|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 April 2008
doi: 10.1242/dev.021444
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 mRNA Regulation and Development, Institut de Génétique Humaine,
CNRS UPR 1142, 141 rue de la Cardonille, 34396 Montpellier Cedex 5,
France.
2 Department of Biochemistry, 433 Babcock Drive, University of Wisconsin,
Madison, WI 53706 1544, USA.
* Author for correspondence (e-mail: Martine.Simonelig{at}igh.cnrs.fr)
Accepted 8 April 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Cytoplasmic polyadenylation, Drosophila, GLD-2, Meiosis, Metaphase I, Translational control
| INTRODUCTION |
|---|
|
|
|---|
The molecular mechanisms of cytoplasmic polyadenylation have been
investigated in Xenopus oocytes. The specific RNA-binding protein in
the reaction is CPEB (Cytoplasmic polyadenylation element binding protein),
which binds the CPE in the 3'-UTR of regulated mRNAs. Two other factors,
CPSF (Cleavage and polyadenylation specificity factor) and Symplekin, are
required in addition to a poly(A) polymerase
(Barnard et al., 2004
;
Richter, 2007
). Before meiotic
maturation, the polyadenylation complex also contains PARN, a deadenylase
whose activity counteracts poly(A) tail elongation
(Kim and Richter, 2006
). At
meiotic maturation, CPEB phosphorylation results in the release of PARN from
the complex, thus leading to polyadenylation and translational activation.
CPSF and Symplekin are also required for nuclear polyadenylation, a
cotranscriptional reaction that leads to the synthesis of a poly(A) tail at
the 3' end of all mRNAs (Edmonds,
2002
). A canonical poly(A) polymerase (PAP) is responsible for
poly(A) tail synthesis during nuclear polyadenylation. Particular isoforms of
PAP were first thought to be required for cytoplasmic polyadenylation
(Ballantyne et al., 1995
).
Moreover, TPAP (Papolb - Mouse Genome Informatics), a testis-specific PAP in
mouse, is cytoplasmic in spermatogenic cells and has been shown, using a
Tpap knockout, to be required for cytoplasmic polyadenylation of
specific mRNAs and for spermiogenesis
(Kashiwabara et al., 2002
;
Zhuang et al., 2004
). More
recently, a new family of atypical poly(A) polymerases, the GLD-2 family, has
been characterized, with a first member identified in C. elegans
(Wang et al., 2002
).
GLD-2-type proteins exist in all eukaryotes, where they have different
functions (Buhler et al., 2007
;
Kwak and Wickens, 2007
;
Rissland et al., 2007
).
In C. elegans, GLD-2 is required for entry into meiosis from the
mitotic cycle in the gonad, and for meiosis I progression
(Kadyk and Kimble, 1998
).
C. elegans GLD-2 has a poly(A) polymerase activity in vitro
(Wang et al., 2002
) and in
vivo (Suh et al., 2006
). In
Xenopus oocytes, GLD-2 is found in the cytoplasmic polyadenylation
complex, within which it directly interacts with CPEB and CPSF, and it has a
poly(A) polymerase activity in vitro in the presence of the other factors of
the complex (Barnard et al.,
2004
). GLD-2 is in complexes with mRNAs, such as cycB1
and mos, that are regulated by cytoplasmic polyadenylation
(Rouhana et al., 2005
). It is
thus very likely that GLD-2 plays a role in cytoplasmic polyadenylation during
Xenopus meiotic maturation. However, although cytoplasmic
polyadenylation of mos and cycB1 mRNAs is required for
meiotic maturation (Sheets et al.,
1995
; Stebbins-Boaz et al.,
1996
), the functional role of Xenopus GLD-2 in meiotic
maturation has not been addressed. Unexpectedly, although mouse GLD-2 (Papd4 -
Mouse Genome Informatics) is found in oocytes at metaphases I and II, a recent
study shows that oocyte maturation in GLD-2 knockout mice is not altered,
demonstrating that if mouse GLD-2 acts as a poly(A) polymerase at this stage,
another protein acts redundantly
(Nakanishi et al., 2006
;
Nakanishi et al., 2007
).
In Drosophila, poly(A) tail regulation by deadenylation and
cytoplasmic polyadenylation is essential for controlling mRNAs involved in
axis patterning and other aspects in early development
(Benoit et al., 2005
;
Castagnetti and Ephrussi,
2003
; Kadyrova et al.,
2007
; Morris et al.,
2005
; Semotok et al.,
2005
; Vardy and Orr-Weaver,
2007
; Zaessinger et al.,
2006
). In ovaries, cytoplasmic polyadenylation regulates the
translation of oskar (osk), the posterior determinant, and
of CycB mRNAs, and this polyadenylation depends on Orb, the
Drosophila homolog of CPEB (Benoit
et al., 2005
; Castagnetti and
Ephrussi, 2003
; Chang et al.,
1999
; Juge et al.,
2002
). Orb is required at the earliest steps of oogenesis for the
regulation of the synchronous divisions of a cystoblast that lead to the
production of sixteen germ cells per cyst, and for the restriction of meiosis
to one oocyte (Huynh and St Johnston,
2000
). A single gene, hiiragi (hrg), which
encodes one isoform of canonical PAP, exists in the Drosophila genome
(Juge et al., 2002
;
Murata et al., 2001
). Genetic
interactions have implicated orb and hrg in the cytoplasmic
polyadenylation of osk mRNA and accumulation of Osk protein at the
posterior pole of the oocyte during mid-oogenesis. This led to the conclusion
that canonical PAP has a role in cytoplasmic polyadenylation at this stage
(Juge et al., 2002
).
Cytoplasmic poly(A) tail elongation is also crucial in early embryos to
activate the translation of mRNAs, including that of bicoid
(bcd), which encodes the anterior morphogen
(Salles et al., 1994
).
Polyadenylation and translation occur upon egg activation, a process that also
induces the resumption of meiosis from the metaphase I arrest in mature
oocytes, and which is triggered by egg laying, the passage of the egg through
the oviduct (Heifetz et al.,
2001
). A link has been established between cytoplasmic
polyadenylation and meiotic progression at egg activation because mutants
defective for meiotic progression are also defective for poly(A) tail
elongation (Horner et al.,
2006
; Lieberfarb et al.,
1996
; Page and Orr-Weaver,
1996
).
Here, we analyze the function of Drosophila GLD-2 in the female
germline. We show that this protein is encoded by wispy
(wisp), a gene previously identified genetically
(Brent et al., 2000
), and we
therefore refer to this protein as Wisp. We find that Wisp has a poly(A)
polymerase activity in vitro and in vivo, and that it is required for poly(A)
tail elongation of maternal mRNAs during late oogenesis and early
embryogenesis. Wisp is required for meiotic progression in mature oocytes. A
key target of Wisp during this process is cortex (cort)
mRNA, which encodes a meiosis-specific activator of the anaphase-promoting
complex (APC). This demonstrates the role of polyadenylation and translational
activation in meiotic progression. In addition, we investigate the respective
roles of conventional PAP and of Wisp in oogenesis and show that PAP and Orb
are involved earlier than Wisp and Orb. Our results establish the requirement
of two poly(A) polymerases for cytoplasmic polyadenylation at different steps
of oogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Analysis of RNA
Analysis of poly(A) tail length by PCR (the PAT assay) and RT-PCRs were
performed as reported previously (Benoit et
al., 2005
; Zaessinger et al.,
2006
). RNA preparations were from 20 embryos, 10 ovaries, and from
dissected germarium-to-stage 8, stage 9-10, and stage 14 egg chambers from 10
ovaries. RT-PCRs were performed on the same RNA preparations used for the PAT
assays, using serial dilutions of the cDNAs. Dilutions 1:10 are shown. Oligos
for PAT assays were (5' to 3'): osk,
AAGCGCTTGTTTGTAGCACA; CycB, GCTGGCCGAACACATCGGCG; nos,
TTTTGTTTACCATTGATCAATTTTTC; bcd, CATTTGCGCATTCTTTGACC; cort,
GGCCAAGGACAAGTGCAGCTC; and sop, GGATTGCTACACCTCGGCCCGT. Oligos for
RT-PCR were (5' to 3'): osk, GCCATATTGCTGAGCCACGCCC and
CCAGTAGCGTGGAGGTGCTCG; nos, CGATCCTTGAAAATCTTTGCGCAGGT and
TCGTTGTTATTCTCACAAAAGACGCA; bcd, CTGGGTCGACCAATGTCAAT GGCG and
GCTCTTGTCCAGACCCTTCAAAGG; and sop, CACCCCAATAAAGTTGATAGACCT and
ATCTCGAACTCTTTGATGGGAAGC. Whole-mount RNA in situ hybridizations were
performed by standard methods. The RNA antisense probes were made from
pKSbcdwt (bcd), pN5 (nos) and osk cDNA clones.
Poly(A) polymerase assays in Xenopus oocytes
To express MS2 fusion proteins in Xenopus oocytes, the C-terminal
half of Wisp (residues 702-1373) and full-length Homo sapiens GLD-2
(HsGLD-2) were cloned into the pCSMS2 vector using NheI and
XhoI (Rouhana et al.,
2005
). Wisp D1031A and HsGLD-2 D215A mutations were
created by site-directed mutagenesis. For in vitro transcription, Wisp and
HsGLD-2 clones were linearized with XbaI and NotI,
respectively, and transcribed using the SP6 Megascript Kit (Ambion).
Xenopus oocyte manipulation, injection, luciferase assays and labeled
RNA analysis were performed as described
(Dickson et al., 1999
;
Kwak et al., 2004
). To test
MS2 fusion protein expression, oocytes were harvested 6 hours after mRNA
injection and analyzed by western blotting using
-HA11
antibody (1:2000; Covance). Two oocytes were loaded per lane.
GST pull-down assays
GST recombinant proteins were produced by cloning the C-terminal half of
Wisp (residues 702-1373) into the pBAH vector using EcoRI and
XhoI, and the N-terminal region of Wisp (residues 11-547) digested
with BglII into pGEX-5X-2 digested with BamHI. In vitro
interactions were performed as described
(Benoit et al., 2002
), in the
presence of 0.2 µg/µl RNase A. Orb was in vitro translated from the
orb D5 cDNA cloned into pBluescript using EcoRI and
HindIII.
Antibodies, western blots and immunostaining
Antibodies against Wisp were obtained by cloning a portion of wisp
cDNA LD18468 encoding residues 702 to 1373 into the pMAL vector. The Wisp-MBP
fusion protein was expressed in Escherichia coli and purified using
amylose beads (NEB). The purified fusion protein was injected into guinea
pigs. Western blots and immunostaining were performed as described
(Benoit et al., 2005
;
Benoit et al., 1999
). Antibody
dilutions for western blots were: anti-Wisp 1:3000, rabbit anti-BicC
(Saffman et al., 1998
) 1:1000,
rat anti-PAP (Juge et al.,
2002
) 1:500, anti-Orb 6H4 (Developmental Studies Hybridoma Bank)
1:20, rabbit anti-Cyclin A (Whitfield et
al., 1990
) 1:10,000, anti-Cort
(Pesin and Orr-Weaver, 2007
)
1:2000, anti-
-tubulin (Sigma T5168) 1:10,000. Dilutions for
immunostaining were: anti-Wisp 1:2000, anti-Osk
(Kim-Ha et al., 1995
) 1:500,
anti-Nos (gift from A. Nakamura, RIKEN Center for Developmental Biology, Kobe,
Japan) 1:1000, anti-Bcd (Kosman et al.,
1998
) 1:200, mouse anti-C(3)G
(Anderson et al., 2005
) 1:500.
To visualize meiotic or mitotic spindles in embryos, methanol fixation was
performed as described (Brent et al.,
2000
) and dilution of anti-
-tubulin (Sigma T9026) was
1:200. Meiotic spindles in stage 14 oocytes were visualized as described
(Endow and Komma, 1997
) using
FITC-conjugated anti-
-tubulin (Sigma F2168).
|
| RESULTS |
|---|
|
|
|---|
An antibody against the C-terminal half of the protein (residues 702-1373) was developed. In western blots, this antibody revealed a band of 180 kDa that was present in adult females and ovaries and absent from adult males (Fig. 1C). This band corresponds to the protein encoded by CG15737 as it was absent when the gene was mutated (see below). In embryos, expression of the protein peaked at 0-2 hours of development, decreased at 2-4 hours and was undetectable in later stages, consistent with a maternal expression. Immunostaining of ovaries showed that the protein is expressed throughout oogenesis (Fig. 1D). It was cytoplasmic, present both in nurse cells and the oocyte and accumulated in the oocyte from stage 5 onwards. In stages 9 and 10, protein accumulation was visible at the posterior pole of the oocyte. Staining of ovaries mutant for CG15737 was reduced to background levels, indicating that the antibody specifically recognized the protein encoded by this gene.
|
These phenotypes were similar to those of wisp mutants, a gene
previously identified genetically and which is located in the same chromosome
region as CG15737 (Brent et al.,
2000
; Mohler,
1977
). Complementation tests between
CG15737KG5287 and wisp12-3147 showed
that CG15737 is wisp. Sequencing of the conserved domains in
wisp12-3147 identified a point mutation, T1151I, in the
central domain of the protein, changing a residue that is conserved in the
other species (Fig. 1A). This
mutation did not prevent the production of Wisp in ovaries
(Fig. 1C).
Staining of embryos from wispKG5287 or
wispKG5287/Df(1)RA47 females (thereafter called
wisp embryos) with anti-
-tubulin and DAPI to visualize meiotic
figures showed that these embryos did not complete meiosis
(Fig. 2A-E). In most embryos
(74%), a single meiotic spindle was visible, which could be thin or distorted
and on which the chromosomes were scattered or separated in asymmetric pools
(Fig. 2C,D). A second small
spindle was sometimes present, which was nucleated by one or several lost
chromosomes (8% of embryos). These figures (81%,
Fig. 2E) correspond to a block
in meiosis I. Among the remaining embryos, 15% were identified as blocked in
meiosis II by visualization of two meiotic spindles, which in most cases were
abnormally arranged. This phenotype is stronger than that of
wisp12-3147/Df(1)RA47 embryos, most of which were arrested
at or after metaphase II (Brent et al.,
2000
). Meiotic figures in wisp mutant embryos correspond
to either abnormal metaphase I or anaphase I. In the wild type, a meiotic
arrest occurs at metaphase I in mature oocytes
(Fig. 2F,G). Meiosis I resumes
at egg activation, driven by egg laying, and meiosis II is rapidly completed
without further arrest.
Meiotic figures were analyzed in wispKG5287/Df(1)RA47
mature (stage 14) oocytes and we found that in most oocytes (79%), metaphase I
arrest was not maintained properly (Fig.
2H-J). The chromosomes separated along the spindle and did so
asymmetrically, the fourth chromosomes often migrating out of the spindle. The
spindle appeared thin or irregular (Fig.
2H,I). Therefore, wisp mutants showed a defect in
metaphase I arrest, and meiosis is then blocked at this stage as abnormal
meiotic figures are similar before and after egg activation in wisp
mutant embryos. Because a defect in metaphase I arrest could result from a
defect earlier in meiosis, we analyzed earlier aspects of meiosis. We found
that the karyosome in wispKG5287/Df(1)RA47 stage 8 oocytes
appeared as in the wild type (Fig.
2K,L). Entry into meiosis, as well as meiosis restriction to one
oocyte in the germarium, as visualized by the formation of the synaptonemal
complex using anti-C(3)G antibody (Anderson
et al., 2005
), were also as in the wild type (data not shown).
We conclude that the GLD-2-type poly(A) polymerase in the Drosophila female germline is encoded by wisp and is required for metaphase I arrest and for progression of meiosis after this stage.
Wisp is a poly(A) polymerase and is involved in poly(A) tail elongation during late oogenesis
A tethering assay was previously developed in Xenopus oocytes to
analyze the poly(A) polymerase activity of candidate proteins
(Kwak et al., 2004
). The
tested protein is tethered to mRNAs through MS2, an exogenous RNA-binding
protein, and poly(A) addition as well as translational activation of the
targeted mRNA are assayed. A chimeric mRNA encoding an MS2-Wisp fusion protein
was injected into Xenopus oocytes. Two reporter mRNAs, luciferase
with MS2 binding sites and β-galactosidase lacking MS2 binding sites,
were then co-injected. Translational activation was calculated by comparing
luciferase activity to β-galactosidase activity
(Fig. 3A). HsGLD-2 was
used as a positive control and induced translational activation that was
abolished when the catalytic site was destroyed by mutation of an essential
aspartic acid residue (HsGLD-2 DA). Wisp protein strongly stimulated
translation of the reporter RNA and the stimulatory effect was abolished by a
point mutation in the catalytic domain (Wisp DA)
(Fig. 1A). Poly(A) tail
addition to a short RNA containing MS2 binding sites was measured and a robust
polyadenylation, which depended on the catalytic domain integrity, was
observed in the presence of either MS2-HsGLD-2 or MS2-Wisp
(Fig. 3B). These results
demonstrate that Wisp is a poly(A) polymerase.
We confirmed the role of Wisp in poly(A) tail elongation in vivo using PAT
assays, an RT-PCR-based technique that allows measurements of poly(A) tail
length. Cytoplasmic polyadenylation of osk and CycB mRNAs
during oogenesis has been reported and this depends on Orb
(Benoit et al., 2005
;
Castagnetti and Ephrussi,
2003
). We determined whether it also depended on the Wisp poly(A)
polymerase. Cytoplasmic polyadenylation of nanos (nos) and
bcd mRNAs was also analyzed. Egg chambers of progressive stages were
dissected and poly(A) tails were measured
(Fig. 3C). For all tested
mRNAs, poly(A) tails lengthened during oogenesis in the wild type, with a
moderate lengthening between early stages (germarium to stage 8) and stages
9-10, and a pronounced elongation between stages 9-10 and stage 14. For
bcd mRNA, this lengthening is not sufficient for translational
activation, which occurs after egg activation
(Salles et al., 1994
). In
wispKG5287 egg chambers, the lengthening at stage 9-10 was
slightly affected and the strong elongation at stage 14 was completely
abolished.
To determine whether Wisp has a general role in regulating mRNAs, we analyzed the poly(A) status of 30 mRNAs that we have identified to be regulated by cytoplasmic polyadenylation and the poly(A) tails of which undergo a robust lengthening in mature oocytes (I. Busseau and M.S., unpublished). For all tested mRNAs, the poly(A) tail lengthening in wispKG5287 mature oocytes was impaired (see Fig. S1 in the supplementary material).
Together, these data show that Wisp is the poly(A) polymerase responsible for cytoplasmic polyadenylation of mRNA targets during late oogenesis.
cort mRNA is a meiotic target of Wisp
To determine whether the meiotic defect observed in wisp mutants
resulted from defects in mRNA polyadenylation and translational activation, we
identified a Wisp target required for meiotic progression. cort
encodes a female meiosis-specific activator of the APC that is necessary for
female meiosis (Chu et al.,
2001
). Eggs from cort mutant females show aberrant
chromosome segregation in meiosis I and eventually arrest in metaphase II
(Lieberfarb et al., 1996
;
Page and Orr-Weaver, 1996
).
Cort is required for sequential degradation of CycA, B and B3 during meiosis,
with CycA being degraded earlier, prior to metaphase I arrest
(Pesin and Orr-Weaver, 2007
;
Swan and Schupbach, 2007
).
Cort protein expression peaks during oocyte maturation (stages 13 and 14) and
correlates with cort mRNA poly(A) tail lengthening
(Pesin and Orr-Weaver, 2007
).
We found that cort poly(A) tail elongation was abolished in
wispKG5287 stage 14 oocytes
(Fig. 4A). This led to a defect
in Cort protein accumulation at this stage
(Fig. 4B). The earliest target
of Cort is CycA, the degradation of which fails in cort mutants by
metaphase I arrest (Pesin and Orr-Weaver,
2007
). We verified that the lack of Cort accumulation in
wispKG5287 mature oocytes resulted in a defect of CycA
destruction: CycA levels were elevated in wispKG5287
mature oocytes, consistent with impaired destruction
(Fig. 4C).
These results identify cort, an mRNA required for meiotic progression, as a Wisp target, the poly(A) tail elongation and translation of cort being dependent on Wisp. They strongly suggest that the poly(A) polymerase function of Wisp is required during the progression of meiosis.
Wisp and PAP poly(A) polymerases are both in a cytoplasmic polyadenylation complex with Orb
Cytoplasmic polyadenylation of osk and CycB mRNAs during
oogenesis is Orb-dependent, and GLD-2 is in a complex with CPEB in
Xenopus oocytes (Barnard et al.,
2004
; Rouhana et al.,
2005
). We therefore analyzed whether Wisp and Orb were present in
a complex, by co-immunoprecipitations in ovary extracts. Orb was able to
co-precipitate with Wisp and this interaction was RNA-independent
(Fig. 5A). Conversely, Wisp
co-precipitated with Orb, and the interaction again was RNA-independent
(Fig. 5B). A direct interaction
between Wisp and Orb was confirmed by in vitro binding assays, in which in
vitro translated Orb bound to recombinant GST-Wisp(702-1373), but not to
GST-Wisp(11-547) or to GST alone (Fig.
5E).
|
We reported previously that poly(A) tail elongation of osk mRNA in
ovaries, and Osk protein accumulation at the posterior pole of oocytes, depend
on Orb and the canonical PAP (Juge et al.,
2002
). We now find that cytoplasmic polyadenylation of
osk mRNA requires Wisp, another poly(A) polymerase. To understand the
role of two different poly(A) polymerases in poly(A) tail lengthening of the
same targets, we investigated the presence of PAP in the cytoplasmic
polyadenylation complex. PAP co-precipitated with Orb in ovary extracts,
independently of the presence of RNA (Fig.
5B). More strikingly, Wisp co-precipitated with PAP and the
interaction was maintained in the absence of RNA
(Fig. 5D).
These data show that Wisp is recruited to mRNAs through a direct interaction with Orb, and are consistent with the role of both PAP and Wisp in cytoplasmic polyadenylation with Orb.
Functions of PAP and Wisp during oogenesis
To investigate the respective roles of PAP and Wisp in oogenesis, we
analyzed genetic interactions between orb and wisp and
between orb and the PAP-encoding gene hrg. Strong
hrg mutants are lethal and do not produce late egg chambers in
germline clones (Juge et al.,
2002
). Therefore, the role of PAP and Orb in cytoplasmic
polyadenylation had been inferred from strong genetic interactions between
heterozygous hrg alleles and the homozygous weak orb allele,
orbmel. The combination of both mutants strongly reduces
female fertility and oogenesis stops around stage 8 in a number of ovarioles
(Juge et al., 2002
).
|
|
We then compared the phenotypes of genetic interactions between orb and hrg and between orb and wisp during oogenesis. Oogenesis stopped at stage 8 in a number of ovarioles from hrgPAP21/+; orbmel females (34%) (Fig. 6B). Staining with anti-C(3)G to visualize the oocyte was impaired in arrested hrgPAP21/+; orbmel egg chambers, indicating either degeneration or the lack of oocyte determination (Fig. 6C). Lack of oocyte determination was confirmed by the presence of sixteen nurse cells (10% of ovarioles). Consistent with the possible function of PAP with Orb during early oogenesis, PAP and Orb expression overlapped at these stages (see Fig. S2 in the supplementary material). Note that these data do not preclude a role for PAP later in oogenesis.
|
We conclude that PAP is required with Orb during early oogenesis, whereas Wisp has an essential function with Orb after stage 10 of oogenesis.
Wisp is required for cytoplasmic polyadenylation in early embryos
Upon egg activation, cytoplasmic polyadenylation leads to a robust poly(A)
tail elongation and translation of a number of maternal mRNAs, including
bcd. In wisp mutant embryos, poly(A) tail elongation of
bcd mRNA was abolished (Fig.
7A). This short poly(A) tail was stable during the first 3 hours
of embryogenesis and, consistently, bcd mRNA was not completely
destabilized. bcd mRNA was also detected in embryos by in situ
hybridization; however, the transcript was delocalized in the anterior region
and to a lesser extent in the rest of the embryo
(Fig. 7B). Maternal mRNA
delocalization in wisp mutant embryos has been reported previously,
but was weaker, probably owing to the utilization of weaker alleles
(Brent et al., 2000
).
Consistent with previous data establishing that poly(A) tail elongation of
bcd mRNA is necessary and sufficient for its translation in embryos
(Salles et al., 1994
), the
lack of poly(A) lengthening in wisp mutant embryos prevented Bcd
protein accumulation (Fig. 7C,
see Fig. S3 in the supplementary material).
We measured poly(A) tail lengths of osk and nos mRNAs in
embryos. In wild-type embryos, pools of osk and nos mRNAs
are localized at the posterior pole, but another fraction of these mRNAs is
widespread in the bulk cytoplasm (Bergsten
and Gavis, 1999
) and then degraded. In agreement with this, both
osk and nos mRNAs analyzed by PAT assays and RT-PCR were
deadenylated and destabilized during the first 3 hours in wild-type embryos
(Fig. 7A). We have shown
previously that nos mRNA destabilization in the bulk cytoplasm of the
embryo depends on deadenylation by CCR4 (twin - FlyBase)
(Zaessinger et al., 2006
). In
wisp mutant embryos, osk and nos mRNAs were
destabilized prematurely in the first hour of embryogenesis and pools of these
mRNAs were not stabilized at the posterior pole
(Fig. 7A,B, see Fig. S3B,C in
the supplementary material). Accordingly, Osk and Nos proteins were completely
lacking in wisp mutant embryos
(Fig. 7C). We propose that
premature destabilization of osk and nos mRNAs in
wisp mutant embryos results from increased shortening of poly(A)
tails in the absence of poly(A) tail elongation by Wisp. As Smaug protein is
required for nos mRNA destabilization, through the recruitment of the
deadenylation complex (Zaessinger et al.,
2006
), we verified that Smaug levels were unaffected in
wisp mutant embryos (data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
In addition to its function in oogenesis, Wisp-dependent cytoplasmic
polyadenylation is required for the translation of essential determinants of
the anteroposterior patterning of the embryo. bcd mRNA poly(A) tail
elongation was known to be required for the deployment of the Bcd gradient
from the anterior pole of the embryo
(Salles et al., 1994
). We now
show that Osk and Nos accumulation at the posterior pole also depends on Wisp.
This highlights the general role of poly(A) tail length regulation in
Drosophila early development.
Meiotic progression and translational control
In Drosophila, meiosis starts in the germarium, where several
cells per germline cyst enter meiotic prophase. Meiosis is then restricted to
a single oocyte that remains in prophase I during most of oogenesis.
Progression to metaphase I (oocyte maturation) occurs in stage 13, with
maintenance of metaphase I arrest in mature stage 14 oocytes
(King, 1970
). Arrested oocytes
are then activated by egg laying, which induces the resumption of meiosis
(Heifetz et al., 2001
).
The earliest phenotypes in wisp-null mutant are defects in
metaphase I arrest and in the progression beyond this stage. This suggests
that Wisp-dependent cytoplasmic polyadenylation and translational activation
are essential for meiosis during and after metaphase I (but not for oocyte
maturation). Consistent with this, massive translation appears to be
dispensable for the completion of meiosis
(Page and Orr-Weaver, 1997
),
but translational activation of specific mRNAs, at least of cort, is
required (Pesin and Orr-Weaver,
2007
). We identify cort as a Wisp target: cort
poly(A) tail elongation and Cort accumulation in mature oocytes require Wisp.
Moreover, defects in Cort accumulation in wisp mutant oocytes result
in impaired CycA destruction, an event thought to be critical for meiotic
progression (Pesin and Orr-Weaver,
2007
; Swan and Schupbach,
2007
). We find that Wisp regulates many mRNAs at oocyte
maturation, several of which might be involved at various steps of meiosis.
Identification of these specific targets will be necessary to fully unravel
the role of Wisp during meiosis.
Cytoplasmic polyadenylation has been linked to meiotic progression at egg
activation given that some maternal mRNAs undergo poly(A) tail elongation at
egg activation (Benoit et al.,
2005
; Salles et al.,
1994
; Vardy and Orr-Weaver,
2007
). Moreover, bcd polyadenylation is affected in
mutants that are defective in meiosis, such as cort mutants
(Lieberfarb et al., 1996
). It
has been proposed that the link between cytoplasmic polyadenylation and egg
activation results from the inactivation of canonical PAP activity by
phosphorylation via the MPF (Mitotic promoting factor: Cdc2/CycB)
(Chu et al., 2001
). CycB
degradation by APC-Cort would both induce meiotic progression and release PAP
inactivation, leading to polyadenylation.
This model can be adapted with results presented here and in the recent
literature (Pesin and Orr-Weaver,
2007
; Vardy and Orr-Weaver,
2007
). Two waves of cytoplasmic polyadenylation occur
successively, one during oocyte maturation and one at egg activation. They
both depend on Wisp poly(A) polymerase. The first wave is Orb-dependent and
the pathway that triggers its activation is unknown. This polyadenylation
induces the synthesis of Cort (and probably other proteins), which in turn is
required for the second wave of cytoplasmic polyadenylation at egg activation.
Cort could act in this process through the destruction of cyclins or of other
proteins more specifically involved in the regulation of the polyadenylation
machinery.
Two poly(A) polymerases function in translational control during oogenesis
A striking result in this paper is the requirement of two poly(A)
polymerases for cytoplasmic polyadenylation during oogenesis. Since the
discovery of GLD-2 poly(A) polymerases, it has been assumed that these
proteins were responsible for cytoplasmic polyadenylation. Our data reveal a
higher level of complexity to this regulation. The phenotypes of wisp
mutants indicate a function of Wisp late in oogenesis. We find that entry into
meiosis and restriction of meiosis to one oocyte, as well as DNA condensation
in the karyosome, are unaffected in wisp mutants. By contrast,
orb-null mutants arrest oogenesis in the germarium, with defects in
the synchronous mitoses of cystoblasts and in the restriction of meiosis to
one oocyte (Huynh and St Johnston,
2000
) (I. Busseau and M.S., unpublished). We find that
orb phenotypes corresponding to early defects in oogenesis, including
oocyte determination and dorsoventral patterning, are dominantly enhanced by
hrg mutants, strongly suggesting that canonical PAP and Orb act
together in cytoplasmic polyadenylation during the first steps of oogenesis.
Because Orb forms complexes with both PAP and Wisp, the same pools of mRNAs
can be regulated by the two different complexes, at different steps of
oogenesis. The inclusion of one or other poly(A) polymerase could allow for
different types of regulation. In addition, it is possible that the presence
of both poly(A) polymerases together in the complex could be required for some
step of oogenesis.
In Xenopus, GLD-2 catalyzes polyadenylation during oocyte
maturation (Barnard et al.,
2004
; Rouhana et al.,
2005
), but the enzymes involved after fertilization have not been
identified. Moreover, polyadenylation at earlier stages of oogenesis remains
unexplored.
CPEB function has been addressed genetically in mouse and the defect in the
female germline of Cpeb-knockout mice was found to be during prophase
I (Tay and Richter, 2001
). By
contrast, GLD-2 expression in the oocytes appears to start at metaphase I
(Nakanishi et al., 2006
).
Moreover, no female germline defective phenotype was observed in GLD-2
knockout mice (Nakanishi et al.,
2007
). This demonstrates some level of redundancy in poly(A)
polymerase function in mouse female meiosis, and indicates that the
involvement of different types of poly(A) polymerase for translational
activation in oogenesis and meiotic progression is common to other
species.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/11/1969/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, L. K., Royer, S. M., Page, S. L., McKim, K. S., Lai,
A., Lilly, M. A. and Hawley, R. S. (2005). Juxtaposition of
C(2)M and the transverse filament protein C(3)G within the central region of
Drosophila synaptonemal complex. Proc. Natl. Acad. Sci.
USA 102,4482
-4487.
Ballantyne, S., Bilger, A., Astrom, J., Virtanen, A. and
Wickens, M. (1995). Poly(A) polymerases in the nucleus and
cytoplasm of frog oocytes: dynamic changes during oocyte maturation and early
development. RNA 1,64
-78.[Abstract]
Barnard, D. C., Ryan, K., Manley, J. L. and Richter, J. D.
(2004). Symplekin and xGLD-2 are required for CPEB-mediated
cytoplasmic polyadenylation. Cell
119,641
-651.[CrossRef][Medline]
Benoit, B., Nemeth, A., Aulner, N., Kühn, U., Simonelig,
M., Wahle, E. and Bourbon, H. M. (1999). The
Drosophila poly(A)-binding protein II is ubiquitous throughout
Drosophila development and has the same function in mRNA polyadenylation as
its bovine homolog in vitro. Nucleic Acids Res.
27,3771
-3778.
Benoit, B., Juge, F., Iral, F., Audibert, A. and Simonelig,
M. (2002). Chimeric human CstF-77/Drosophila Suppressor of
forked proteins rescue suppressor of forked mutant lethality and mRNA
3'-end processing in Drosophila. Proc. Natl. Acad. Sci.
USA 99,10593
-10598.
Benoit, B., Mitou, G., Chartier, A., Temme, C., Zaessinger, S.,
Wahle, E., Busseau, I. and Simonelig, M. (2005). An essential
cytoplasmic function for the nuclear poly(A) binding protein, PABP2, in
poly(A) tail length control and early development in Drosophila.
Dev. Cell 9,511
-522.[CrossRef][Medline]
Bergsten, S. E. and Gavis, E. R. (1999). Role
for mRNA localization in translational activation but not spatial restriction
of nanos RNA. Development
126,659
-669.[Abstract]
Brent, A. E., MacQueen, A. and Hazelrigg, T.
(2000). The Drosophila wispy gene is required for RNA
localization and other microtubule-based events of meiosis and early
embryogenesis. Genetics
154,1649
-1662.
Buhler, M., Haas, W., Gygi, S. P. and Moazed, D.
(2007). RNAi-dependent and - independent RNA turnover mechanisms
contribute to heterochromatic gene silencing. Cell
129,707
-721.[CrossRef][Medline]
Castagnetti, S. and Ephrussi, A. (2003). Orb
and a long poly(A) tail are required for efficient oskar translation at the
posterior pole of the Drosophila oocyte. Development
130,835
-843.
Chang, J. S., Tan, L. and Schedl, P. (1999).
The Drosophila CPEB homolog, Orb, is required for Oskar protein expression in
oocytes. Dev. Biol. 215,91
-106.[CrossRef][Medline]
Chang, J. S., Tan, L., Wolf, M. R. and Schedl, P.
(2001). Functioning of the Drosophila orb gene in gurken mRNA
localization and translation. Development
128,3169
-3177.[Medline]
Chicoine, J., Benoit, P., Gamberi, C., Paliouras, M., Simonelig,
M. and Lasko, P. (2007). Bicaudal-C recruits CCR4-NOT
deadenylase to target mRNAs and regulates oogenesis, cytoskeletal
organization, and its own expression. Dev. Cell
13,691
-704.[CrossRef][Medline]
Chu, T., Henrion, G., Haegeli, V. and Strickland, S.
(2001). Cortex, a Drosophila gene required to complete oocyte
meiosis, is a member of the Cdc20/fizzy protein family.
Genesis 29,141
-152.[CrossRef][Medline]
Dickson, K. S., Bilger, A., Ballantyne, S. and Wickens, M.
P. (1999). The cleavage and polyadenylation specificity
factor in Xenopus laevis oocytes is a cytoplasmic factor involved in regulated
polyadenylation. Mol. Cell. Biol.
19,5707
-5717.
Edmonds, M. (2002). A history of poly A
sequences: from formation to factors to function. Prog. Nucleic
Acid Res. Mol. Biol. 71,285
-389.[Medline]
Endow, S. A. and Komma, D. J. (1997). Spindle
dynamics during meiosis in Drosophila oocytes. J. Cell
Biol. 137,1321
-1336.
Heifetz, Y., Yu, J. and Wolfner, M. F. (2001).
Ovulation triggers activation of Drosophila oocytes. Dev.
Biol. 234,416
-424.[CrossRef][Medline]
Horner, V. L., Czank, A., Jang, J. K., Singh, N., Williams, B.
C., Puro, J., Kubli, E., Hanes, S. D., McKim, K. S., Wolfner, M. F. et al.
(2006). The Drosophila calcipressin sarah is required for several
aspects of egg activation. Curr. Biol.
16,1441
-1446.[CrossRef][Medline]
Huynh, J. R. and St Johnston, D. (2000). The
role of BicD, Egl, Orb and the microtubules in the restriction of meiosis to
the Drosophila oocyte. Development
127,2785
-2794.[Abstract]
Juge, F., Zaessinger, S., Temme, C., Wahle, E. and Simonelig,
M. (2002). Control of poly(A) polymerase level is essential
to cytoplasmic polyadenylation and early development in Drosophila.
EMBO J. 21,6603
-6613.[CrossRef][Medline]
Kadyk, L. C. and Kimble, J. (1998). Genetic
regulation of entry into meiosis in Caenorhabditis elegans.
Development 125,1803
-1813.[Abstract]
Kadyrova, L. Y., Habara, Y., Lee, T. H. and Wharton, R. P.
(2007). Translational control of maternal Cyclin B mRNA by Nanos
in the Drosophila germline. Development
134,1519
-1527.
Kashiwabara, S., Noguchi, J., Zhuang, T., Ohmura, K., Honda, A.,
Sugiura, S., Miyamoto, K., Takahashi, S., Inoue, K., Ogura, A. et al.
(2002). Regulation of spermatogenesis by testis-specific,
cytoplasmic poly(A) polymerase TPAP. Science
298,1999
-2002.
Kim, J. H. and Richter, J. D. (2006). Opposing
polymerase-deadenylase activities regulate cytoplasmic polyadenylation.
Mol. Cell 24,173
-183.[CrossRef][Medline]
Kim-Ha, J., Kerr, K. and Macdonald, P. M.
(1995). Translational regulation of oskar mRNA by bruno, an
ovarian RNA-binding protein, is essential. Cell
81,403
-412.[CrossRef][Medline]
King, R. C. (1970). Ovarian
Development in Drosophila melanogaster. New York: Academic
press.
Kosman, D., Small, S. and Reinitz, J. (1998).
Rapid preparation of a panel of polyclonal antibodies to Drosophila
segmentation proteins. Dev. Genes Evol.
208,290
-294.[CrossRef][Medline]
Kwak, J. E. and Wickens, M. (2007). A family of
poly(U) polymerases. RNA
13,860
-867.
Kwak, J. E., Wang, L., Ballantyne, S., Kimble, J. and Wickens,
M. (2004). Mammalian GLD-2 homologs are poly(A) polymerases.
Proc. Natl. Acad. Sci. USA
101,4407
-4412.
Lieberfarb, M. E., Chu, T., Wreden, C., Theurkauf, W., Gerden,
J. P. and Strickland, S. (1996). Mutation that perturb
poly(A)-dependent maternal mRNA activation block the initiation of
development. Development
122,579
-588.[Abstract]
Mohler, J. D. (1977). Developmental genetics of
the Drosophila egg. I. Identification of 59 sex-linked cistrons with maternal
effects on embryonic development. Genetics
85,259
-272.
Morris, J. Z., Hong, A., Lilly, M. A. and Lehmann, R.
(2005). twin, a CCR4 homolog, regulates cyclin poly(A) tail
length to permit Drosophila oogenesis. Development
132,1165
-1174.
Murata, T., Nagaso, H., Kashiwabara, S., Baba, T., Okano, H. and
Yokoyama, K. K. (2001). The hiiragi gene encodes a poly(A)
polymerase, which controls the formation of the wing margin in Drosophila
melanogaster. Dev. Biol.
233,137
-147.[CrossRef][Medline]
Nakanishi, T., Kubota, H., Ishibashi, N., Kumagai, S., Watanabe,
H., Yamashita, M., Kashiwabara, S., Miyado, K. and Baba, T.
(2006). Possible role of mouse poly(A) polymerase mGLD-2 during
oocyte maturation. Dev. Biol.
289,115
-126.[CrossRef][Medline]
Nakanishi, T., Kumagai, S., Kimura, M., Watanabe, H., Sakurai,
T., Kashiwabara, S. and Baba, T. (2007). Disruption of mouse
poly(A) polymerase mGLD-2 does not alter polyadenylation status in oocytes and
somatic cells. Biochem. Biophys. Res. Commun.
364, 14-19.[CrossRef][Medline]
Page, A. W. and Orr-Weaver, T. L. (1996). The
Drosophila genes grauzone and cortex are necessary for proper female meiosis.
J. Cell Sci. 109,1707
-1715.[Abstract]
Page, A. W. and Orr-Weaver, T. L. (1997).
Activation of the meiotic divisions in Drosophila oocytes. Dev.
Biol. 183,195
-207.[CrossRef][Medline]
Pesin, J. A. and Orr-Weaver, T. L. (2007).
Developmental role and regulation of cortex, a meiosis-specific
anaphase-promoting complex/cyclosome activator. PLoS
Genet.. 3,e202
.[CrossRef][Medline]
Richter, J. D. (2000). The influence of
polyadenylation-induced translation on metazoan development and neuronal
synaptic function. In Translational Control of Gene
Expression (ed. J. W. B. Hershey, M. B. Mathews and N.
Sonenberg), pp. 785-806. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
Richter, J. D. (2007). CPEB: a life in
translation. Trends Biochem. Sci.
32,279
-285.[CrossRef][Medline]
Rissland, O. S., Mikulasova, A. and Norbury, C. J.
(2007). Efficient RNA polyuridylation by noncanonical poly(A)
polymerases. Mol. Cell. Biol.
27,3612
-3624.
Rouhana, L., Wang, L., Buter, N., Kwak, J. E., Schiltz, C. A.,
Gonzalez, T., Kelley, A. E., Landry, C. F. and Wickens, M.
(2005). Vertebrate GLD2 poly(A) polymerases in the germline and
the brain. RNA 11,1117
-1130.
Saffman, E. E., Styhler, S., Rother, K., Li, W., Richard, S. and
Lasko, P. (1998). Premature translation of oskar in oocytes
lacking the RNA-binding protein bicaudal-C. Mol. Cell.
Biol. 18,4855
-4862.
Salles, F. J., Lieberfarb, M. E., Wreden, C., Gergen, J. P. and
Strickland, S. (1994). Coordinate initiation of Drosophila
development by regulated polyadenylation of maternal messenger RNAs.
Science 266,1996
-1999.
Semotok, J. L., Cooperstock, R. L., Pinder, B. D., Vari, H. K.,
Lipshitz, H. D. and Smibert, C. A. (2005). Smaug recruits the
CCR4/POP2/NOT deadenylase complex to trigger maternal transcript localization
in the early Drosophila embryo. Curr. Biol.
15,284
-294.[CrossRef][Medline]
Sheets, M. D., Wu, M. and Wickens, M. (1995).
Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic
maturation. Nature 374,511
-516.[CrossRef][Medline]
Stebbins-Boaz, B., Hake, L. E. and Richter, J. D.
(1996). CPEB controls the cytoplasmic polyadenylation of cyclin,
Cdk2 and c-mos mRNAs and is necessary for oocyte maturation in Xenopus.
EMBO J. 15,2582
-2592.[Medline]
Suh, N., Jedamzik, B., Eckmann, C. R., Wickens, M. and Kimble,
J. (2006). The GLD-2 poly(A) polymerase activates gld-1 mRNA
in the Caenorhabditis elegans germ line. Proc. Natl. Acad. Sci.
USA 103,15108
-15112.
Swan, A. and Schupbach, T. (2007). The Cdc20
(Fzy)/Cdh1-related protein, Cort, cooperates with Fzy in cyclin destruction
and anaphase progression in meiosis I and II in Drosophila.
Development 134,891
-899.
Tay, J. and Richter, J. D. (2001). Germ cell
differentiation and synaptonemal complex formation are disrupted in CPEB
knockout mice. Dev. Cell
1, 201-213.[CrossRef][Medline]
Vardy, L. and Orr-Weaver, T. L. (2007). The
Drosophila PNG kinase complex regulates the translation of cyclin B.
Dev. Cell 12,157
-166.[CrossRef][Medline]
Wang, L., Eckmann, C. R., Kadyk, L. C., Wickens, M. and Kimble,
J. (2002). A regulatory cytoplasmic poly(A) polymerase in
Caenorhabditis elegans. Nature
419,312
-316.[CrossRef][Medline]
Whitfield, W. G. F., Gonzalez, C., Maldonado-Colina, G. and
Glover, D. M. (1990). The A- and B-type cyclins of Drosophila
are accumulated and destroyed in temporally distinct events that define
separable phases of the G2-M transition. EMBO J.
9,2563
-2572.[Medline]
Wickens, M., Goodwin, E. B., Kimble, J., Strickland, S. and
Hentze, M. (2000). Translational control of developmental
decisions. In Translational Control of Gene Expression
(ed. J. W. B. Hershey, M. B. Mathews and N. Sonenberg), pp.295
-370. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Zaessinger, S., Busseau, I. and Simonelig, M.
(2006). Oskar allows nanos mRNA translation in Drosophila embryos
by preventing its deadenylation by Smaug/CCR4.
Development 133,4573
-4583.
Zhuang, T., Kashiwabara, S., Noguchi, J. and Baba, T.
(2004). Transgenic expression of testis-specific poly(A)
polymerase TPAP in wild-type and TPAP-deficient mice. J. Reprod.
Dev. 50,207
-213.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Schmid, B. Kuchler, and C. R. Eckmann Two conserved regulatory cytoplasmic poly(A) polymerases, GLD-4 and GLD-2, regulate meiotic progression in C. elegans Genes & Dev., April 1, 2009; 23(7): 824 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Vardy, J. A. Pesin, and T. L. Orr-Weaver Regulation of Cyclin A protein in meiosis and early embryogenesis PNAS, February 10, 2009; 106(6): 1838 - 1843. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Kwak, E. Drier, S. A. Barbee, M. Ramaswami, J. C. P. Yin, and M. Wickens GLD2 poly(A) polymerase is required for long-term memory PNAS, September 23, 2008; 105(38): 14644 - 14649. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||