|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
| ||||||||||||||||||||
Files in this Data Supplement:
Fig. S1. Analysis of bpfr1 mutations and antisense MO. (A) Sequencing profiles of brpf1 genomic fragment from wild-type (+/+), heterozygous (+/−) and t20002 mutant (−/−) animals. In the mutant allele, TAC is mutated to a TAA stop codon, as indicated by an asterisk. (B) Sequencing profiles of brpf1 genomic fragment from wild-type (+/+, upper panel) and t25114 mutant animals (−/−, lower panel). The t25114 mutation generates a new splice acceptor site within the intron (AG), which is preferentially used. This leads to a 10 bp insertion (indicated in gray) and a frameshift in the cDNA. (C-E) The t25114 mutant brpf1 transcript and the resulting C-terminally truncated Brpf1 protein are stable. (C) Whole-mount in situ hybridization with brpf1 probe of wild-type (left) and t25114 homozygous embryo at 48 hpf. Embryos were genotyped after photography. (D) Semi-quantitative RT-PCR to amplify brpf1 (upper panels) or, as control, ef1α (lower panels) fragments from cDNA of single (left) or pooled (right) wild-type (WT) or t25114 homozygous larvae (−/−) at 120 hpf, when the phenotype was morphologically visible. Mutant bands were cloned, over 50 clones were sequenced and all found to contain the 10 bp insertion (data not shown). PCR primers used were: brpf1-F, TTCTTCACTGAGCCCGTACC and -R, GGGGACCAGAGACTTTAGGG; ef1α-F, TCACCCTGGGAGTGAAACAGC and −R, ACTTGCAGGCGATGTGAGCAG. (E) Anti-GPF western blot analysis of protein extracts from zebrafish embryos (10 hpf) after injection of plasmid DNA encoding GFP fusion proteins of full-length Brpf1 or C-terminally truncated Brpf1 lacking the PWWP domain (left). Full-length and truncated proteins are present in comparable amounts. (Right panel) Ponceau Red staining of nitrocellulose filter as loading control. (F-I) The three mutant brpf1 alleles display skeletal defects of similar strengths. Panels show Alcian Blue staining of heads at 120 hpf, ventral views. Numbers of pharyngeal arches and basihyal (bh) of second arch are indicated in F. Note that the t25114 allele (H), which only lacks the C-terminal PWWP domain, completely lacks the basihyal and the hypobranchials of arches 3 and 4, similar to the potential null allele t20002 (G; compare with Fig. 1G). (J-L) The brpf1 splice donor MO efficiently blocks splicing of intron 1 in vivo. (J) Diagram demonstrating of the structure of unspliced brpf1 hnRNA and the positions of the MO and the primers used in K. Primer sequences are available upon request. (K) RT-PCR on cDNA from uninjected and brpf1 morphant larvae at 48 hpf, using the primer pairs indicated in J. The wild-type cDNA (first lanes) only gave a band of appropriate size with a primer pair from exons 1 and 2 (panel 1), but no band with a primer pair from exon 1 and intron 1 (panel 2), or with two intron-internal primers (panel 3), whereas the morphant cDNA (second lanes) yielded the opposite pattern, indicating that intron 1 was not spliced out. Lanes 3 contain -RT controls, ruling out contamination with genomic DNA. Row 4 shows ef1α loading controls. (L) Northern blot analysis with brpf1 probe of total RNA from wild-type (lane 1) or morphant (lane 2) embryos. Only the wild-type RNA shows a brpf1 band of the appropriate size (5 kb). No band was detected in the morphant RNA, indicating that most of the unspliced brpf1 transcripts are degraded. (Lower panel) Methylene blue staining of blot showing rRNA as loading control.
Fig. S2. hox expression is initiated normally in brpf1 mutants. (A,B) hoxb1a (lateral views), (C,D) hoxb2a (lateral views) and (E,F) hoxa2b (dorsal views) whole-mount in situ hybridizations of wild-type sibling (A,C,E) and brpf1 mutant (B,D,F) embryos at segmentation stages (15 hpf is equivalent to the 12-somite stage; 18 hpf is equivalent to the 18-somite stage). Anterior Hox genes are initially expressed in hindbrain and cranial neural crest of mutants. Note that hoxa2b transcript levels in neural crest streams are already reduced, whereas in the hindbrain they are still normal (E,F). Rhombomere numbers (r) and cranial neural crest streams (2=hyoid; 3-7=gill arches) are indicated.
Fig. S3. brpf1 displays early ubiquitous and later restricted expression in neuroectodermal, ectodermal and endodermal derivatives. (A) RT-PCR at indicated developmental stages for brpf1 and, as control, ef1α transcripts (for details, see legend to Fig. S1D). brpf1 is expressed at all stages investigated, from the 1-cell stage throughout adulthood (1-cell=0 hpf; 256-cell=early blastula stage=3 hpf; 70% epiboly=mid-gastrula stage=8 hpf; 5-somites=early segmentation stage=12 hpf). Transcripts detected during the first 4 hours of development, before the onset of zygotic transcription (Kane and Kimmel, 1993), are most likely maternally provided. To knockdown both maternal and zygotic brpf1 transcripts, we injected an antisense MO targeting the translational start site (in contrast to the described splice MO, which only targets zygotic transcripts). Preliminary results indicate that defects in segmental identity in such maternal-zygotic morphants are no more severe than in brpf1 mutants, with a regular initiation of anterior Hox gene expression (K.L. and M.H., unpublished; compare with Fig. S2). (B-K) brpf1 whole-mount in situ hybridization at stages indicated in lower right corners (6 hpf=shield stage=early gastrula; 11 hpf=3-somite stage; 17 hpf=16-somite stage). (B-D,G) Lateral views; (E,F) dorsal views; (H-J) longitudinal sections, (H) medial, (I,J) lateral; (K) horizontal section. Numbers of arches in H-J are indicated. ce, cerebellum; gcl, ganglion cell layer (retina); g, gut; l, liver; mye, myencephalon; np, nasal pit; oe, oral ectoderm; opl, outer plexiform layer (retina); pec, pharyngeal ectoderm; p, pancreas; r, posterior retina; tel, telencephalon; zli, zona limitans intrathalamica (Scholpp et al., 2006).
Kane, D. A. and Kimmel, C. B. (1993). The zebrafish midblastula transition. Development 119, 447-456.
Scholpp, S., Wolf, O., Brand, M. and Lumsden, A. (2006). Hedgehog signalling from the zona limitans intrathalamica orchestrates patterning of the zebrafish diencephalon. Development 133, 855-864.
Fig. S4. Loss of Brpf1 function in the hindbrain has a cell-autonomous effect on hoxb1a expression, but no obvious effects on anterior-posterior patterning. (A-D) Hindbrain patterning of brpf1 mutants appears normal. (A,B) egr2b (krox20) (Oxtoby and Jowett, 1993) and pax2a (Krauss et al., 1991) expression at 18 hpf, dorsal view of hindbrain region. In the brpf1 mutant (B; genotyped after photography), the width of rhombomeres r3, r4 and r5 is similar to that in wild-type siblings (A) (n=13/13). There was some variability (see r3), which, however, did not correlate with the brpf1 genotype. This is in contrast to the shifts obtained upon MO-based knockdown of hoxb1 genes, with a broadening of r3, whereas r4 and r5 are narrower than in uninjected siblings (McClintock et al., 2002). (C,D) In situ hybridization for isl1 transcripts (Inoue et al., 1994), 36 hpf, dorsal view of hindbrain region. Branchiomotor neurons of the trigeminal (V), facial (VII), glossopharyngeal (IX) and vagal nerves (X) are indicated. During normal development, cell bodies of the Vth nerve differentiate in r2 (Va) and r3 (Vp), where they remain during further development. Cell bodies of the VIIth nerve differentiate in rhombomers r4 and r5, followed by posterior migration to end up in r6 and r7 at 36 hpf (McClintock et al., 2002). brpf1 mutant (D; genotyped after photography) (n=21/12) and wild-type sibling show no significant difference in the patterning of isl1-positive branchiomotor cell bodies. The same results were obtained for mutants at 24 hpf, 28 hpf, 32 hpf and 40 hpf. This is in contrast to the phenotype observed in hoxb1 morphants, in which cell bodies of the Vth nerve remain in lateral positions of r4/5 (McClintock et al., 2002). Also in moz mutants, no defects during early rhomobomere patterning could be detected, while branchiomotor defects were much weaker and less penetrant than in hoxb1 morphants (Miller et al., 2004). Consistently, we found that Hox gene expression in the hindbrain of brpf1 mutants was much less affected than in the cranial neural crest (CNC) (see Fig. 2E-H and Fig. S2E,F). Together, this suggests that in the hindbrain, Brpf1/Moz activity and/or maintenance of anterior Hox gene expression is less critical for segmental identity determination than in the CNC. (E-H) Brpf1 promotes hoxb1a expression in hindbrain r4 cells in a cell-autonomous fashion. Fluorescein-dextran (Molecular Probes) was injected into wild-type donor embryos at the 1- to 4-cell stage. For hindbrain transplants, labeled cells were taken from the respective region (Kimmel et al., 1990) of shield stage (6 hpf) donor embryos and homotopically transferred into unlabeled shield stage brpf1 morphant hosts. Chimeric embryos were fixed at 35 hpf and in situ hybridized for hoxb1a, using Fast Red (Roche) as substrate. Subsequently, transplanted cells were stained by anti-fluorescein immunostaining. Chimeric embryos were analyzed by confocal laser-scanning microscopy (Zeiss LSM510 META). Lateral views of heads of wild-type (E) or brpf1 morphant embryos with transplanted wild-type cells (green; F-H). (H) A higher magnification of G. hoxb1a expression (in red) in ventral medial nucleus, which serves as internal control, is indicated by red asterisks. Chimeric embryos with wild-type cells anterior and posterior to r4 lacked hoxb1a expression (F; n=12/12), whereas wild-type cells within r4 were strongly hoxb1a-positive (H; yellow arrows; n=4/4). Note that hoxb1a expression remains absent in brpf1 morphant cells adjacent to hoxb1a-positive wild-type cells, ruling out the possibility that Brpf1 acts via a Hox expression-activating extracellular signal such as retinoic acid, which has a posteriorizing effect on Hox gene expression and segmental identity (Glover et al., 2006).
Glover, J. C., Renaud, J. S. and Rijli, F. M. (2006). Retinoic acid and hindbrain patterning. J. Neurobiol. 66, 705-725.
Inoue, A., Takahashi, M., Hatta, K., Hotta, Y. and Okamoto, H. (1994). Developmental regulation of islet-1 mRNA expression during neuronal differentiation in embryonic zebrafish. Dev. Dyn. 199, 1-11.
Kimmel, C. B., Warga, R. M. and Schilling, T. F. (1990). Origin and organization of the zebrafish fate map. Development 108, 581-594.
Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression of the zebrafish paired box gene paxzf-b during early neurogenesis. Development 113, 1193-1206.
McClintock, J. M., Kheirbek, M. A. and Prince, V. E. (2002). Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention. Development 129, 2339-2354.
Oxtoby, E. and Jowett, T. (1993). Cloning of the zebrafish Krox-20 (Krx-20) and its expression during hindbrain development. Nucleic Acids Res. 21, 1087-1095.
Fig. S5. Brpf1 in pharyngeal endoderm is neither necessary nor sufficient for segmental identities of skeletal elements of pharyngeal arches. Donor embryos were injected with Fluorescein-dextran (FD; Molecular Probes) and taramA* mRNA, encoding a constitutively active Nodal type I receptor that drives cells into an endodermal fate (David and Rosa, 2001). Upon transplantation into animal regions of host embryos, these cells directly ingress and form pharyngeal endoderm (David and Rosa, 2001), largely replacing endogenous anterior endodermal cells. (A,B) Fluorescent in situ hybridization for bapx1 transcripts (Fast Red), staining joint cells of arch 1 character, and anti-fluorescein immunostaining to visualize transplanted cells in the pharyngeal endoderm (green); 52 hpf; lateral views, confocal sections (Zeiss LSM510 META). brpf1 mutants with wild-type pharyngeal endoderm at the level of arch 2 display ectopic bapx1 expression like non-chimeric mutants (compare A with Fig. 1N; n=3/3), whereas wild-type embryos with brpf1 morphant pharyngeal endoderm lack bapx1 expression in arch 2, like non-chimeric wild-type animals (n=7/7; compare B with Fig. 1M). (C-F) Alcian Blue staining of head skeleton at 120 hpf. (C,D) Ventral views; (E,F) lateral views. Animals had been selected at 26 hpf, based on the abundance of fluorescein-positive cells in the pharyngeal endodermal cells (>50% of cells positive; not shown). Chimeric brpf1 mutants with wild-type pharyngeal endoderm show skeletal defects like non-chimeric mutants (n=4/4), including absence of basihyal (bh) (arrowhead in C; compare with Fig. 1D) and fusion of Meckel’s cartilage (m) and ceratohyal (ch) (arrowhead in E; compare with Fig. 1L). Conversely, chimeric wild types with brpf1 morphant pharyngeal endoderm are indistinguishable from non-chimeric wild-type animals (compare D with Fig. S1F, and F with Fig. 1J; n=12/12). hs, hyosymplectic; pq, palatoquadrate.
David, N. B. and Rosa, F. M. (2001). Cell autonomous commitment to an endodermal fate and behaviour by activation of Nodal signalling. Development 128, 3937-3947.
Fig. S6. Brpf1 genetically interacts with Moz and brpf1 mutant defects are alleviated by HDAC inactivation with TSA. (A-D) hoxb2a in situ hybridizations at 35 hpf, lateral views. Arrows point to hoxb2a expression in cranial neural crest of wild-type embryo (A) and embryos injected with low amounts of brpf1 MO (B) or moz MO (C); asterisk indicates absent hoxb2a expression in embryo co-injected with the same low amounts of both MOs (D). (E-J) Alcian Blue staining of head skeletons at 120 hpf, ventral view. Arrows point to basihyal in wild-type (E), and larvae injected with low amounts of brpf1 MO (F) or moz MO (G). Asterisks indicate absent basihyal in larva co-injected with low amounts of brpf1 and moz MO (H), in strong moz morphant (I) and in brpf1 mutant injected with high amounts of moz MO (J). Co-injection of low doses of brpf1 MO and moz MO, which in single injections did not cause any phenotypes (compare F and G with E), caused defects as severe as in strongest brpf1 or moz morphants (compare H with I; n=11/13). By contrast, brpf1 mutants injected with highest amounts moz MOs showed a phenotype no more severe than that of moz single morphants (compare J with I; n=20/20). (K-N) TSA treatment enhances hoxb1a expression in r4 of both wild-type and brpf1 mutant embryos. hoxb1a in situ hybridizations at 33 hpf, lateral view of head region. TSA-treated wild-type embryo (L) displays slightly stronger hoxb1a expression than DMSO-treated sibling (K; n=27/35). TSA-treated brpf1 mutant displays recovered hoxb1a expression in r4 (N; embryo genotyped after photography; n=11/11), whereas expression remains absent in control mutant treated with DMSO (M). (O-R) TSA treatment from 20-33 hpf significantly ameliorates the later cartilage defects of brpf1 mutants. Alcian Blue staining of head skeletons at 120 hpf, ventral views. In O, basihyal of arch 2 (bh) and hypobranchials (hb) of arch 3 are indicated. The head skeleton of the TSA-treated wild-type larva (P) looks similar to that of the DMSO-treated control sibling (O). The TSA-treated brpf1 mutant (R) displays a significant amelioration of skeletal defects, including formation of hypobranchials and a normally sized basihyal (red arrows; animal genotyped after photography; n=26/33). By contrast, both elements remain absent or strongly reduced in control mutant treated with DMSO (Q; red asterisks; n=9/9). Stronger or longer TSA treatments interfered with additional developmental processes requiring HDAC activity and caused defects comparable to those of zebrafish hdac1 mutants (Pillai et al., 2004), including more severe craniofacial abnormalities, which masked the brpf1-specific traits.
Pillai, R., Coverdale, L. E., Dubey, G. and Martin, C. C. (2004). Histone deacetylase 1 (HDAC-1) required for the normal formation of craniofacial cartilage and pectoral fins of the zebrafish. Dev. Dyn. 231, 647-654.
Fig. S7. Brpf1-GFP displays PWWP domain-dependent chromatin association in zebrafish embryos. Zebrafish embryos were injected at the 1-cell stage with mouse full-length GFP-Brpf1 or GFP-Brpf1ΔPWWP plasmids, as also used for Fig. S1E, Figs 5 and 6, and fixed at mid-gastrula stages (7-9 hpf). GFP was visualized by immunofluorescence, as described for transfected HEK 293 cells (Figs 5 and 6), DNA was counterstained with DAPI, and embryos were analyzed by confocal microscopy (Zeiss LSM510 META). (A-C) Full-length Brpf1; (D) Brpf1ΔPWWP. (A) Interphase, (B) early mitosis, (C,D) late mitosis, with the two sets of sister chromosomes clearly separated. Full-length Brpf1 is localized at discrete sites of the chromatin of zebrafish cells both in interphase (A) and mitosis (B,C); compare with Fig. 5A and Fig. 6B for HEK 293 cells. (C,D) In contrast to full-length Brpf1 (C), Brpf1ΔPWWP lacking the PWWP domain is largely excluded from the chromatin (D); compare with Fig. 6D.
| ||||||||||||||||||||
