|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online April 25, 2008
doi: 10.1242/10.1242/dev.020784
1 Sars Centre for Marine Molecular Biology, University of Bergen, N-5008 Bergen,
Norway.
2 Miltenyi Biotec, Friedrich-Ebert-Str. 68, 51429 Bergisch-Gladbach,
Germany.
3 Faculty of Life Sciences, University of Vienna, Althanstrasse 14, 1090 Wien,
Austria.
* Authors for correspondence (e-mails: ulrich.technau{at}univie.ac.at; fabian.rentzsch{at}sars.uib.no)
Accepted 12 March 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Cnidaria, Nematostella, Apical organ, FGF signalling
| INTRODUCTION |
|---|
|
|
|---|
In order to identify signalling molecules that are involved in the
embryonic patterning of Nematostella, we identified and isolated the
complete set of 15 homologous transcripts of Fibroblast growth factors (FGFs)
and the only two Fibroblast growth factor receptors (FGFRs) present in the
genome. This extends the recent predictive identification and selective
cloning of 13 FGF ligands from the Nematostella genome
(Matus et al., 2007
). FGF
signalling is involved in a wide variety of developmental processes in
vertebrates and invertebrates (Borland et
al., 2001
; Bottcher and Niehrs,
2005
; Huang and Stern,
2005
; Thisse and Thisse,
2005
). It regulates the migratory behaviour of cells during
gastrulation in vertebrates, sea urchin and Drosophila
(Keller, 2005
;
Leptin, 2005
;
Rottinger et al., 2008
;
Wilson and Leptin, 2000
),
mesoderm formation in vertebrates
(Kimelman, 2006
), and neural
induction in vertebrates and urochordates
(Bertrand et al., 2003
;
Stern, 2005
;
Wilson and Edlund, 2001
). At
later developmental stages, it is involved in anteroposterior patterning of
the neuroectoderm and the mesoderm in vertebrates
(Altmann and Brivanlou, 2001
),
branching morphogenesis in the Drosophila and mouse respiratory
systems (Ghabrial et al.,
2003
; Metzger and Krasnow,
1999
; Warburton et al.,
2000
), limb development in vertebrates
(Capdevila and Izpisua Belmonte,
2001
; Niswander,
2002
; Tickle,
1999
), and notochord and heart formation in urochordates
(Davidson et al., 2006
;
Imai et al., 2002
;
Yasuo and Hudson, 2007
). In
planarians, a role for FGF signalling in brain development has been proposed
(Cebria et al., 2002
;
Ogawa et al., 2002
), and, in
the hydrozoan Hydra, a FGF receptor is expressed both in the tip and
the foot region of developing buds (Sudhop
et al., 2004
). However, to date, no functional data about the role
of individual FGFs in lower metazoans have been reported.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Identification of Nematostella FGFs and FGF receptors, phylogenetic analysis and RT-PCR
All described genes were identified by searching a Nematostella
EST database
(http://genome.jgi-psf.org/Nemve1/Nemve1.home.html)
with corresponding vertebrate sequences and tBLASTN. Incomplete 5' ends
of NvFGFRb and NvFGFRa were obtained by 5' RACE using
GeneRacer (Invitrogen). GenBank Accession numbers are: NvFGFa2,
DQ882654; NvFGFa1, DQ882655; NvFGFRb, EF173462;
NvFGFRa, EF173463.
Oligo dT-primed cDNAs for developmental RT-PCR were generated by standard procedures. Primer sequences and PCR conditions are available from the authors upon request.
Morpholino tests with coupled transcription-translation assays
For the rabbit reticulocyte lysate-based assay, the open reading frame and
morpholino target site of NvFGFa1, NvFGFa2 and NvFGFRa were
cloned into the pCS2+ vector. In each case, 200 ng of plasmid, 0.5 nmol
morpholino and 4 µCi 35S-labeled methionine (Amersham, UK) were
added to 10 µl of SP6 TnT-Quick coupled transcription/translation reaction
mix (Promega, USA) and incubated for 90 minutes at 30°C. Reactions were
separated by SDS-PAGE and synthesised proteins were visualised by
autoradiography.
In situ hybridisation and immunocytochemistry
Embryos were fixed for 1 hour in cold 4% paraformaldehyde in PBS or 3.7%
formaldehyde in Nematostella medium and stored in methanol until use.
Hybridisations were carried out as described
(Rentzsch et al., 2006
).
Probes were synthesised from full-length cDNA clones with Megascript Kits
(Ambion, USA) and digoxigenin- or FITC-labeled UTP (Roche, Switzerland).
For staining with anti-acetylated tubulin antibody (Sigma T6793), embryos were fixed for 1 hour in cold 4% paraformaldehyde/PBS, followed by 20 minutes in 10% DMSO in PBS and 15 minutes in 2% H2O2 in PBS. The antibody was diluted 1:400 in 10% lamb serum, 1% DMSO, 0.1% Triton X-100 in PBS.
Microscopy
Scanning electron microscopy was carried out at the Molecular Imaging
Centre (MIC) of the University of Bergen (FUGE, Norwegian Research Council)
using a Jeol JSM7400-F microscope. Samples were treated as described
previously (Kraus and Technau,
2006
); the blastopore was used for orientation of the larvae.
Injection of morpholinos and inhibitor treatments
For microinjections, fertilised eggs were dejellied with 2.5% cysteine in
Nematostella medium
(Fritzenwanker and Technau,
2002
). Injections were done with a Femtojet microinjector
(Eppendorf, Germany) on a Nikon TE2000-S inverted microscope.
Morpholinos (MOs) were purchased from Gene Tools, USA. Sequences are: NvFGFa2, CGTTAGCATGGTGATCGTCATGTTG; NvFGFa1, ATAAGGTGGACGCATGACTTTGTAG; NvFGFRa, TCCACCAAGCTCGAAGAGCCGTCAT; and control MO, CATGGAGAAATCGGACTTCATATTT. Nucleotides complementary to the start ATG are underlined. The sequence of the control MO does not yield any hits in the available Nematostella genome assembly or EST database (http://genome.jgi-psf.org/Nemve1/Nemve1.home.html). MOs were diluted in water and injected at 0.25 nmol/µl (NvFGFa2) or 0.5 nmol/µl (NvFGFa1 and NvFGFRa) with 0.5 µg/µl rhodamine-dextran (Mr 10,000, Molecular Probes, USA) as a tracer.
SU5402 (Calbiochem, USA) was applied at a final concentration of 20 µM, UO126 (Promega, USA) at 10 µM, each in 0.1% DMSO. Control animals were incubated in 0.1% DMSO only. Solutions were changed after 8 hours.
Double phosphorylated ERK was detected with monoclonal anti-phospho p42/44 antibody E10 (Cell Signaling Technologies, USA).
| RESULTS |
|---|
|
|
|---|
|
FGF ligands and receptors are expressed at the apical pole
To determine whether FGF signalling might be involved in embryonic
development of Nematostella, we analysed the temporal and spatial
expression pattern of NvFGFa1, NvFGFa2, NvFGFRa and NvFGFRb
by RT-PCR and in situ hybridisation, respectively. RT-PCR on cDNA from
different developmental stages shows that both NvFGF receptors and
NvFGFa2 are expressed maternally and zygotically, whereas
NvFGFa1 is expressed only zygotically
(Fig. 2A). By in situ
hybridisation, the earliest localised expression detected for NvFGFa1
and NvFGFa2 was in early gastrula stages, as a broad domain
encompassing almost the complete aboral half of the embryo
(Fig. 2B,F). During
gastrulation, this broad domain becomes gradually restricted to the small
patch at the aboral pole that marks the site where the apical organ will
develop in the early planula larva (Fig.
2C,G). Expression of both genes remains confined to this site
throughout planula stages and the first 2 to 3 days after metamorphosis
(Fig. 2D,E,H,I), and becomes
undetectable afterwards. Double in situ hybridisation did not reveal a
difference in the width of the expression domains of NvFGFa1 and
NvFGFa2 during midgastrulation, when the expression becomes
restricted to the aboral pole (Fig.
2N-P).
The expression of NvFGFRa is very similar to that of
NvFGFa1 and NvFGFa2: it commences broadly in the aboral half
and then becomes restricted to the aboral pole
(Fig. 2J-M). However,
fluorescent double in situ hybridisation experiments show that, in contrast to
NvFGFa1, the expression domain of NvFGFRa is slightly wider
than that of NvFGFa2 during the narrowing of the aboral expression
domain (Fig. 2Q-S). In
addition, NvFGFRa is expressed in the whole endoderm during planula
stages, with pronounced signals detectable in the mesenteries
(Fig. 2K,L). The second FGF
receptor, NvFGFRb, is expressed uniformly throughout the endoderm
during gastrulation and planula stages (data not shown) (see
Matus et al., 2007
).
|
Opposing activities of NvFGFa1 and NvFGFa2 control the development of the ciliary tuft
We used morpholino antisense oligonucleotides (MO)
(Summerton, 1999
) to analyse
the function of NvFGFa1, NvFGFa2 and NvFGFRa during Nematostella
development. To test whether the morpholinos can suppress translation of the
targeted transcripts, we employed a reticulocyte lysate-based
transcription-translation system (see Material and methods). Synthesis of
NvFGFa1 protein from a NvFGFa1 encoding plasmid was readily suppressed by
addition of the NvFGFa1 MO to the reaction, but not by the
NvFGFa2 MO. Similarly, the NvFGFa2 MO, but not the
NvFGFa1 MO, suppressed synthesis of NvFGFa2, and translation of
NvFGFRa was suppressed by the NvFGFRa MO, but not by the
NvFGFRb MO (Fig.
3A).
Embryos injected with a control morpholino or with dextran developed normally into planula larvae, although with a slight developmental delay compared with uninjected embryos. Scanning electron microscopy of mid-planula (96 hpf) embryos revealed that NvFGFa1 MO- or NvFGFRa MO-injected embryos lack the ciliary tuft (Fig. 3B,C; see also Fig. S4 in the supplementary material). By striking contrast, the injection of morpholinos against the co-expressed paralog NvFGFa2 resulted in a pronounced expansion of the ciliary tuft (Fig. 3D). Furthermore, staining of cilia with an antibody against acetylated tubulin showed that, in embryos injected with the NvFGFa2 MO, the long apical cilia develop significantly earlier than in control embryos. At early planula stage (48 hpf), before the apical tuft is visible in control embryos, a vastly oversized tuft of apical cilia is detectable in NvFGFa2 morphants (Fig. 3E-G).
The observation that both FGFs and the FGF receptor are expressed in the
apical organ cells throughout planula stages and in the young primary polyp
suggested that FGF signalling might still be required after the initial
formation of the apical organ. To test this possibility, we used a chemical
FGF receptor inhibitor, SU5402, which binds to a region of the tyrosine kinase
domain of FGF receptors that is highly conserved in both Nematostella
FGF receptors (Mohammadi et al.,
1997
). Incubation of Nematostella embryos with SU5402
leads to a clear reduction in phosphorylation of the MAP kinase ERK, which is
phosphorylated and thereby activated by FGF signalling in various higher
metazoans (Fig. 6A). We
selected planula larvae after formation of a visible apical tuft (72 hpf), and
incubated them in 20 µM SU5402. Within 48 hours, 67% of the SU5402-treated
planulae (n=33) completely lost the apical cilia
(Fig. 3I) and 24% had a clearly
thinner apical tuft; control incubation in 0.1% DMSO had no effect
(Fig. 3H; n=38).
We conclude that opposing activities of NvFGFa1 and NvFGFa2 regulate proper development of the apical organ in Nematostella, and that FGFR signalling is required to maintain the apical cilia throughout planula stages.
FGF signalling controls patterning within the aboral region
To obtain a better understanding of the patterning defects that underlie
the observed phenotypes, we used a panel of marker genes that demarcate
distinct regions along the oral-aboral axis. Expression analysis was carried
out at 48 hpf and, thus, about 24 hours before differentiation of the apical
organ becomes apparent by the emergence of the apical cilia.
NvCOE is a homolog of the Collier/Olf/EBF family of transcription
factors that are implicated in neuronal development in various organisms
(Dubois and Vincent, 2001
).
NvCOE is expressed in the apical organ of the Nematostella
early planula larvae (Fig. 4A)
(Pang et al., 2004
). This
expression is lost in embryos injected with the NvFGFa1 or
NvFGFRa MO (Fig.
4E,I), whereas it is strongly expanded upon NvFGFa2 MO
injection (Fig. 4M).
NvFoxD1 is a winged helix transcription factor that is expressed in a
broad aboral domain of the Nematostella planula larvae and thus
includes, but goes beyond the expression domain of NvCOE at this
stage (Fig. 4B)
(Magie et al., 2005
). The
expression of NvFoxD1 is unaffected in NvFGFa1 and
NvFGFRa MO-injected embryos (Fig.
4F,J), whereas its expression in NvFGFa2 morphants
includes the expanded apical organ, but does not exceed the expression domain
of NvCOE (Fig. 4N). We
also analysed the expression of NvWnt2, which is expressed in a
belt-like domain in the central part of the planula
(Fig. 4C)
(Kusserow et al., 2005
), and
that of NvFkh, which at this stage is expressed around the
blastopore, marking the oral end of the planula
(Fig. 4D)
(Fritzenwanker et al., 2004
;
Martindale et al., 2004
). Both
markers were unaffected by injection of the NvFGFa1, NvFGFa2 or
NvFGFRa MOs (Fig.
4G,H,K,L,O,P).
|
|
Expression of FGF pathway components is maintained by FGFRa signalling
The above results indicate that proper development of the apical organ
requires a balance between the opposing activities of NvFGFa1 and NvFGFa2. One
possible way to achieve such a balance would be the use of feedback
mechanisms. We therefore analysed whether the expression of NvFGFa1,
NvFGFa2 and NvFGFRa is regulated by FGF signalling. Indeed, we
found that knockdown of NvFGFa1 or NvFGFRa leads to a loss
of transcription of NvFGFa1 and NvFGFa2, and to a nearly
complete loss of NvFGFRa expression
(Fig. 5A-I). By contrast,
knockdown of NvFGFa2 resulted in an expansion of the expression
domains of NvFGFa1 and NvFGFRa, and of NvFGFa2
itself (Fig. 5J-L). The
expanded expression domains of NvFGFa1 and NvFGFRa in
NvFGFa2 morphants suggest that the expansion of the apical organ in
these embryos might be caused by excessive signalling of NvFGFa1 via NvFGFRa.
To test this possibility, we co-injected NvFGFa2 and NvFGFRa
MOs, and found that co-injection suppressed the expansion of the apical organ
territory caused by injection of NvFGFa2 MO alone
(Fig. 5M,N). Similarly,
incubation of NvFGFa2 MO-injected embryos with the chemical FGF
receptor inhibitor SU5402 completely blocked formation of the apical cilia
(Fig. 5O).
We conclude that NvFGFa1 signalling via NvFGFRa maintains its own expression, as well as that of NvFGFRa and the antagonistic NvFGFa2 (Fig. 7H), and that the expansion of the apical organ caused by knockdown of NvFGFa2 is mediated by NvFGFRa signalling.
Nematostella FGF signalling is transduced by the MAP kinase pathway
Activation of FGF receptors can trigger several intracellular transduction
pathways. One of the most prominent among these is a conserved Ras/Raf/MEK/MAP
kinase pathway, which mediates FGF signalling in many developmental processes
in other animals. Manipulation of this pathway can be achieved by the
application of UO126, a chemical compound that specifically blocks the
activity of MEK, which is a specific activator of the MAP kinase ERK
(Favata et al., 1998
). Western
blot analysis with an antibody against double-phosphorylated (i.e. activated)
ERK shows that UO126 almost completely abolishes ERK activation in
Nematostella (Fig.
6A). As ERK is also involved in FGF-independent processes, we
applied UO126 only after blastula stage (20 hpf) to minimise the risk of
non-FGF related effects that might secondarily affect apical organ formation.
Treatment with UO126 blocked apical organ formation and expression of the
apical organ markers NvCOE and NvFGFa1, but did not affect
the expression of NvFoxD1 (Fig.
6B-D; data not shown). Moreover, UO126 blocked the expansion of
apical organ markers caused by the injection of NvFGFa2 MOs
(Fig. 6E-G). These data suggest
a major role for a Ras-MEK-ERK cascade in FGF-dependent apical organ
formation.
|
As the apical organ of bilaterian larvae has been suggested to be involved in metamorphosis, we next examined whether NvFGFa1 or NvFGFa2 morphants undergo normal metamorphosis into primary polyps. After 12 days, 71% of uninjected (n=156), 67% of control MO-injected (n=133), 64% of NvFGFa2 MO-injected (n=85), but only 2% of NvFGFa1 MO-injected (n=98) embryos had become primary polyps (Fig. 7C-F).
The experiments with the FGF receptor inhibitor SU5402 had shown that continuous FGF receptor activity is required for the maintenance of the apical organ. To support the idea that the apical organ is essential for the induction of metamorphosis, we incubated Nematostella larvae from late planula stages (120 hpf) in SU5402. Whereas 93% (n=159) of the control embryos had become primary polyps at 9 dpf, only 10% (n=165) of the SU5402-treated planula had begun metamorphosis, and none had become primary polyps (Fig. 7G). Although inhibition of FGF receptor signalling by SU5402 is not restricted to the apical organ, these results suggest that loss of the apical organ in NvFGFa1 morphants and upon SU5402 treatment impairs the ability to undergo metamorphosis.
| DISCUSSION |
|---|
|
|
|---|
We propose that in the wild-type situation, the apical organ-promoting
activity of NvFGFa1 is antagonised by NvFGFa2 until the initially broad
expression domain of NvFGFa1 is restricted to a small patch at the
aboral pole in the early planula larvae. Because NvFGFa1 activates
transcription of both NvFGFa2 and NvFGFa1, it maintains a
balance between promoting and suppressing signals, which in turn prevents
precocious apical organ formation. Upon suppression of NvFGFa2
translation by injection of the NvFGFa2 MO, NvFGFa1 activity is
enhanced by the lack of the antagonistic NvFGFa2 protein and by elevated
autoregulation of its own transcription
(Fig. 7H), resulting in earlier
differentiation of the long apical cilia from a broader, i.e. not fully
restricted, domain. As in wild-type larvae, expression of NvFGFa1 and
NvFGFa2 is then maintained in the differentiated apical organ cells,
and this late expression is required for the maintenance of the apical cilia,
as even late inhibition of the FGF receptor by the specific inhibitor SU5402
leads to loss of the apical organ. These data are consistent with a
reaction-diffusion type of patterning mechanism. It would predict that the
inhibitor (NvFGFa2) diffuses faster and thus has a longer diffusion range than
the activator (NvFGFa1) in order to delimit the range of signalling and,
thereby, the formation of the apical organ to a small area. Although
theoretical models have stressed for a long time the power of
reaction-diffusion mechanisms to generate spot- or stripe-like patterns
(Meinhardt and Gierer, 2000
),
molecular evidence has remained relatively scarce. The best-studied example is
the pair of antagonistically acting TGFβ ligands, Nodal and Lefty, in
vertebrate development (for reviews, see
Juan and Hamada, 2001
;
Solnica-Krezel, 2003
).
Although attracting and repulsive FGF signals have been invoked to act in
mesoderm migration during chick gastrulation
(Yang et al., 2002
), our data
are, to our knowledge, the first example of two FGF ligands that are
co-expressed, are auto- and crosscatalytic, and have activating and inhibiting
effects consistent with a reaction-diffusion type mechanism.
|
The mechanism that drives the restriction of NvFGFa1, NvFGFa2 and
NvFGFRa expression into the small aboral domain during gastrulation
remains unclear. The activity of NvFGFa2 itself might be required for this
process, as an expansion of apical pole markers in NvFGFa2 morphants was
already visible at midgastrulation (data not shown). However, expression of
apical organ markers is maintained in differentiated apical organ cells, and
it is therefore difficult to distinguish whether the early expansion of the
expression domains is caused by a direct role of NvFGFa2 in their restriction,
or indirectly by the premature onset of differentiation of the apical organ
cells. Interestingly, all described apical organ markers in
Nematostella either display the same expression dynamics as the FGFs,
or their expression commences only at later stages. So far, no gene has been
described that is expressed in a spot-like domain at the apical pole during
gastrulation, and that would thereby provide a localised source for initiation
of the restriction. Dissection experiments have shown that only the oral half
of gastrula-stage embryos is able to regenerate a complete planula larva,
including a correctly patterned apical tuft
(Fritzenwanker et al., 2007
;
Lee et al., 2007
), and it
therefore appears possible that the restriction is not triggered by an
`attractive' signal from the aboral pole, but rather by a `repulsive' signal
from the oral pole. Wnt factors would be a candidate group of molecules for
such a function, as several of them are expressed in distinct ring-like
domains located exclusively in the oral half of the embryo
(Kusserow et al., 2005
). A
similar mechanism operates in the sea urchin embryo, where the size of the
apical organ is restricted by β-catenin signalling from the opposite,
vegetal pole (Yaguchi et al.,
2006
).
The Nematostella genome encodes two FGF receptors, but only
NvFGFRa is co-expressed with NvFGFa1 and NvFGFa2 in
the apical organ. This co-expression suggests that both FGFs use NvFGFRa as
their receptor. As knockdown of NvFGFa1 and NvFGFRa have
identical effects on apical organ formation and marker gene expression, one
obvious possibility to account for the opposing activities of the two ligands
would be that only NvFGFa1 is able to activate the receptor, whereas NvFGFa2
binds to NvFGFRa without activating it and thus acts as a dominant-negative
ligand. Alternatively, binding of NvFGFa1 and NvFGFa2 could activate different
transduction pathways that antagonise each other intracellularly. To our
knowledge, an antagonism of two co-expressed FGFs that signal via the same
receptor would represent a novel mechanism for the fine-tuning of FGF
activity. Interestingly, a similar mechanism has been described for a member
of the TGFβ family of growth factors, whereby BMP3 can bind and block
ActRIIB, a receptor that is activated by the binding of BMP4 or Activin
(Gamer et al., 2005
).
Our results suggest that signalling of NvFGFa1 via NvFGFRa might be
mediated by conserved intracellular pathway components. The ability of the MEK
inhibitor UO126 to block apical organ formation in wild-type embryos and in
NvFGFa2 morphants is compatible with an involvement of a Ras/MEK/ERK
signalling cascade in NvFGFa1 signalling. This pathway mediates the response
to FGFs in many developmental processes in higher metazoans
(Eswarakumar et al., 2005
;
Thisse and Thisse, 2005
).
However, the MAP kinase pathway can also be activated by other signals, and
indeed blocking of FGF receptor signalling only partially abolishes the
phosphorylation of ERK/MAP kinase (Fig.
6A). This indicates that ERK is also activated by another pathway
besides the FGF signalling pathway. This other signalling input is apparently
not essential for apical organ formation, as expansion and abolishment can all
be achieved by manipulation of the corresponding FGF signalling pathway.
Evolution of apical sensory organs
Apical organs with a tuft of long cilia have been described in marine
ciliated larvae from the two major bilaterian groups, protostomes and
deuterostomes, but the evolutionary relationship of cnidarian, protostomian
and deuterostomian apical organs is not yet clear.
Strikingly, FGFs or FGF receptors are expressed in the region of apical
organ formation in sea urchin and hemichordate embryos [two deuterostomians
(Gerhart et al., 2005
;
Lapraz et al., 2006
)], and in
the polychaete Platynereis (a protostomian; P. Steinmetz and D.
Arendt, personal communication). Thus, although functional data are lacking
for these organisms, it is tempting to speculate that regulation of apical
organ formation by FGF signalling is common to cnidarian, protostomian and
deuterostomian larvae, and might thus represent an ancestral function of FGF
signalling that was present in the common ancestor of all eumetazoans.
However, broader species sampling and more marker genes are necessary to
conclude on the homology of apical organs in cnidarian and bilaterian
larvae.
In bilaterian larvae, morphological observations, and pharmacological and
cell ablation experiments, have suggested that apical organs are chemo- and/or
mechanosensory structures with neuroendocrine functions that might be involved
in the induction of metamorphosis
(Hadfield et al., 2000
;
Kempf et al., 1997
;
Voronezhskaya and Khabarova,
2003
). Our results strongly indicate that FGF signalling is
required for metamorphosis, most likely through the formation of the apical
organ. Because metamorphosis of larvae into adults is of pivotal importance
for all pelago-benthic directly and indirectly developing organisms, future
work will attempt to identify the external cues and their internal
processing.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/10/1761/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altmann, C. R. and Brivanlou, A. H. (2001).
Neural patterning in the vertebrate embryo. Int. Rev.
Cytol. 203,447
-482.[Medline]
Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S.
(2004). Improved prediction of signal peptides: SignalP 3.0.
J. Mol. Biol. 340,783
-795.[CrossRef][Medline]
Bertrand, V., Hudson, C., Caillol, D., Popovici, C. and Lemaire,
P. (2003). Neural tissue in ascidian embryos is induced by
FGF9/16/20, acting via a combination of maternal GATA and Ets transcription
factors. Cell 115,615
-627.[CrossRef][Medline]
Borland, C. Z., Schutzman, J. L. and Stern, M. J.
(2001). Fibroblast growth factor signaling in Caenorhabditis
elegans. BioEssays 23,1120
-1130.[CrossRef][Medline]
Bottcher, R. T. and Niehrs, C. (2005).
Fibroblast growth factor signaling during early vertebrate development.
Endocr. Rev. 26,63
-77.
Bourlat, S. J., Juliusdottir, T., Lowe, C. J., Freeman, R.,
Aronowicz, J., Kirschner, M., Lander, E. S., Thorndyke, M., Nakano, H., Kohn,
A. B. et al. (2006). Deuterostome phylogeny reveals
monophyletic chordates and the new phylum Xenoturbellida.
Nature 444,85
-88.[CrossRef][Medline]
Bridge, D., Cunningham, C. W., Schierwater, B., DeSalle, R. and
Buss, L. W. (1992). Class-level relationships in the phylum
Cnidaria: evidence from mitochondrial genome structure. Proc. Natl.
Acad. Sci. USA 89,8750
-8753.
Bridge, D., Cunningham, C. W., DeSalle, R. and Buss, L. W.
(1995). Class-level relationships in the phylum Cnidaria:
molecular and morphological evidence. Mol. Biol. Evol.
12,679
-689.[Abstract]
Capdevila, J. and Izpisua Belmonte, J. C.
(2001). Patterning mechanisms controlling vertebrate limb
development. Annu. Rev. Cell Dev. Biol.
17, 87-132.[CrossRef][Medline]
Cebria, F., Kobayashi, C., Umesono, Y., Nakazawa, M., Mineta,
K., Ikeo, K., Gojobori, T., Itoh, M., Taira, M., Sanchez Alvarado, A. et
al. (2002). FGFR-related gene nou-darake restricts brain
tissues to the head region of planarians. Nature
419,620
-624.[CrossRef][Medline]
Chia, F. S. and Koss, R. (1979). Fine
structural studies of the nervous system and the apical organ in the planula
larva of the sea anemone Anthopleura elegantissima. J.
Morph. 160,275
-298.[CrossRef]
Chourrout, D., Delsuc, F., Chourrout, P., Edvardsen, R. B.,
Rentzsch, F., Renfer, E., Jensen, M. F., Zhu, B., de Jong, P., Steele, R. E.
et al. (2006). Minimal ProtoHox cluster inferred from
bilaterian and cnidarian Hox complements. Nature
442,684
-687.[CrossRef][Medline]
Collins, A. G. (2002). Phylogeny of medusozoa
and the evolution of cnidarian life cycles. J. Evol.
Biol. 15,418
-431.[CrossRef]
Davidson, B., Shi, W., Beh, J., Christiaen, L. and Levine,
M. (2006). FGF signaling delineates the cardiac progenitor
field in the simple chordate, Ciona intestinalis. Genes
Dev. 20,2728
-2738.
Delsuc, F., Brinkmann, H., Chourrout, D. and Philippe, H.
(2006). Tunicates and not cephalochordates are the closest living
relatives of vertebrates. Nature
439,965
-968.[CrossRef][Medline]
Dubois, L. and Vincent, A. (2001). The
COE-Collier/Olf1/EBF-transcription factors: structural conservation and
diversity of developmental functions. Mech. Dev.
108, 3-12.[CrossRef][Medline]
Eswarakumar, V. P., Lax, I. and Schlessinger, J.
(2005). Cellular signaling by fibroblast growth factor receptors.
Cytokine Growth Factor Rev.
16,139
-149.[CrossRef][Medline]
Favata, M. F., Horiuchi, K. Y., Manos, E. J., Daulerio, A. J.,
Stradley, D. A., Feeser, W. S., Van Dyk, D. E., Pitts, W. J., Earl, R.
A., Hobbs, F. et al. (1998). Identification of a novel
inhibitor of mitogen-activated protein kinase kinase. J. Biol.
Chem. 273,18623
-18632.
Fritzenwanker, J. H. and Technau, U. (2002).
Induction of gametogenesis in the basal cnidarian Nematostella vectensis
(Anthozoa). Dev. Genes Evol.
212,99
-103.[CrossRef][Medline]
Fritzenwanker, J. H., Saina, M. and Technau, U.
(2004). Analysis of forkhead and snail expression reveals
epithelial-mesenchymal transitions during embryonic and larval development of
Nematostella vectensis. Dev. Biol.
275,389
-402.[CrossRef][Medline]
Fritzenwanker, J. H., Genikhovich, G., Kraus, Y. and Technau,
U. (2007). Early development and axis specification in the
sea anemone Nematostella vectensis. Dev. Biol.
310,264
-279.[CrossRef][Medline]
Gamer, L. W., Nove, J., Levin, M. and Rosen, V.
(2005). BMP-3 is a novel inhibitor of both activin and BMP-4
signaling in Xenopus embryos. Dev. Biol.
285,156
-168.[CrossRef][Medline]
Gerhart, J., Lowe, C. and Kirschner, M. (2005).
Hemichordates and the origin of chordates. Curr. Opin. Genet.
Dev. 15,461
-467.[CrossRef][Medline]
Ghabrial, A., Luschnig, S., Metzstein, M. M. and Krasnow, M.
A. (2003). Branching morphogenesis of the Drosophila tracheal
system. Annu. Rev. Cell Dev. Biol.
19,623
-647.[CrossRef][Medline]
Hadfield, M. G., Meleshkevitch, E. A. and Boudko, D. Y.
(2000). The apical sensory organ of a gastropod veliger is a
receptor for settlement cues. Biol. Bull.
198, 67-76.[Abstract]
Hand, C. and Uhlinger, K. (1992). The culture,
sexual and asexual reproduction, and growth of the sea anemone
Nematostella vectensis. Biol. Bull.
182,169
-176.
Huang, P. and Stern, M. J. (2005). FGF
signaling in flies and worms: more and more relevant to vertebrate biology.
Cytokine Growth Factor Rev.
16,151
-158.[CrossRef][Medline]
Imai, K. S., Satoh, N. and Satou, Y. (2002).
Early embryonic expression of FGF4/6/9 gene and its role in the induction of
mesenchyme and notochord in Ciona savignyi embryos.
Development 129,1729
-1738.
Juan, H. and Hamada, H. (2001). Roles of
nodal-lefty regulatory loops in embryonic patterning of vertebrates.
Genes Cells 6,923
-930.[Abstract]
Keller, R. (2005). Cell migration during
gastrulation. Curr. Opin. Cell Biol.
17,533
-541.[CrossRef][Medline]
Kempf, S. C., Page, L. R. and Pires, A. (1997).
Development of serotonin-like immunoreactivity in the embryos and larvae of
nudibranch mollusks with emphasis on the structure and possible function of
the apical sensory organ. J. Comp. Neurol.
386,507
-528.[CrossRef][Medline]
Kimelman, D. (2006). Mesoderm induction: from
caps to chips. Nat. Rev. Genet.
7, 360-372.[CrossRef][Medline]
Kraus, Y. and Technau, U. (2006). Gastrulation
in the sea anemone Nematostella vectensis occurs by invagination and
immigration: an ultrastructural study. Dev. Genes
Evol. 216,119
-132.[CrossRef][Medline]
Kusserow, A., Pang, K., Sturm, C., Hrouda, M., Lentfer, J.,
Schmidt, H. A., Technau, U., von Haeseler, A., Hobmayer, B., Martindale, M. Q.
et al. (2005). Unexpected complexity of the Wnt gene family
in a sea anemone. Nature
433,156
-160.[CrossRef][Medline]
Lapraz, F., Rottinger, E., Duboc, V., Range, R., Duloquin, L.,
Walton, K., Wu, S. Y., Bradham, C., Loza, M. A., Hibino, T. et al.
(2006). RTK and TGF-beta signaling pathways genes in the sea
urchin genome. Dev. Biol.
300,132
-152.[CrossRef][Medline]
Lee, P. N., Kumburegama, S., Marlow, H. Q., Martindale, M. Q.
and Wikramanayake, A. H. (2007). Asymmetric
developmental potential along the animal-vegetal axis in the anthozoan
cnidarian, Nematostella vectensis, is mediated by Dishevelled. Dev.
Biol. 310,169
-186.[CrossRef][Medline]
Leptin, M. (2005). Gastrulation movements: the
logic and the nuts and bolts. Dev. Cell
8, 305-320.[CrossRef][Medline]
Magie, C. R., Pang, K. and Martindale, M. Q.
(2005). Genomic inventory and expression of Sox and Fox genes in
the cnidarian Nematostella vectensis. Dev. Genes Evol.
215,618
-630.[CrossRef][Medline]
Magie, C. R., Daly, M. and Martindale, M. Q.
(2007). Gastrulation in the cnidarian Nematostella vectensis
occurs via invagination not ingression. Dev. Biol.
305,483
-497.[CrossRef][Medline]
Martindale, M. Q., Pang, K. and Finnerty, J. R.
(2004). Investigating the origins of triploblasty: `mesodermal'
gene expression in a diploblastic animal, the sea anemone Nematostella
vectensis (phylum, Cnidaria; class, Anthozoa).
Development 131,2463
-2474.
Matus, D. Q., Thomsen, G. H. and Martindale, M. Q.
(2007). FGF signaling in gastrulation and neural development in
Nematostella vectensis, an anthozoan cnidarian. Dev. Genes
Evol. 217,137
-148.[CrossRef][Medline]
Medina, M., Collins, A. G., Silberman, J. D. and Sogin, M.
L. (2001). Evaluating hypotheses of basal animal phylogeny
using complete sequences of large and small subunit rRNA. Proc.
Natl. Acad. Sci. USA 98,9707
-9712.
Meinhardt, H. and Gierer, A. (2000). Pattern
formation by local self-activation and lateral inhibition.
BioEssays 22,753
-760.[CrossRef][Medline]
Metzger, R. J. and Krasnow, M. A. (1999).
Genetic control of branching morphogenesis. Science
284,1635
-1639.
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures
of the tyrosine kinase domain of fibroblast growth factor receptor in complex
with inhibitors. Science
276,955
-960.
Niswander, L. (2002). Interplay between the
molecular signals that control vertebrate limb development. Int. J.
Dev. Biol. 46,877
-881.[Medline]
Ogawa, K., Kobayashi, C., Hayashi, T., Orii, H., Watanabe, K.
and Agata, K. (2002). Planarian fibroblast growth factor
receptor homologs expressed in stem cells and cephalic ganglions.
Dev. Growth Differ. 44,191
-204.[CrossRef][Medline]
Pang, K., Matus, D. Q. and Martindale, M. Q.
(2004). The ancestral role of COE genes may have been in
chemoreception: evidence from the development of the sea anemone, Nematostella
vectensis (Phylum Cnidaria; Class Anthozoa). Dev. Genes
Evol. 214,134
-138.[CrossRef][Medline]
Putnam, N. H., Srivastava, M., Hellsten, U., Dirks, B., Chapman,
J., Salamov, A., Terry, A., Shapiro, H., Lindquist, E., Kapitonov, V. V. et
al. (2007). Sea anemone genome reveals ancestral eumetazoan
gene repertoire and genomic organization. Science
317, 86-94.
Rentzsch, F., Anton, R., Saina, M., Hammerschmidt, M., Holstein,
T. W. and Technau, U. (2006). Asymmetric expression of the
BMP antagonists chordin and gremlin in the sea anemone Nematostella vectensis:
implications for the evolution of axial patterning. Dev.
Biol. 296,375
-387.[CrossRef][Medline]
Rottinger, E., Saudemont, A., Duboc, V., Besnardeau, L., McClay,
D. and Lepage, T. (2008). FGF signals guide migration of
mesenchymal cells, control skeletal morphogenesis of the skeleton and regulate
gastrulation during sea urchin development.
Development 135,353
-365.
Ryan, J. F., Burton, P. M., Mazza, M. E., Kwong, G. K.,
Mullikin, J. C. and Finnerty, J. R. (2006). The
cnidarian-bilaterian ancestor possessed at least 56 homeoboxes: evidence from
the starlet sea anemone, Nematostella vectensis. Genome
Biol. 7,R64
.[CrossRef][Medline]
Solnica-Krezel, L. (2003). Vertebrate
development: taming the nodal waves. Curr. Biol.
13, R7-R9.[CrossRef][Medline]
Stern, C. D. (2005). Neural induction: old
problem, new findings, yet more questions. Development
132,2007
-2021.
Sudhop, S., Coulier, F., Bieller, A., Vogt, A., Hotz, T. and
Hassel, M. (2004). Signalling by the FGFR-like tyrosine
kinase, Kringelchen, is essential for bud detachment in Hydra vulgaris.
Development 131,4001
-4011.
Summerton, J. (1999). Morpholino antisense
oligomers: the case for an RNase H-independent structural type.
Biochim. Biophys. Acta
1489,141
-158.[Medline]
Technau, U., Rudd, S., Maxwell, P., Gordon, P. M., Saina, M.,
Grasso, L. C., Hayward, D. C., Sensen, C. W., Saint, R., Holstein, T. W. et
al. (2005). Maintenance of ancestral complexity and
non-metazoan genes in two basal cnidarians. Trends
Genet. 21,633
-639.[CrossRef][Medline]
Thisse, B. and Thisse, C. (2005). Functions and
regulations of fibroblast growth factor signaling during embryonic
development. Dev. Biol.
287,390
-402.[Medline]
Tickle, C. (1999). Morphogen gradients in
vertebrate limb development. Semin. Cell Dev. Biol.
10,345
-351.[CrossRef][Medline]
Voronezhskaya, E. E. and Khabarova, M. Y.
(2003). Function of the apical sensory organ in the development
of invertebrates. Dokl. Biol. Sci.
390,231
-234.[CrossRef][Medline]
Warburton, D., Schwarz, M., Tefft, D., Flores-Delgado, G.,
Anderson, K. D. and Cardoso, W. V. (2000). The molecular
basis of lung morphogenesis. Mech. Dev.
92, 55-81.[CrossRef][Medline]
Wilson, R. and Leptin, M. (2000). Fibroblast
growth factor receptor-dependent morphogenesis of the Drosophila mesoderm.
Philos. Trans. R. Soc. Lond. B Biol. Sci.
355,891
-895.
Wilson, S. I. and Edlund, T. (2001). Neural
induction: toward a unifying mechanism. Nat. Neurosci.
4 Suppl, 1161-1168.
Yaguchi, S., Yaguchi, J. and Burke, R. D.
(2006). Specification of ectoderm restricts the size of the
animal plate and patterns neurogenesis in sea urchin embryos.
Development 133,2337
-2346.
Yang, X., Dormann, D., Munsterberg, A. E. and Weijer, C. J.
(2002). Cell movement patterns during gastrulation in the chick
are controlled by positive and negative chemotaxis mediated by FGF4 and FGF8.
Dev. Cell 3,425
-437.[CrossRef][Medline]
Yasuo, H. and Hudson, C. (2007). FGF8/17/18
functions together with FGF9/16/20 during formation of the notochord in Ciona
embryos. Dev. Biol. 302,92
-103.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Saina, G. Genikhovich, E. Renfer, and U. Technau BMPs and Chordin regulate patterning of the directive axis in a sea anemone PNAS, November 3, 2009; 106(44): 18592 - 18597. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Genikhovich and U. Technau The Starlet Sea Anemone Nematostella vectensis: An Anthozoan Model Organism for Studies in Comparative Genomics and Functional Evolutionary Developmental Biology CSH Protocols, September 1, 2009; 2009(9): pdb.emo129 - pdb.emo129. [Abstract] [Full Text] |
||||
![]() |
G. Genikhovich and U. Technau Anti-acetylated Tubulin Antibody Staining and Phalloidin Staining in the Starlet Sea Anemone Nematostella vectensis CSH Protocols, September 1, 2009; 2009(9): pdb.prot5283 - pdb.prot5283. [Abstract] [Full Text] |
||||
![]() |
Y. Yasuoka, M. Kobayashi, D. Kurokawa, K. Akasaka, H. Saiga, and M. Taira Evolutionary origins of blastoporal expression and organizer activity of the vertebrate gastrula organizer gene lhx1 and its ancient metazoan paralog lhx3 Development, June 15, 2009; 136(12): 2005 - 2014. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kadam, A. McMahon, P. Tzou, and A. Stathopoulos FGF ligands in Drosophila have distinct activities required to support cell migration and differentiation Development, March 1, 2009; 136(5): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||