|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 9 April 2008
doi: 10.1242/dev.017350
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Anatomy and Development Biology, University College London,
Gower Street, London WC1E 6BT, UK.
2 P. Universidad Católica de Chile, Alameda 340, Santiago, Chile.
3 Randall Division of Cell and Molecular Biophysics, King's College London,
Guy's Campus, London SE1 1UL, UK.
* Author for correspondence (e-mail: r.mayor{at}ucl.ac.uk)
Accepted 19 March 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Cell migration, Neural crest, Directionality, Persistence, Syndecan-4, Non-canonical Wnt signaling, PCP, RhoA, Rac1
| INTRODUCTION |
|---|
|
|
|---|
The NC has been called `the explorer of the embryo' because of its inherent
migratory abilities. NC cells migrate from the dorsal neural tube, covering
extremely long distances and colonizing almost all the tissues of the embryo.
Upon reaching their destination, they differentiate into a wide range of cell
types, including neurons, glial cells, skeletal and connective tissue, and
adrenergic and pigment cells (LeDouarin
and Kalcheim, 1999
).
The migration of the NC is a highly ordered process; individual NC cells
migrate with high persistence towards the direction of their targets
(Teddy and Kulesa, 2004
), but
it is not known how this directionality is controlled. A number of molecules
have been identified as being key players in neural crest migration (for a
review, see Kuriyama and Mayor,
2008
). However most of these molecules function as inhibitory
signals, which are required to prevent the migration of NC cells into
prohibited areas. Although chemoattraction has been one of the proposed
mechanisms to explain this directional migration, no chemoattractant has thus
far been found in the NC. This prompted us to look for alternative mechanisms
that might generate directional migration. Interestingly, researchers studying
cell migration in vitro have observed that cultured cells can migrate with a
high directionality even in the absence of external chemoattractants. It is
known that in vitro cell migration requires the formation of membrane
protrusions at the leading edge of the cell, membrane adhesive interactions
with the substrata and the coordinated dynamics of the cytoskeleton
(Lauffenburger and Horwitz,
1996
; Pollard and Borisy,
2003
; Ridley et al.,
2003
; Sheetz et al.,
1999
). Small GTPases (Rac, Rho and Cdc42) are well-known
modulators of several of these activities (for reviews, see
Ridley et al., 2003
;
Jaffe and Hall, 2005
).
Moreover, it has been shown that directional migration in vitro in the absence
of extrinsic chemoattractants is controlled by the level of Rac activity
(Pankov et al., 2005
). Rac
promotes the formation of peripheral lamella during random migration, while
slightly lower levels of Rac suppress peripheral lamella and favour the
formation of a polarized cell with lamella just at the leading edge
(Pankov et al., 2005
).
Syndecan-4 (Syn4) is a proteoglycan that is involved in the migration of
cells cultured in vitro, and it has been proposed as a key regulator of RhoA
and Rac activities, focal adhesion formation and planar cell polarity (PCP)
signaling (for a review, see Alexopoulou et
al., 2007
). In this study, we examined the role of Syn4 in neural
crest migration in Xenopus and zebrafish embryos. We show that
syn4 is expressed specifically in the migrating neural crest and that
it is essential for its migration. In addition, we show that Syn4 controls
directional migration by regulating the polarized formation of cell
protrusions, in a manner similar to non-canonical Wnt signaling. In order to
understand the molecular mechanism by which Syn4 and planar cell polarity
(PCP) signaling control the orientation of cell protrusions, we performed
fluorescence resonance energy transfer (FRET) analysis to measure the activity
of the small GTPases, Cdc42, RhoA and Rac. This is the first time that this
kind of FRET analysis has been carried out in vivo. Our results indicate that
whereas Syn4 inhibits Rac activity, PCP signaling activates RhoA. In addition,
we show that RhoA, through Rock, is an inhibitor of Rac activity in the neural
crest. Thus, the convergence of Syn4 and PCP signaling through the regulation
of small GTPases contributes to the directional migration of neural crest
cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Whole-mount in situ hybridization and cartilage staining
In situ hybridization was carried out according to Harland
(Harland, 1991
) using
digoxigenin-labelled antisense RNA probes (Roche Diagnostics). Probes used
were: Xenopus syn4 (Munoz et al.,
2006
); and zebrafish syn4, snail2
(Mayor et al., 1995
),
fli (Meyer et al.,
1995
), foxd3 (Kelsh
et al., 2000
) and crestin
(Luo et al., 2001
). For
cartilage staining, 5-dpf zebrafish were stained according to Barrallo-Gimeno
et al. (Barrallo-Gimeno et al.,
2004
).
RNA synthesis and morpholino microinjection
cDNA was linearized and RNA was synthesized using the mMessage mMachine Kit
(Ambion), according to the manufacturer's instructions. mRNA and MOs were
co-injected into Xenopus embryos with fluorescein dextran (FDX,
Molecular Probes) at the eight- or 32-cell stage
(Aybar et al., 2003
). For
zebrafish microinjection, 4 nl was injected at the one- or two-cell stage. The
mRNA constructs used were: Xenopus syn4
(Munoz et al., 2006
); and
zebrafish syn4, DshDEP+ and Dsh
N
(Tada and Smith, 2000
), and
mutant syn4. Two translation-blocking MOs against zebrafish
syn4 were designed over the 5'UTR region: syn4 MO1,
5'CGGACAACTTTATTCACTCGGGCTA3'; and syn4 MO2,
5'GAGAAG(ATG)TTGAAAGTTTACCTCA3'. As both MOs produced the same
phenotype, we used mainly syn4 MO1 (called syn4 MO), except
in some experiments where syn4 MO2 or a mixture of both MOs was used,
as indicated in the text and figure legends. A standard control MO was used:
5'CCTCTTACCTCAGTTACAATTTATA3'. Injection of this control MO into
wild-type zebrafish embryos caused no defective phenotype. Two
translation-blocking MOs against Xenopus syn4 were used:
syn4 MO1, 5'GCACAAACAGCAGGGTCGGACTCAT3'; and
syn4 MO2, 5'CTAAAAGCAGCAGGAGGCGATTCAT3'
(Munoz et al., 2006
).
Throughout this work, a 1:1 mixture of both MOs called syn4 MO was
used. A 5-base mismatched MO against Xenopus syn4 was used as a
control (5'GCAGAAAGATCAGCGTCCGACTGAT3'). The other MO used was
directed against wnt5a (Lele et
al., 2001
). Unless stated otherwise, 6 ng of MO was used for
zebrafish and 8 ng for Xenopus.
For the mutation in the PKC
-binding site of Syn4 (called
Syn4*), a mutation was introduced in the PIP2-binding site that
enables interaction with PKC
. Amino acid residues Y185KK
were changed to LQQ using PCR with mutated primers. According to Horowitz et
al., this mutation reduces the affinity of PIP2 binding to Syn4 (Horowitz et
al., 1999). We observed that this mutant has the same activity as wild-type
Syn4 in a neural plate induction assay (our unpublished results).
Time-lapse microscopy
sox10:egfp was used to analyze NC migration in vivo
(Carney et al., 2006
). Embryos
were processed as described by Westerfield
(Westerfield, 2000
). Each
embryo was staged according to the number of somites and only embryos with
equal numbers of somites were compared. The embryos were dechorionated,
inserted into a drop of 0.20% agarose in embryo medium
(Westerfield, 2000
) and
mounted in a custom-built chamber. Control and experimental embryos were
mounted side-by-side in the same chamber. A compound (Leica DM5500) or a
confocal (Leica SP2-DMRE) microscope was used for time-lapse imaging. Digital
images were typically collected at 30 to 90 second intervals for a period of
between 1 and 14 hours. We performed z-stack in preliminary
experiments to establish how deep the NC migrates in the embryo. After 6- to
8-hour time-lapse imaging of 20-somite embryos, we found that cephalic NC
cells migrate between 500 and 800 µm in the anteroposterior axis, between
40 and 60 µm in the dorsoventral axis, and between 7 and 9 µm in the
periphery-center axis. Consequently, for tracking analysis, we can assume that
most of the cell migration is performed in two dimensions; the third dimension
(in the z-axis when the embryo has a lateral orientation) can be
neglected.
Sequences of images were quantitatively analyzed using the public domain program NIH ImageJ (developed at the US National Institutes of Health) and Matlab (MathWorks). Tracking of individual cells was used to calculate velocity (total distance traveled divided by time), persistence (defined as the ratio between the linear distance from the initial to the final point and the total length of the migratory path) and the angle of migration (with respect to its previous position).
The shape of individual cells was analyzed using NIH ImageJ. Thresholds were fixed at the same value for control and syn4 MO-injected cells. The outline/analyze particles function was used to draw the contour of each cell at different time points, which were overlapped maintaining the original XY positions. Two independent methods were used to analyze cell protrusions. For the first method, we defined Cell extension (CE) as the new positive area between two consecutives frames (separated by the shortest time of 1 minute in the time-lapse analysis). During the course of one minute, the body (and centroid) of the cell does not move a significant distance and most of the new area generated corresponds to lamellipodia extension. Note, fillopodia were not considered in this analysis as they move faster and the intensity of fluorescence is weaker. Using ImageJ, we subtracted two consecutives frames, in a manner that the new growing area was shown in red and the unchanged area in white (Fig. 6C,H,M). The centroid (defined as the average of the x and y coordinates of all the cell pixels) was calculated and a vector between the centroid (x) and the center of the red area was drawn (arrow in Fig. 6N). These vectorial data were used to analyze the distribution of CE orientation under different conditions. As a second method to estimate cell protrusion, we measured the Cell Smoothness (CS), defined as the ratio between the perimeter of an ideal ellipse-shaped cell and the actual perimeter of the cell. The ellipse was the best-fit ellipse and we used the standard built-in ImageJ function. This value gives us an unbiased measure of how folded a cell is (i.e. how many protrusions a cell has). P-values were obtained using a one-way analysis of variance (ANOVA). All statistical analyses and their graphical illustrations were performed on Matlab, using both built-in functions and customized scripts (available from the authors on request).
Fluorescence (Förster) resonance energy transfer (FRET)
Plasmid DNA encoding FRET probes [Raichu-Rac, Raichu-Cdc42
(Itoh et al., 2002
) and RhoA
biosensor (Pertz et al.,
2006
)] was injected directly into Xenopus embryos at the
eight-cell stage and NCs were dissected at stage 15. For in vitro analysis, NC
cells were cultured on fibronectin, as described by Alfandari et al.
(Alfandari et al., 2003
), and
fixed with 4% PFA after 5-7 hours migration. For the in vivo analysis,
injected neural crests were grafted into wild-type hosts. Embryos were fixed
in MEMFA at stage 26, and 12 µm cryostat sections were taken.
Samples for FRET analysis were imaged using a Zeiss lSM 510 META laser scanning confocal microscope and a 63x Plan Apochromat NA 1.4 Ph3 oil objective. The CFP and YFP channels were excited using the 405-nm blue diode laser and the 514-nm argon line, respectively. The two emission channels were split using a 545-nm dichroic mirror, which was followed by a 475-525 nm bandpass filter for CFP and a 530 nm longpass filter for YFP. Pinholes were opened to give a depth of focus of 3 mm for each channel. Scanning was performed on a line-by-line basis with the zoom level set to two. The gain for each channel was set to approximately 75% of dynamic range (12-bit, 4096 gray levels) and offsets set such that backgrounds were zero. The time-lapse mode was used to collect one prebleach image for each channel before bleaching with 50 scans of the 514 nm argon laser line at maximum power (to bleach YFP). A second post-bleach image was then collected for each channel. Pre- and post-bleach CFP and YFP images were imported into Mathematica 5.2 for processing. Briefly, images were smoothed using a 3x3 box mean filter, background subtracted and post-bleach images fade compensated. A FRET efficiency ratio map over the whole cell was calculated using the following formula: (CFPpostbleach-CFPprebleach)/CFPpostbleach. Ratio values were then extracted from pixels falling inside the bleach region, as well as an equal-sized region outside of the bleach region, and the mean ratio was determined for each region and plotted on a histogram. The non-bleach ratio was then subtracted from the bleach region ratio to give a final value for the FRET efficiency ratio. Data from images were used only if YFP bleaching efficiency was greater than 70%.
|
|
| RESULTS |
|---|
|
|
|---|
This highly localized expression of syn4 prompted us to analyze its function in NC development. Two morpholino antisense oligonucleotides (MO1, MO2) were developed to inhibit zebrafish syn4. We tested the efficiency of MO1 by analyzing its ability to reduce the fluorescence of a Syn4-GFP fusion protein (Fig. 2A-C). Injection of syn4 MO1 or syn4 MO2 into zebrafish produces a dramatic reduction of neural crest derivatives, including cartilage (Fig. 2D,E,G,H; see also Fig. S1 in the supplementary material) and melanocytes (Fig. 2F,I; Fig. S1 in the supplementary material). We ruled out a possible role for Syn4 in NC specification by analyzing the expression of early NC markers. No effect on the expression of NC markers was seen in Xenopus (Fig. 2J) or zebrafish (Fig. 2K,L) embryos injected with syn4 MOs. In addition, when either control ectoderm, or ectoderm injected with syn4 MO, was combined with dorsolateral mesoderm to test for induction of the NC, no difference was observed (Fig. 2M-O).
|
-binding site does not rescue NC
migration in syn4-MO-injected embryos
(Fig. 3E, two last columns),
which is different to what has been reported for the effect of this mutation
in cells cultured in vitro (Bass et al.,
2007
Our results show that syn4 MO affects NC migration; however, it is
also possible that the MO interferes with NC migration in a
non-cell-autonomous manner, as it is known, for example, that syn4 MO
affects convergent extension of mesoderm
(Munoz et al., 2006
) (L.M. and
R.M., unpublished). Two experiments were performed to analyze this
possibility. First, we injected zebrafish embryos with a MO against
has2, the synthesizing enzyme of Hyaluronan, which has been described
to perturb convergent extension (Bakkers et
al., 2004
). Injection of the has2 MO produced a strong
phenotype in convergent extension, as previously described, but no difference
in the migration of NC between control and has2 MO-injected embryos
was observed (see Fig. S2A,B in the supplementary material). A second set of
experiments were performed to show that syn4 MO inhibits cell
migration in a cell-autonomous manner. Grafts of fluorescein dextran (FDX)- or
syn4 5-base mismatched MO (syn4 5mm MO)-injected
Xenopus NC into control embryos
(Fig. 4A) show normal migration
(Fig. 4B,C; uninjected, 87%
grafts migrated, n=15; syn4 5mm MO, 75% grafts migrated,
n=12); however, grafts of NC injected with syn4 MO exhibit a
complete inhibition of migration (Fig.
4D; 0% grafts migrated, n=15). This result suggests that
Syn4 is required in a cell-autonomous manner for NC migration. However, the NC
graft contains a large number of cells that could affect each other in a
non-cell-autonomous manner; therefore, true cell-autonomy can only be examined
by grafting single cells. As it is technically difficult to do this in
Xenopus, we used zebrafish embryos for this experiment, using a
transgenic line that expresses GFP only in NC cells (sox10:egfp)
(Carney et al., 2006
). We
grafted either NC cells injected with the syn4 MO into wild-type
embryos (Fig. 4E) or wild-type
NC cells into embryos injected with the MO
(Fig. 4F).
Fig. 4G-N shows the
GFP-positive cells after 4 hours of migration. The average distance traveled
in 4 hours by several grafts is shown in
Fig. 4O,P. The control MO did
not inhibit NC migration (Fig.
4O,P; compare position at time 0, indicated by the black arrow in
Fig. 4G-J with the position 4
hours later, white arrow in Fig.
4H,J). However, syn4 MO had a significant effect on NC
migration, whether present in the grafted NC or in the host
(Fig. 4K-P). These results
suggest that Syn4 is required autonomously in the NC to control its migration,
but that an interaction with other NC cells expressing syn4 is also
required.
Syn4 controls the directionality of NC migration and the orientation of cell protrusions
As the migration of NC cells is a complex process involving an early
delamination step followed by active cell migration, we explored which step is
affected by syn4 MO. We used the sox10:egfp zebrafish
transgenic line to visualize migrating NC cells
(Carney et al., 2006
).
The movement of individual cephalic NC cells was followed (Fig. 5A-D; similar results were seen with trunk NC, data not shown) and their migration path was tracked (Fig. 5E). A strong inhibition of the migration of NC cells in the syn4 MO-injected embryos was observed (Fig. 5F-I; see also Fig. S3 in the supplementary material); the cells were motile, but their overall migration was reduced, as shown by the cell tracks (Fig. 4J). We confirmed that these effects were not due to a delay in cell migration by analyzing embryos at later stages of development (see Movie 1 in the supplementary material). Moreover, these data suggest that delamination and cell motility are not inhibited, as cells can migrate as individuals. Tracks of individual cells (Fig. 5K) showed no significant difference in the velocity of migration between control and syn4 MO cells (Fig. 5L; P=0.2276, n=15). However, the directionality of migration [measured as persistence (the linear displacement of the cell divided by the total distance traveled)] was significantly affected by the syn4 MO (Fig. 5M; P=0.0049, n=15). The distribution of angles of migration for each individual cell at each time point also demonstrated a significant difference between control MO (Fig. 5N,O) and syn4 MO (Fig. 5N,P; P=0.0044, n=665) cells. Taken together, these results indicate that the syn4 MO affects NC migration by interfering with the directionality of migration. As far as we know, this is the first time that a specific effect on the directional migration of NC cells has been described during development.
|
|
|
|
|
Syn4 and PCP signaling control the localized activity of Rac and RhoA
It has been observed in many in vitro studies of cell migration that cell
polarity and the formation of cell protrusions are dependent on the activity
of members of the small Rho GTPase family
(Jaffe and Hall, 2005
). To
analyze the activity of GTPases in the NC in vitro and in vivo, we used
fluorescence resonance energy transfer (FRET) biosensors for Cdc42, Rac and
RhoA (Itoh et al., 2002
;
Pertz et al., 2006
). The
inhibition of Syn4 leads to a fivefold increase in Rac activity
(Fig. 8A-C). No significant
effect on the activity or localization of Cdc42 or RhoA was seen between
control and syn4 MO-injected cells
(Fig. 8A). Therefore, Syn4
inhibits Rac activity in the NC cell migrating in vitro.
Next, we investigated whether Dsh could also play a role in GTPase
signaling. The activation of Cdc42, Rac and RhoA was compared among control NC
cells and cells from embryos injected with Dsh
n or DshDep+
(Fig. 8D-F). The activation or
inhibition of Dsh had no significant effect on the activity of Cdc42 or Rac
(Fig. 8D). However, the
activation of Dsh led to a significant increase in RhoA activity, whereas the
inhibition of Dsh produced a significant decrease in RhoA activity
(Fig. 8D-F). Thus, Dsh-PCP
promotes RhoA activity in NC migration in vitro.
|
These measurements of small Rho GTPase activity were performed in NC cells
cultured on fibronectin in vitro. A growing number of reports suggest that
there are important differences in the migration of cells cultured in
two-dimensional (2D) versus 3D matrices
(Even-Ram and Yamada, 2005
),
and that those differences could be even bigger when cell migration is
analyzed in vivo, so we decided to perform FRET analysis of NC cells migrating
in the embryo. To our knowledge, this is the first time that small GTPase
activity has been observed in vivo using FRET. DNA coding the FRET probes for
RhoA and Rac was injected in blastomeres fated to become NC cells. At the
early neurula stages, the NCs were dissected from the injected
Xenopus embryos and grafted into control hosts. NC cells could be
identified by the fluorescence of membrane-RFP, which was co-injected with
each probe. During migration the embryos were fixed and sectioned, and FRET
analysis was performed. Fig.
9A-D shows the migrating NC, and in
Fig. 9A'-D' cells
expressing the biosensors can be seen. Examples of FRET efficiency for
individual cells migrating in vivo are shown in
Fig. 9E-H. A clear increase in
Rac activity is observed in syn4 MO cells
(Fig. 9I), whereas an
inhibition of RhoA is observed after Dsh inhibition
(Fig. 9J). This confirms our in
vitro observations, indicating that, in terms of Rho GTPase regulation, there
is no apparent difference between the 2D in vitro and in vivo migration of NC
cells. Taken together, our results indicate that Syn4 acts as an inhibitor of
Rac and that the Dsh-PCP pathway promotes the activity of RhoA. In addition,
activation of RhoA by PCP signaling may also result in Rac inhibition via the
inhibitory activity of Rock upon Rac. These data all support a model whereby
the Syn4 and PCP activities converge to polarize the formation of cell
protrusions, restricting them to the front of the cell. More specifically,
they control the levels of Rac, by both a Rac-Syn4 and a RhoA-PCP dependent
pathway.
| DISCUSSION |
|---|
|
|
|---|
Cdc42 has been shown to be active at the front of migrating cells and it
has been suggested that this may be required for cell polarity
(Etienne-Manneville and Hall,
2002
). However, more recent studies show no significant effects of
loss of Cdc42 upon cell polarity [either by genetic ablation or siRNA
targeting (Czuchra et al.,
2005
; Pankov et al.,
2005
)]. Our data demonstrate that the inhibition of Syn4 or PCP
has no effect on the activation status of Cdc42, despite having a profound
effect upon cell polarity and directed migration. This would suggest that in
NC migration, Cdc42 is not the primary GTPase regulating polarization and
protrusion formation.
Rac activation at the front of a cell has also been shown to be a key event
for directional migration (Grande-Garcia
et al., 2005
; Nishiya et al.,
2005
). Several factors control the localized activity of Rac, such
as specific guanine nucleotide-exchange factors (GEFs) that are delivered to
the front of the cell in a PI3K-dependent manner
(Welch et al., 2003
), and the
formation of lipid rafts (del Pozo et al.,
2004
). Once Rac is active, numerous feedback loops help to
maintain directional protrusions (Ridley
et al., 2003
). We have shown here that Syn4 contributes to the
inhibition of Rac, as an antisense MO against syn4 increases the
levels of Rac in the entire cell, leading to loss of cell polarity similar to
that seen in other cells types in vitro
(Bass et al., 2007
;
Saoncella et al., 2004
). Bass
and colleagues showed that the regulation of Rac levels by Syn4 contributes to
a persistent migration in vitro, with Syn4-null fibroblasts showing an
activation of Rac around the cell periphery
(Bass et al., 2007
), similar to
what we have observed in the NC. However, there are some notable differences
between their results and those shown here, primarily that they demonstrate
that Syn4 stimulates a wave of Rac activation upon initial cell spreading,
whereas we only observed a negative regulation of Rac by Syn4. Additionally,
Bass et al. showed that Syn4 containing a mutation in the PKC
-binding
site was able to rescue persistent migration in vitro, whereas we were unable
to rescue the embryonic phenotype of the syn4 MO with this same
mutant. Thus, our results support the previous notion that the
PKC
-binding site is essential for Syn4 function
(Alexopoulou et al., 2007
). The
differences between our results and those of Bass et al.
(Bass et al., 2007
) could be
due to the added complexity of migration in an in vivo environment, or to an
intrinsic difference between NC cells and fibroblasts.
|
vβ3
integrin is not detected in 3D-matrix adhesion, and focal adhesion kinase
(FAK) is less phosphorylated at residue Y397 in fibroblasts in a 3D matrix
than it is in those on a 2D substrate
(Cukierman et al., 2001
Unlike with Syn4, no significant effect on Rac activity was observed after
modifying PCP signaling in our study, consistent with the role of Rock on
convergent extension (Marlow et al.,
2002
). This is paradoxical, because we show that PCP signaling
promotes RhoA activation and that RhoA, via Rock, inhibits the activity of Rac
in NC cells. One possible explanation is that a residual amount of RhoA
remaining after Dsh inhibition is sufficient to maintain the normal Rac
level.
It has been demonstrated that RhoA, Rac1 and Cdc42 all act downstream of
PCP signaling (Choi and Han,
2002
; Habas et al.,
2003
; Penzo-Mendez et al.,
2003
). Convergent extension in Xenopus and zebrafish are
dependent on RhoA/Rac activity, controlled by PCP signaling
(Habas et al., 2003
;
Habas et al., 2001
;
Tahinci and Symes, 2003
). Our
results show that RhoA, but not Rac, is dependent on PCP signaling.
Interestingly, a triple deletion of the three Rac genes in Drosophila,
Rac1, Rac2 and Mtl, fails to cause PCP defects
(Adler, 2002
;
Hakeda-Suzuki et al., 2002
),
suggesting that Rac signaling is not essential for the PCP pathway.
One open question is: how exactly does Syn4 interact with PCP signaling to
control NC migration? Our results clearly indicate that Syn4 and PCP activate
two parallel pathways that lead to the inhibition of Rac activity and the
activation of RhoA, respectively (Fig.
10). However, we also show that RhoA inhibits Rac activity in the
NC. Thus, both pathways ultimately have the same effect of decreasing the
overall levels of Rac, either directly or indirectly, which is necessary for
the polarized formation of cell protrusions and for maintaining persistent
migration (Pankov et al.,
2005
). The requirement for precise levels of Rac signaling for
persistent migration may explain why both inhibition and overexpression of
Syn4 produce an inhibition of migration, as has been previously shown for the
PCP signaling pathway (De Calisto et al.,
2005
; Wallingford et al.,
2000
). It has recently been shown that Syn4 interacts with PCP
signaling during convergent extension of the mesoderm
(Munoz et al., 2006
). They
propose a direct interaction of Syn4 with Dsh and Frz7. Thus, it is possible
that, in addition to this interaction between Syn4 and the Wnt receptor, each
of these molecules could lead to the activation of parallel pathways that
control the activity of small GTPases, as we have shown here.
Chemotaxis has been suggested as one of the mechanisms to explain the
directional migration of NC cells; however, there is no sound evidence for
this proposal. Moreover, persistent directional migration occurs in vitro in
the absence of chemoattractants. Instead, interactions between the
extracellular matrix, integrins, and the levels of Rac and Syn4 can control
persistent migration (Bass et al.,
2007
; Choma et al.,
2004
; Pankov et al.,
2005
; White et al.,
2007
). Here, we provide evidence that a similar mechanism
regulates the migration of NC cells in vivo. Syn4 and PCP signaling in the NC
act on RhoA and Rac to maintain the balance of Rac required for the formation
of directional cell protrusions, which results in a persistent, directional
migration.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/10/1771/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adler, P. N. (2002). Planar signaling and
morphogenesis in Drosophila. Dev. Cell.
2, 525-535.[CrossRef][Medline]
Alexopoulou, A. N., Multhaupt, H. A. and Couchman, J. R.
(2007). Syndecans in wound healing, inflammation and vascular
biology. Int. J. Biochem. Cell Biol.
39,505
-528.[CrossRef][Medline]
Alfandari, D., Cousin, H., Gaultier, A., Hoffstrom, B. G. and
DeSimone, D. W. (2003). Integrin
5β1 supports the
migration of Xenopus cranial neural crest on fibronectin. Dev.
Biol. 260,449
-464.[CrossRef][Medline]
Aybar, M. J., Nieto, M. A. and Mayor, R.
(2003). Snail precedes slug in the genetic cascade required for
the specification and migration of the Xenopus neural crest.
Development 130,483
-494.
Bakkers, J., Kramer, C., Pothof, J., Quaedvlieg, N. E., Spaink,
H. P. and Hammerschmidt, M. (2004). Has2 is required upstream
of Rac1 to govern dorsal migration of lateral cells during zebrafish
gastrulation. Development
131,525
-537.
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Bass, M. D., Roach, K. A., Morgan, M. R., Mostafavi-Pour, Z.,
Schoen, T., Muramatsu, T., Mayer, U., Ballestrem, C., Spatz, J. P. and
Humphries, M. J. (2007). Syndecan-4-dependent Rac1 regulation
determines directional migration in response to the extracellular matrix.
J. Cell Biol. 177,527
-538.
Carney, T. J., Dutton, K. A., Greenhill, E., Delfino-Machin, M.,
Dufourcq, P., Blader, P. and Kelsh, R. N. (2006). A direct
role for Sox10 in specification of neural crest-derived sensory neurons.
Development 133,4619
-4630.
Choi, S. C. and Han, J. K. (2002). Xenopus
Cdc42 regulates convergent extension movements during gastrulation through
Wnt/Ca2+ signaling pathway. Dev. Biol.
244,342
-357.[CrossRef][Medline]
Choma, D. P., Pumiglia, K. and DiPersio, C. M.
(2004). Integrin
3β1 directs the stabilization of a
polarized lamellipodium in epithelial cells through activation of Rac1.
J. Cell Sci. 117,3947
-3959.
Cukierman, E., Pankov, R., Stevens, D. R. and Yamada, K. M.
(2001). Taking cell-matrix adhesions to the third dimension.
Science 294,1708
-1712.
Czuchra, A., Wu, X., Meyer, H., van Hengel, J., Schroeder, T.,
Geffers, R., Rottner, K. and Brakebusch, C. (2005).
Cdc42 is not essential for filopodium formation, directed migration, cell
polarization, and mitosis in fibroblastoid cells. Mol. Biol.
Cell 16,4473
-4484.
De Calisto, J., Araya, C., Marchant, L., Riaz, C. F. and Mayor,
R. (2005). Essential role of non-canonical Wnt signalling in
neural crest migration. Development
132,2587
-2597.
del Pozo, M. A., Alderson, N. B., Kiosses, W. B., Chiang, H. H.,
Anderson, R. G. and Schwartz, M. A. (2004). Integrins
regulate Rac targeting by internalization of membrane domains.
Science 303,839
-842.
Echtermeyer, F., Streit, M., Wilcox-Adelman, S., Saoncella, S.,
Denhez, F., Detmar, M. and Goetinck, P. (2001). Delayed wound
repair and impaired angiogenesis in mice lacking syndecan-4. J.
Clin. Invest. 107,R9
-R14.[Medline]
Etienne-Manneville, S. and Hall, A. (2002). Rho
GTPases in cell biology. Nature
420,629
-635.[CrossRef][Medline]
Even-Ram, S. and Yamada, K. M. (2005). Cell
migration in 3D matrix. Curr. Opin. Cell Biol.
17,524
-532.[CrossRef][Medline]
Gao, Y., Dickerson, J. B., Guo, F., Zheng, J. and Zheng, Y.
(2004). Rational design and characterization of a Rac
GTPase-specific small molecule inhibitor. Proc. Natl. Acad. Sci.
USA 101,7618
-7623.
Grande-Garcia, A., Echarri, A. and Del Pozo, M. A.
(2005). Integrin regulation of membrane domain trafficking and
Rac targeting. Biochem. Soc. Trans.
33,609
-613.[CrossRef][Medline]
Habas, R., Dawid, I. B. and He, X. (2003).
Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for
vertebrate gastrulation. Genes Dev.
17,295
-309.
Habas, R., Kato, Y. and He, X. (2001).
Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires
a novel Formin homology protein Daam1. Cell
107,843
-854.[CrossRef][Medline]
Hakeda-Suzuki, S., Ng, J., Tzu, J., Dietzl, G., Sun, Y., Harms,
M., Nardine, T., Luo, L. and Dickson, B. J. (2002). Rac
function and regulation during Drosophila development. Nature
416,438
-442.[CrossRef][Medline]
Harland, R. M. (1991). In situ hybridization:
an improved whole-mount method for Xenopus embryos. Methods Cell
Biol. 36,685
-695.[Medline]
Itoh, R. E., Kurokawa, K., Ohba, Y., Yoshizaki, H., Mochizuki,
N. and Matsuda, M. (2002). Activation of Rac and Cdc42 video
imaged by fluorescent resonance energy transfer-based single-molecule probes
in the membrane of living cells. Mol. Cell. Biol.
22,6582
-6591.
Jaffe, A. B. and Hall, A. (2005). Rho GTPases:
biochemistry and biology. Annu. Rev. Cell Dev. Biol.
21,247
-269.[CrossRef][Medline]
Kelsh, R. N., Dutton, K., Medlin, J. and Eisen, J. S.
(2000). Expression of zebrafish fkd6 in neural crest-derived
glia. Mech. Dev. 93,161
-164.[CrossRef][Medline]
Kilian, B., Mansukoski, H., Barbosa, F. C., Ulrich, F., Tada, M.
and Heisenberg, C. P. (2003). The role of Ppt/Wnt5 in
regulating cell shape and movement during zebrafish gastrulation.
Mech. Dev. 120,467
-476.[CrossRef][Medline]
Kuriyama, S. and Mayor, R. (2008). Molecular
analysis of neural crest migration. Philos. Trans. R. Soc. Lond. B
Biol. Sci. 363,1349
-1362.
Lauffenburger, D. A. and Horwitz, A. F. (1996).
Cell migration: a physically integrated molecular process.
Cell 84,359
-369.[CrossRef][Medline]
LeDouarin, N. M. and Kalcheim, C. (1999).
The Neural Crest, 2nd edn. Cambridge: Cambridge
University Press.
Lele, Z., Bakkers, J. and Hammerschmidt, M.
(2001). Morpholino phenocopies of the swirl, snailhouse,
somitabun, minifin, silberblick, and pipetail mutations.
Genesis 30,190
-194.[CrossRef][Medline]
Luo, R., An, M., Arduini, B. L. and Henion, P. D.
(2001). Specific pan-neural crest expression of zebrafish Crestin
throughout embryonic development. Dev. Dyn.
220,169
-174.[CrossRef][Medline]
Mancilla, A. and Mayor, R. (1996). Neural crest
formation in Xenopus laevis: mechanisms of Xslug induction. Dev.
Biol. 177,580
-589.[CrossRef][Medline]
Marlow, F., Topczewski, J., Sepich, D. and Solnica-Krezel,
L. (2002). Zebrafish Rho kinase 2 acts downstream of Wnt11 to
mediate cell polarity and effective convergence and extension movements.
Curr. Biol. 12,876
-884.[CrossRef][Medline]
Mayor, R., Morgan, R. and Sargent, M. G.
(1995). Induction of the prospective neural crest of Xenopus.
Development 121,767
-777.[Abstract]
Meyer, D., Stiegler, P., Hindelang, C., Mager, A. M. and Remy,
P. (1995). Whole-mount in situ hybridization reveals the
expression of the Xl-Fli gene in several lineages of migrating cells in
Xenopus embryos. Int. J. Dev. Biol.
39,909
-919.[Medline]
Munoz, R., Moreno, M., Oliva, C., Orbenes, C. and Larrain,
J. (2006). Syndecan-4 regulates non-canonical Wnt signalling
and is essential for convergent and extension movements in Xenopus embryos.
Nat. Cell Biol. 8,492
-500.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1967).Normal Table of Xenopus laevis (Doudin)
.
Amsterdam: Elsevier-North Holland Publishing.
Nishiya, N., Kiosses, W. B., Han, J. and Ginsberg, M. H.
(2005). An alpha4 integrin-paxillin-Arf-GAP complex restricts Rac
activation to the leading edge of migrating cells. Nat. Cell.
Biol. 7,343
-352.[CrossRef][Medline]
Pankov, R., Endo, Y., Even-Ram, S., Araki, M., Clark, K.,
Cukierman, E., Matsumoto, K. and Yamada, K. M. (2005).
A Rac switch regulates random versus directionally persistent cell migration.
J. Cell Biol. 170,793
-802.
Penzo-Mendez, A., Umbhauer, M., Djiane, A., Boucaut, J. C. and
Riou, J. F. (2003). Activation of Gβ
signaling
downstream of Wnt-11/Xfz7 regulates Cdc42 activity during Xenopus
gastrulation. Dev. Biol.
257,302
-314.[CrossRef][Medline]
Pertz, O., Hodgson, L., Klemke, R. L. and Hahn, K. M.
(2006). Spatiotemporal dynamics of RhoA activity in migrating
cells. Nature 440,1069
-1072.[CrossRef][Medline]
Pollard, T. D. and Borisy, G. G. (2003).
Cellular motility driven by assembly and disassembly of actin filaments.
Cell 112,453
-465.[CrossRef][Medline]
Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A.,
Ginsberg, M. H., Borisy, G., Parsons, J. T. and Horwitz, A. R.
(2003). Cell migration: integrating signals from front to back.
Science 302,1704
-1709.
Saoncella, S., Calautti, E., Neveu, W. and Goetinck, P. F.
(2004). Syndecan-4 regulates ATF-2 transcriptional activity in a
Rac1-dependent manner. J. Biol. Chem.
279,47172
-47176.
Sheetz, M. P., Felsenfeld, D., Galbraith, C. G. and Choquet,
D. (1999). Cell migration as a five-step cycle.
Biochem. Soc. Symp. 65,233
-243.[Medline]
Tada, M. and Smith, J. C. (2000). Xwnt11 is a
target of Xenopus Brachyury: regulation of gastrulation movements via
Dishevelled, but not through the canonical Wnt pathway.
Development 127,2227
-2238.[Abstract]
Tahinci, E. and Symes, K. (2003). Distinct
functions of Rho and Rac are required for convergent extension during Xenopus
gastrulation. Dev. Biol.
259,318
-335.[CrossRef][Medline]
Teddy, J. M. and Kulesa, P. M. (2004). In vivo
evidence for short- and long-range cell communication in cranial neural crest
cells. Development 131,6141
-6151.
Uehata, M., Ishizaki, T., Satoh, H., Ono, T., Kawahara, T.,
Morishita, T., Tamakawa, H., Yamagami, K., Inui, J., Maekawa, M. and
Narumiya, S. (1997). Calcium sensitization of smooth muscle
mediated by a Rho-associated protein kinase in hypertension.
Nature 389,990
-994.[CrossRef][Medline]
Wallingford, J. B., Rowning, B. A., Vogeli, K. M., Rothbacher,
U., Fraser, S. E. and Harland, R. M. (2000). Dishevelled
controls cell polarity during Xenopus gastrulation.
Nature 405,81
-85.[CrossRef][Medline]
Welch, H. C., Coadwell, W. J., Stephens, L. R. and Hawkins, P.
T. (2003). Phosphoinositide 3-kinase-dependent activation of
Rac. FEBS Lett. 546,93
-97.[CrossRef][Medline]
Westerfield, M. (2000). The
Zebrafish Book. A guide for the laboratory use of zebrafish
(Danio rerio). 4th edn. Eugene, OR: University of Oregon Press.
White, D. P., Caswell, P. T. and Norman, J. C.
(2007).
vβ3 and
5β1 integrin recycling
pathways dictate downstream Rho kinase signaling to regulate persistent cell
migration. J. Cell Biol.
177,515
-525.
Related articles in Development:
This article has been cited by other articles:
![]() |
M. P. O'Connell, J. L. Fiori, E. K. Kershner, B. P. Frank, F. E. Indig, D. D. Taub, K. S. Hoek, and A. T. Weeraratna Heparan Sulfate Proteoglycan Modulation of Wnt5A Signal Transduction in Metastatic Melanoma Cells J. Biol. Chem., October 16, 2009; 284(42): 28704 - 28712. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Elfenbein, J. M. Rhodes, J. Meller, M. A. Schwartz, M. Matsuda, and M. Simons Suppression of RhoG activity is mediated by a syndecan 4-synectin-RhoGDI1 complex and is reversed by PKC{alpha} in a Rac1 activation pathway J. Cell Biol., July 13, 2009; 186(1): 75 - 83. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Bass, M. R. Morgan, and M. J. Humphries Syndecans Shed Their Reputation as Inert Molecules Sci. Signal., March 31, 2009; 2(64): pe18 - pe18. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Mahoney, M. R. Morgan, A. Harrison, M. J. Humphries, and M. D. Bass Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 J. Biol. Chem., March 27, 2009; 284(13): 8898 - 8909. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kuriyama and R. Mayor A role for Syndecan-4 in neural induction involving ERK- and PKC-dependent pathways Development, February 15, 2009; 136(4): 575 - 584. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schlessinger, A. Hall, and N. Tolwinski Wnt signaling pathways meet Rho GTPases Genes & Dev., February 1, 2009; 23(3): 265 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Whiteford, S. Ko, W. Lee, and J. R. Couchman Structural and Cell Adhesion Properties of Zebrafish Syndecan-4 Are Shared with Higher Vertebrates J. Biol. Chem., October 24, 2008; 283(43): 29322 - 29330. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||