition to conserved node-like/cilia development in
fish and frog, our results indicate a conserved early Ca2+
requirement in LR patterning.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Pharmacological reagents
Thapsigargin (2.5 µM; Molecular Probes), BODIPY-FL-Thapsigargin (2.5
µM; Molecular Probes), Cyclopiazonic Acid (200 µM; Calbiochem) or
Valproic Acid (0.2 mM; Sigma) were diluted in embryo medium. Zebrafish embryos
were incubated in thapsigargin for the indicated time and then washed three
times in embryo medium. Xenopus (stage 11.5) were incubated for 20
minutes in thapsigargin. Xestospongin C (1-2 µM; Calbiochem), was
co-injected with Texas Red lineage marker (Molecular Probes) into the yolk of
256- to 512-cell embryos.
Morpholino antisense oligonucleotides (MO)
Control: CCTCTTACCTCAGTTACAATTTATA and Axin1: ACTCATGCTCATAGTGTCCCTGCAC MOs
were purchased from Gene Tools, LLC. MO (8 ng) or in vitro transcribed
β-catenin 55C RNA (70-100 ng/µl) was co-injected with Texas Red
lineage marker (Molecular Probes) into the yolk of 256-512 cell embryos.
LR scoring and whole-mount in situ hybridization (WISH)
Zebrafish cardiac jogging and looping was assessed by light microscopy or
by WISH with nkx2.5. Gut looping was determined by foxA3 at
48-52 hpf. Xenopus heart and gut orientation was scored under a light
microscope (stage 44-46) and laterality was monitored by xnr1
expression (stage 22-24). For all manipulations, embryos were fixed in 4%
paraformaldehyde/1xPBS. Digoxygenin-labeled RNA probes (Roche) were
synthesized using linearized templates and the appropriate RNA polymerase.
Zebrafish and Xenopus hybridizations were done as described
(Long et al., 2003
;
Houston and Wylie, 2005
).
TopFlash assay
Zebrafish embryos were injected with either TopFlash or FopFlash as
previously described (Park and Moon,
2002
), incubated until epiboly stage and treated with thapsigargin
or DMSO for 10 minutes at 60% epiboly. After three to five washes with embryo
medium, excess medium was removed and embryos were flash frozen at the
indicated time (20 or 60 minutes after drug application). Triplicate samples
of 15 embryos each were used for TopFlash/FopFlash dual luciferase assays
performed following manufacturer instructions (Promega). Luminescence was
detected in a Turner Biosystems 20/20n Luminometer.
Immunolocalization
Immunofluorescence was performed according to a standard protocol using
anti-acetylated tubulin (Sigma), β-catenin (Sigma) or Ntl (a gift from Dr
D. J. Grunwald, University of Utah) followed by fluorescent secondary antibody
(Alexa Fluor 488, Molecular Probes) or conjugated anti-horseradish peroxidase
(Jackson ImmunoResearch). Confocal image stacks collected at 2 µm intervals
were evaluated for nuclear β-catenin.
Syto-11
Syto-11 (Molecular Probes) was diluted in embryo medium to a final
concentration of 7.5 µM. Control solution was 2% DMSO in embryo medium.
Zebrafish (70% epiboly) and Xenopus (stage 11.5) were soaked in
Syto-11 for 30 minutes and washed out with excess medium.
Calcium imaging
Zebrafish embryos (one-cell) injected with Fura-2 (dextran-conjugated,
Molecular Probes) were oriented with the dorsal shield location noted before
collection. The instrumentation for data collection, image analysis software
and data manipulations were as described
(Slusarski and Corces,
2000
).
| RESULTS |
|---|
|
|
|---|
To visualize spatial and temporal changes in live embryos during
epiboly/gastrulation, we used the ratiometric Ca2+ sensor Fura-2, a
reliable measure of intracellular Ca2+
(Grynkiewicz et al., 1985
). As
described in the introduction, Ca2+ indicators have been used to
investigate the role of Ca2+ in LR patterning. Most of the commonly
used Ca2+ indicators utilize single wavelength excitation and have
the potential to interpret signal artifacts as Ca2+-dependent
changes. Dual-wavelength detection of Fura-2 has reduced sensitivity to signal
artifacts and enables quantitative measurement of Ca2+
concentrations. In addition, Fura-2 is less prone to photobleaching (the
irreversible destruction of fluorophores) allowing for extended imaging over a
developmental time point. Using Fura-2 imaging in zebrafish, we detected
localized Ca2+ release activity in the shield/DFC region between
60-90% epiboly. In a lateral view of a bright field image, the DFCs resided at
the leading edge ahead of the shield region
(Fig. 1A, arrow). A single
frame of the raw Fura-2 fluorescence of an embryo in a lateral orientation
with the shield to the right (Fig.
1B, arrow) and the associated ratio image
(Fig. 1C, arrow) demonstrates
localized Ca2+ release activity in the region of the DFCs. The
transient Ca2+ release in the DFC region was most active during
60-70% epiboly and became less active after 75-80% epiboly (see Movie 1 in the
supplementary material).
|
Ca2+ inhibition alters organ and molecular LR asymmetry
Heart jogging is one of the first morphological indications of organ LR
asymmetry in zebrafish. At 24-30 hpf, the heart tube elongates from the
midline and bends, or `jogs', to the left. To evaluate heart asymmetry embryos
can be scored for leftward, rightward or no jog bias
(Chen et al., 1997
). In
untreated, wild-type (wt), embryos, the heart jogged to the left in 95% of the
embryos (Fig. 1H and
Fig. 2A). In
thapsigargin-treated embryos, jogging was randomized, as the heart tube
migrated leftward (43%), rightward (25%), or remained in the middle (32%)
(Fig. 1H and
Fig. 2A-C). A conserved aspect
of LR asymmetry among vertebrates is a later morphological looping of the
heart, which typically forms a D-loop that places the zebrafish ventricle
anterior and to the right of the atrium. In thapsigargin-treated embryos there
was concordance between cardiac jogging and looping (see Table S1 in the
supplementary material).
If Ca2+ inhibition during epiboly disrupts a key LR signal, then the placement of other asymmetrically oriented organs, in addition to the heart, should be altered. This could manifest itself either as heterotaxia (organs adopting laterality independently), or as concordance, which can lead to situs inversus totalis (reversal of all organ LR asymmetries). Embryos sorted by heart jogging were stained for foxA3 expression, a larval gut marker (Fig. 1H and Fig. 2D-F) and we found a tight correlation between heart jogging and gut positioning. These results show that organ laterality defects tend to be coordinated in thapsigargin-treated embryos.
|
The dorsal midline (notochord and floorplate) is important as a barrier for
laterality signals and any gaps in the midline barrier can lead to bilateral
spaw expression (Bisgrove et al.,
2000
; Danos and Yost,
1996
; Meno et al.,
1998
). Thus, we evaluated midline integrity in treated embryos.
DIC optics in live embryos (Fig.
1G, data not shown) as well as prechordal/notochord expression in
the goosecoid-GFP transgenic line
(Doitsidou et al., 2002
)
showed normal midline patterning (see Fig. S2 in the supplementary material).
At the molecular level, we evaluated three independent notochord and/or
floorplate markers (lefty1, ntl and shh) and all three were
normal in thapsigargin-treated embryos
(Fig. 2J-O). In the case of
ntl, we evaluated both RNA (Fig.
2L,M) and protein distribution (see Fig. S2 in the supplementary
material). Since ntl, lefty1 and shh have essential
functions associated with the midline and were expressed, these analyses
confirm that brief (10 minute) thapsigargin treatment does not compromise the
integrity of dorsal midline tissues.
Analysis of DFC Ca2+ source
Thapsigargin treatment of zebrafish embryos yielded dramatic alteration to
laterality without alteration to the midline. Typically thapsigargin treatment
results in inhibition of Ca2+ release. Nevertheless, other studies
use thapsigargin to increase Ca2+ levels, in particular those that
investigate capacitative Ca2+ release. To determine whether
thapsigargin led to an increase or a loss of the DFC regional Ca2+
activity, we performed Fura-2 image analysis in zebrafish embryos at the time
of treatment. After application of thapsigargin, we observed suppression of
the DFC-regional Ca2+ fluxes (see Movie 2 in the supplementary
material). The loss of the DFC Ca2+ release activity upon
thapsigargin treatment supports a role for intracellular Ca2+ in a
subset of cells during epiboly.
|
Ca2+ inhibition disrupts late aspects of DFC development
Since the DFCs are located in the region of endogenous Ca2+
release activity, we investigated DFC specification, migration and endocytic
activity after thapsigargin treatment. Several molecular markers are expressed
in the DFCs during epiboly (squint, left-right dynein-related-1/lrdr1,
ntl and sox17) (Alexander and
Stainier, 1999
; Essner et al.,
2002
; Feldman et al.,
1998
; Schulte-Merker et al.,
1994
). We focused on these markers because three of these genes
(lrdr1, ntl and squint) are required for proper LR
patterning and sox17 can be used to evaluate morphogenesis. In
thapsigargin-treated embryos, robust DFC sox17 expression was
observed at 80% epiboly in a linear domain as opposed to an ovoid shape
observed in controls (Fig.
3A,B). lrdr1 expression at 80% epiboly was similar in wt
and thapsigargin-treated embryos (see Fig. S4 in the supplementary material).
squint expression, a zebrafish nodal-related gene, was also
maintained (data not shown). DFCs expressed both ntl RNA (see Fig. S4
in the supplementary material) and Ntl protein in thapsigargin-treated embryos
but the cells did not expand over the yolk as much as in the control
(Fig. 3C,D). The presence of
early DFC markers supports the fact that Ca2+ inhibition does not
interfere with the specification of the DFCs. However the compact DFC domain
at later epiboly suggests that DFC behavior and or migration may be
altered.
Since DFCs are highly endocytic and readily take up vital dyes, such as
Syto-11 (Cooper and D'Amico,
1996
), we determined whether this aspect of DFC function was
affected. Control and thapsigargin-treated embryos incubated in Syto-11 showed
similar DFC dye uptake, as visualized by fluorescent microscopy. In
thapsigargin-treated embryos, Syto-11 uptake and early migration to the
tailbud region was similar to control-treated embryos (see Fig. S4 in the
supplementary material). We next monitored DFC migration in vivo by using a
GFP transgenic line that marks the DFCs. In the Dusp6:d2EGFP
transgenic line, EGFP was expressed in a fibroblast growth factor
(FGF)-responsive manner in several tissues including the KV and its
progenitors (Molina et al.,
2007
). We directly visualized DFC migration in live embryos from
80% epiboly to four-somite stage (see Movie 3 in the supplementary material).
Migration during epiboly was similar in wt and thapsigargin-treated embryos
(Fig. 3G,H). By the tailbud to
one-somite stage in wt, the DFCs formed a circular cluster at the midline
(Fig. 3I) whereas
thapsigargin-treated embryos displayed a smaller midline cluster with
individual cells scattered nearby (Fig.
3J and see Movie 4 in the supplementary material). By the three-
to five-somite stage in wt, the DFCs formed the circular precursor of the KV
(Fig. 3K), but in
thapsigargin-treated embryos, there was increased dispersal
(Fig. 3L).
Evaluation of DFC markers, lrdr1 and sox17, demonstrated a similar migration pattern. DFC migration in thapsigargin-treated embryos appeared the same as in the control during early epiboly but showed increased dispersal of individual cells during somite stages (see Fig. S4 in the supplementary material). Use of another inhibitor, XeC, also resulted in increased dispersal of DFCs, as assayed by the distribution of sox17 (Fig. 3F). sox17 is expressed in the endoderm as well as in the DFCs and endodermal expression is similar in control and thapsigargin-treated embryos (Fig. 3A,B). Thus, transient Ca2+ inhibition specifically affects the DFCs, and not overall sox17 expression. These data support the conclusion that inhibition of Ca2+ release does not perturb DFC specification, endocytic activity or early migration, but rather is required for later migration or coalescence.
Inhibition of DFC regional Ca2+ release suppresses KV formation
The DFCs are KV progenitors (Cooper and
D'Amico, 1996
; Melby et al.,
1996
), and thapsigargin treatment resulted in a dramatic loss of a
visible KV, with 97% severely reduced or absent
(Fig. 4A-D).
Thapsigargin-treated embryos also displayed reduced or absent cilia in the KV
region (see Fig. S4 in the supplementary material). A subset of KV cells
expressed Charon, a Nodal antagonist of the Cer/Dan protein class
(Hashimoto et al., 2004
).
During somite stages, charon expression appeared as a horseshoe shape
in the tailbud (Fig. 4E)
whereas the pattern in thapsigargin-treated embryos was severely reduced
(Fig. 4F) or absent
(Fig. 4A,G). Thus, loss of the
endogenous Ca2+ flux during epiboly eliminates charon
expression and disrupts formation of the KV.
|
To determine whether activated β-catenin is sufficient to disrupt LR
patterning we targeted a stabilized β-catenin construct [βcat55-C
(Pelegri and Maischein, 1998
)]
to the DFCs, using a procedure developed by Amack and Yost
(Amack and Yost, 2004
). In this
method, reagents injected into the yolk of 256- to 512-cell stage embryos were
preferentially taken up by the YSL and DFC progenitors, which maintain
cytoplasmic bridges with the yolk cell (DFC-targeting). In our hands, the
injections successfully targeted the DFCs with 20-40% efficiency as measured
by control GFP RNA or co-injected fluorescent tracer and we assumed a similar
efficiency with unlabelled reagents. DFC-directed βcat55-C RNA was
sufficient to cause abnormal heart jogging and altered lefty1/2
expression, whereas control RNA injection had no change in lefty1/2
expression (Fig. 5H,I). To
confirm that the induced defects were due to activated β-catenin at
biologically relevant levels, we utilized DFC-targeted Axin1-MO
(antisense morpholino oligo), a known negative regulator of β-catenin
(Heisenberg et al., 2001
).
Axin1 knockdown in the DFC region leads to ectopic nuclear
β-catenin (Fig. 5E).
However, the modest impact of Axin1 knockdown on lefty1/2
expression reflects the efficiency of the DFC-targeting; this effect was
significant and was sufficient to alter KV formation (see Fig. S5 in the
supplementary material). Therefore activated β-catenin in the DFCs is
sufficient to alter KV formation and subsequent organ laterality.
To verify that Ca2+ activity in the DFC region is critical for KV formation, we utilized DFC targeting of additional Ca2+ release inhibitors. KV formation was normal in wt or control-injected (DFC targeting of DMSO) embryos (see Fig. S5 in the supplementary material). Consistent with global thapsigargin treatment, DFC targeting of thapsigargin, or valproate (inositol turnover inhibitor) disrupted KV formation (see Fig. S5 in the supplementary material). Taken together, these data affirm that the defects we observe are primarily due to intracellular Ca2+ release inhibition in the DFC region.
DFC-like cells in Xenopus
Our data provide evidence that early Ca2+ release in the
zebrafish DFC region is necessary for proper KV formation and subsequent LR
asymmetry by antagonism of β-catenin. In Xenopus, several pieces
of evidence suggest that early Ca2+ activity near cells with
DFC-like properties could be a conserved mechanism for establishing
laterality. First, Ca2+ release activity has been described near
the late organizer region in Xenopus gastrula stage embryos
(Webb and Miller, 2006
).
Second, stage 13 Xenopus embryos have a cluster of left-right
dynein-expressing cells in the dorsal blastopore
(Essner et al., 2002
) and
finally, stage 15 embryos have recently been shown to have motile cilia with
left-ward fluid flow in a node-like structure
(Schweickert et al., 2007
).
Thus, we explored the possibility that Xenopus embryos have a
population of endocytically active cells, which ultimately contribute to the
tailbud and form a ciliated structure, analogous to zebrafish DFCs
(Cooper and D'Amico, 1996
).
Syto-11 uptake in late gastrula embryos (stage 11.5) revealed accumulation of
labeled cells in the dorsal mesoderm of the tail region of embryos sagittally
bisected at stage 14 (Fig. 6A)
and stage 17 (neurula) (Fig.
6B). Archenteron roof tissue explants from stage 17 embryos showed
Syto-11 staining of the node (Fig.
6C, arrow) and surrounding lateral plate mesoderm. Subsequent
immunostaining of the explants for acetylated tubulin showed enrichment of
cilia in the node region (Fig.
6D, arrow). These data establish that highly endocytic cells in
the late gastrula preferentially contribute to the node region in
Xenopus.
|
| DISCUSSION |
|---|
|
|
|---|
|
Asymmetrical Ca2+ levels across the mouse and chick node have
been implicated in LR axis determination
(McGrath et al., 2003
;
Raya et al., 2004
). The
zebrafish KV contains monociliated cells similar to those found in the mouse
node and several studies support a link between the node/KV and LR patterning
(Brueckner, 2001
;
Essner et al., 2005
;
Hashimoto et al., 2004
;
Supp et al., 1999
;
Supp et al., 1997
). Studies in
zebrafish have established a role for inositol polyphosphates, important
intracellular second messengers, in LR patterning. Inositol polyphosphate
kinases (Ipk) use IP3 as a template to generate higher inositols
(IP4, IP5 and IP6), and play key roles in
maintaining Ca2+ homeostasis by regulating the concentrations of
IP3 and other inositols (Xia
and Yang, 2005
). ipk1 knockdown in zebrafish disrupts
laterality, resulting in right-sided or bilateral spaw expression
(Sarmah et al., 2005
).
However, ipk1 is not expressed in the DFCs and in ipk1
knockdown embryos, KV morphology is normal and cilia are present
(Sarmah et al., 2005
). Recent
work has also postulated a distinct Ca2+ requirement in the
regulation of KV cilia motility in zebrafish
(Shu et al., 2007
). These
previous studies describe changes in laterality after KV formation. Our
findings indicate a novel early role for Ca2+ in the DFCs for KV
formation. Interestingly in our current study, we found that embryos treated
with thapsigargin during tailbud and early somite stages did not have any
impact upon KV formation or organ laterality. We used a fluorescent-labeled
thapsigargin and noted that upon treatment during epiboly stages, labeled
thapsigargin penetrated the YSL and DFC regions (data not shown). Conversely,
treatment after tailbud and during somite stages revealed that labeled
thapsigargin does not penetrate the region of the embryo where the KV resides.
Thus a negative result with thapsigargin treatment at later stages (i.e.
somite stages) may be a reflection of failure of the reagent to permeate into
the target tissues.
We propose that epiboly stage Ca2+ release is required to regulate β-catenin activity in the DFC region. Ca2+ inhibition for a discrete time period resulted in a statistically significant increase in nuclear β-catenin and activation of β-catenin transcriptional reporters, including TOPdGFP transgenic embryos and TopFlash assays. In fact, we observe TopFlash activation as early as 20 minutes after addition of thapsigargin, and this activation occurs hours before somitogenesis, KV and cilia formation. This activation is confirmed in the whole embryo by use of the TOPdGFP transgenic line. We also show that DFC endocytic activity and marker gene expression (ntl, lrdr, sox17 and squint) are maintained in Ca2+-inhibited embryos. Based on in vivo imaging and Syto-11 staining, DFC cell number remained unchanged; however migration within the tailbud region was altered. The labeled cells in the tailbud appear dispersed and did not coalesce into a KV. This may be due to altered cell adhesion, polarized cell movement or failure to undergo a mesenchymal-to-epithelial transition. All are processes that can be perturbed with altered Wnt signaling or β-catenin levels.
Our data provide evidence for an early Ca2+-dependent cascade
that ultimately regulates β-catenin levels and promotes KV formation.
Murine Wnt3a has been shown to be necessary in LR coordination, but after the
node cilia have formed (Nakaya et al.,
2005
). Our findings indicate a critical role for Ca2+
release and β-catenin activity, specifically in the DFC region before
somitogenesis. This may be mediated by Wnt/Ca2+ antagonism of
Wnt/β-catenin (Slusarski et al.,
1997
; Torres et al.,
1996
), however the Wnt/Ca2+ ligand is not identified in
this study. Since the DFCs do not form a KV in both thapsigargin-treated and
Axin1-MO injected embryos, we cannot evaluate effects on
cilia-dependent laterality cues, but we do observe a loss of charon
expression. It should be noted that in charon knockdown embryos, the
KV remains intact while laterality is altered (M.R., unpublished
observations). Conversely, knockdown of Bardet-Biedl Syndrome genes in
zebrafish embryos eliminates the morphological aspects of the KV and KV cilia
but charon is still present (Yen
et al., 2006
). Furthermore, charon knockdown generates a
preponderance of embryos with bilateral expression of laterality markers
(Hashimoto et al., 2004
).
Since Ca2+ inhibition eliminates charon expression, this
loss of charon can explain the high incidence of bilateral marker
gene expression in thapsigargin-treated embryos in the presence of an intact
midline.
The dramatic impact upon LR signaling caused by a transient pulse of Ca2+ inhibition would suggest a key patterning event and would also be predicted to be shared with other vertebrates. In Xenopus, we identified a population of endocytically active cells that ultimately surrounded the putative frog node, thus defining DFC-like properties in another vertebrate. Ca2+-release inhibitors targeting the equivalent developmental stage in Xenopus, induced ectopic β-catenin, organ laterality defects and bilateral nodal (Xnr-1) expression.
In summary, we have identified an early local Ca2+ release in the DFC region and show that inhibition of this activity via DFC-targeted injections results in dramatic KV defects. Furthermore, we implicate β-catenin activity as the target of the endogenous DFC Ca2+ fluxes and we show that suppression of β-catenin signaling within the DFCs is necessary for appropriate LR patterning in zebrafish and Xenopus. Thus, antagonisms between Wnt/Ca2+ and Wnt/β-catenin pathways may be crucial not only for dorsal-ventral patterning but for KV morphogenesis and LR asymmetry.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/1/75/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adams, D. S., Robinson, K. R., Fukumoto, T., Yuan, S.,
Albertson, R. C., Yelick, P., Kuo, L., McSweeney, M. and Levin, M.
(2006). Early, H+-V-ATPase-dependent proton flux is
necessary for consistent left-right patterning of non-mammalian vertebrates.
Development 133,1657
-1671.
Ahmad, N., Long, S. and Rebagliati, M. (2004). A southpaw joins the roster: the role of the zebrafish nodal-related gene southpaw in cardiac LR asymmetry. Trends Cardiovasc. Med. 14,43 -49.[CrossRef][Medline]
Alexander, J. and Stainier, D. Y. (1999). A molecular pathway leading to endoderm formation in zebrafish. Curr. Biol. 9,1147 -1157.[CrossRef][Medline]
Amack, J. D. and Yost, H. J. (2004). The T box transcription factor no tail in ciliated cells controls zebrafish left-right asymmetry. Curr. Biol. 14,685 -690.[CrossRef][Medline]
Bisgrove, B. W., Essner, J. J. and Yost, H. J. (2000). Multiple pathways in the midline regulate concordant brain, heart and gut left-right asymmetry. Development 127,3567 -3579.[Abstract]
Bisgrove, B. W., Morelli, S. H. and Yost, H. J. (2003). Genetics of human laterality disorders: insights from vertebrate model systems. Annu. Rev. Genomics Hum. Genet. 4,1 -32.[Medline]
Brennan, J., Norris, D. P. and Robertson, E. J.
(2002). Nodal activity in the node governs left-right asymmetry.
Genes Dev. 16,2339
-2344.
Brueckner, M. (2001). Cilia propel the embryo in the right direction. Am. J. Med. Genet. 101,339 -344.[CrossRef][Medline]
Chen, J. N., van Eeden, F. J., Warren, K. S., Chin, A., Nusslein-Volhard, C., Haffter, P. and Fishman, M. C. (1997). Left-right pattern of cardiac BMP4 may drive asymmetry of the heart in zebrafish. Development 124,4373 -4382.[Abstract]
Cooper, M. S. and D'Amico, L. A. (1996). A cluster of noninvoluting endocytic cells at the margin of the zebrafish blastoderm marks the site of embryonic shield formation. Dev. Biol. 180,184 -198.[CrossRef][Medline]
Creton, R. (2004). The calcium pump of the endoplasmic reticulum plays a role in midline signaling during early zebrafish development. Brain Res. Dev. Brain Res. 151, 33-41.[Medline]
Danos, M. C. and Yost, H. J. (1996). Role of notochord in specification of cardiac left-right orientation in zebrafish and Xenopus. Dev. Biol. 177,96 -103.[CrossRef][Medline]
Doitsidou, M., Reichman-Fried, M., Stebler, J., Koprunner, M., Dorries, J., Meyer, D., Esguerra, C. V., Leung, T. and Raz, E. (2002). Guidance of primordial germ cell migration by the chemokine SDF-1. Cell 111,647 -659.[CrossRef][Medline]
Dorsky, R. I., Sheldahl, L. C. and Moon, R. T. (2002). A transgenic Lef1/beta-catenin-dependent reporter is expressed in spatially restricted domains throughout zebrafish development. Dev. Biol. 241,229 -237.[CrossRef][Medline]
Eickholt, B. J., Towers, G. J., Ryves, W. J., Eikel, D., Adley,
K., Ylinen, L. M. J., Chadborn, N. H., Harwood, A. J., Nau, H. and Williams,
R. S. B. (2005). Effects of valproic acid derivatives on
inositol trisphosphate depletion, teratogenicity, glycogen synthase
kinase-3{beta} inhibition, and viral replication: a screening approach for new
bipolar disorder drugs derived from the valproic acid core structure.
Mol. Pharmacol. 67,1426
-1433.
Essner, J. J., Vogan, K. J., Wagner, M. K., Tabin, C. J., Yost, H. J. and Brueckner, M. (2002). Conserved function for embryonic nodal cilia. Nature 418, 37-38.[CrossRef][Medline]
Essner, J. J., Amack, J. D., Nyholm, M. K., Harris, E. B. and
Yost, H. J. (2005). Kupffer's vesicle is a ciliated organ of
asymmetry in the zebrafish embryo that initiates left-right development of the
brain, heart and gut. Development
132,1247
-1260.
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Rennebeck, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development and germ-layer formation require nodal-related signals. Nature 395,181 -185.[CrossRef][Medline]
Gafni, J., Munsch, J. A., Lam, T. H., Catlin, M. C., Costa, L. G., Molinski, T. F. and Pessah, I. N. (1997). Xestospongins: potent membrane permeable blockers of the inositol 1,4,5-trisphosphate receptor. Neuron 19,723 -733.[CrossRef][Medline]
Gilland, E., Miller, A. L., Karplus, E., Baker, R. and Webb, S.
E. (1999). Imaging of multicellular large-scale rhythmic
calcium waves during zebrafish gastrulation. Proc. Natl. Acad. Sci.
USA 96,157
-161.
Grynkiewicz, G., Poenie, M. and Tsien, R. Y.
(1985). A new generation of Ca2+ indicators with
greatly improved fluorescence properties. J. Biol.
Chem. 260,3440
-3450.
Halpern, M. E., Liang, J. O. and Gamse, J. T. (2003). Leaning to the left: laterality in the zebrafish forebrain. Trends Neurosci. 26,308 -313.[CrossRef][Medline]
Hamada, H., Meno, C., Watanabe, D. and Saijoh, Y. (2002). Establishment of vertebrate left-right asymmetry. Nat. Rev. Genet. 3,103 -113.[CrossRef][Medline]
Hashimoto, H., Rebagliati, M., Ahmad, N., Muraoka, O., Kurokawa,
T., Hibi, M. and Suzuki, T. (2004). The Cerberus/Dan-family
protein Charon is a negative regulator of Nodal signaling during left-right
patterning in zebrafish. Development
131,1741
-1753.
Heisenberg, C. P., Houart, C., Take-uchi, M., Rauch, G. J.,
Young, N., Coutinho, P., Masai, I., Caneparo, L., Concha, M. L., Geisler, R.
et al. (2001). A mutation in the Gsk3-binding domain of
zebrafish Masterblind/Axin1 leads to a fate transformation of telencephalon
and eyes to diencephalon. Genes Dev.
15,1427
-1434.
Hirokawa, N., Tanaka, Y., Okada, Y. and Takeda, S. (2006). Nodal flow and the generation of left-right asymmetry. Cell 125,33 -45.[CrossRef][Medline]
Houston, D. W. and Wylie, C. (2005). Maternal
Xenopus Zic2 negatively regulates Nodal-related gene expression during
anteroposterior patterning. Development
132,4845
-4855.
Kawakami, Y., Raya, A., Raya, R. M., Rodriguez-Esteban, C. and Belmonte, J. C. (2005). Retinoic acid signalling links left-right asymmetric patterning and bilaterally symmetric somitogenesis in the zebrafish embryo. Nature 435,165 -171.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Levin, M. and Palmer, A. R. (2007). Left-right patterning from the inside out: widespread evidence for intracellular control. BioEssays 29,271 -287.[CrossRef][Medline]
Long, S., Ahmad, N. and Rebagliati, M. (2003).
The zebrafish nodal-related gene southpaw is required for visceral and
diencephalic left-right asymmetry. Development
130,2303
-2316.
Marques, S., Borges, A. C., Silva, A. C., Freitas, S.,
Cordenonsi, M. and Belo, J. A. (2004). The activity of the
Nodal antagonist Cerl-2 in the mouse node is required for correct L/R body
axis. Genes Dev. 18,2342
-2347.
McGrath, J., Somlo, S., Makova, S., Tian, X. and Brueckner, M. (2003). Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell 114, 61-73.[CrossRef][Medline]
Melby, A. E., Warga, R. M. and Kimmel, C. B. (1996). Specification of cell fates at the dorsal margin of the zebrafish gastrula. Development 122,2225 -2237.[Abstract]
Meno, C., Shimono, A., Saijoh, Y., Yashiro, K., Mochida, K., Ohishi, S., Noji, S., Kondoh, H. and Hamada, H. (1998). lefty-1 is required for left-right determination as a regulator of lefty-2 and nodal. Cell 94,287 -297.[CrossRef][Medline]
Molina, G. A., Watkins, S. C. and Tsang, M. (2007). Generation of FGF reporter transgenic zebrafish and their utility in chemical screens. BMC Dev. Biol. 7, 62.[CrossRef][Medline]
Nakaya, M. A., Biris, K., Tsukiyama, T., Jaime, S., Rawls, J. A.
and Yamaguchi, T. P. (2005). Wnt3alinks left-right
determination with segmentation and anteroposterior axis elongation.
Development 132,5425
-5436.
Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A., Kanai, Y., Kido, M. and Hirokawa, N. (1998). Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell 95,829 -837.[CrossRef][Medline]
Okada, Y., Nonaka, S., Tanaka, Y., Saijoh, Y., Hamada, H. and Hirokawa, N. (1999). Abnormal nodal flow precedes situs inversus in iv and inv mice. Mol. Cell 4, 459-468.[CrossRef][Medline]
Park, M. and Moon, R. T. (2002). The planar cell-polarity gene stbm regulates cell behavior and cell fate in vertebrate embryos. Nat. Cell Biol. 4, 20-25.[CrossRef][Medline]
Pelegri, F. and Maischein, H. M. (1998). Function of zebrafish beta-catenin and TCF-3 in dorsoventral patterning. Mech. Dev. 77,63 -74.[CrossRef][Medline]
Raya, A. and Belmonte, J. C. (2006). Left-right asymmetry in the vertebrate embryo: from early information to higher-level integration. Nat. Rev. Genet. 7, 283-293.[CrossRef][Medline]
Raya, A., Kawakami, Y., Rodriguez-Esteban, C., Ibanes, M., Rasskin-Gutman, D., Rodriguez-Leon, J., Buscher, D., Feijo, J. A. and Izpisua Belmonte, J. C. (2004). Notch activity acts as a sensor for extracellular calcium during vertebrate left-right determination. Nature 427,121 -128.[CrossRef][Medline]
Reinhard, E., Yokoe, H., Niebling, K. R., Allbritton, N. L., Kuhn, M. A. and Meyer, T. (1995). Localized calcium signals in early zebrafish development. Dev. Biol. 170, 50-61.[CrossRef][Medline]
Sarmah, B., Latimer, A. J., Appel, B. and Wente, S. R. (2005). Inositol polyphosphates regulate zebrafish left-right asymmetry. Dev. Cell 9,133 -145.[CrossRef][Medline]
Schottenfeld, J., Sullivan-Brown, J. and Burdine, R. D.
(2007). Zebrafish curly up encodes a Pkd2 ortholog that restricts
left-side-specific expression of southpaw. Development
134,1605
-1615.
Schulte-Merker, S., van Eeden, F. J., Halpern, M. E., Kimmel, C. B. and Nusslein-Volhard, C. (1994). no tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Development 120,1009 -1015.[Abstract]
Schweickert, A., Weber, T., Beyer, T., Vick, P., Bogusch, S., Feistel, K. and Blum, M. (2007). Cilia-driven leftward flow determines laterality in Xenopus. Curr. Biol. 17, 60-66.[CrossRef][Medline]
Seidler, N. W., Jona, I., Vegh, M. and Martonosi, A.
(1989). Cyclopiazonic acid is a specific inhibitor of the
Ca2+-ATPase of sarcoplasmic reticulum. J. Biol. Chem.
264,17816
-17823.
Shimeld, S. M. (2004). Calcium turns sinister in left-right asymmetry. Trends Genet. 20,277 -280.[CrossRef][Medline]
Shu, X., Huang, J., Dong, Y., Choi, J., Langenbacher, A. and
Chen, J. N. (2007). Na,K-ATPase {alpha}2 and Ncx4a regulate
zebrafish left-right patterning. Development
134,1921
-1930.
Slusarski, D. C. and Corces, V. G. (2000). Calcium imaging in cell-cell signaling. In Developmental Biology Protocols. Vol. 1 (ed. R. S. Tuan and C. W. Lo), pp. 253-261. Totowa, NJ: Humana Press.
Slusarski, D. C., Yang-Snyder, J., Busa, W. B. and Moon, R. T. (1997). Modulation of embryonic intracellular Ca2+ signaling by Wnt-5A. Dev. Biol. 185,114 -120.
Supp, D. M., Witte, D. P., Potter, S. S. and Brueckner, M. (1997). Mutation of an axonemal dynein affects left-right asymmetry in inversus viscerum mice. Nature 389,963 -966.[CrossRef][Medline]
Supp, D. M., Brueckner, M., Kuehn, M. R., Witte, D. P., Lowe, L. A., McGrath, J., Corrales, J. and Potter, S. S. (1999). Targeted deletion of the ATP binding domain of left-right dynein confirms its role in specifying development of left-right asymmetries. Development 126,5495 -5504.[Abstract]
Tabin, C. J. (2006). The key to left-right asymmetry. Cell 127,27 -32.[CrossRef][Medline]
Tanaka, Y., Okada, Y. and Hirokawa, N. (2005). FGF-induced vesicula