|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online May 9, 2008
doi: 10.1242/10.1242/dev.019893
1 Department of Biology, Graduate School of Sciences, Kyushu University,
Hakozaki 6-10-1, Fukuoka 812-8581, Japan.
2 Faculty of Integrated Arts and Sciences, The University of Tokushima,
Minamijyousanjima-cho 1-1, Tokushima 770-8502, Japan.
3 CREST, Japan Science and Technology Agency, Nihonbashi, Tokyo 103-0027,
Japan.
* Authors for correspondence (e-mails: nnakascb{at}mbox.nc.kyushu-u.ac.jp; nsagascb{at}mbox.nc.kyushu-u.ac.jp)
Accepted 7 April 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Xenopus, Neural differentiation, Cell division, FoxM1, Cdc25B, BMP
| INTRODUCTION |
|---|
|
|
|---|
Neuroectodermal cells have a higher mitotic activity than
non-neuroectodermal cells in Xenopus embryos
(Saka and Smith, 2001
), and
neural precursors actively proliferate in both chick and mouse embryos
(Graham et al., 2003
;
Hollyday, 2001
). Neural
precursors exit from the cell cycle and differentiate into functional neural
cells, owing in part to the actions of Cdk inhibitors, such as
p27Xic1 in Xenopus
(Vernon et al., 2003
) and
p27Kip1/p57Kip2 (Cdkn1b/Cdkn1c - Mouse Genome
Informatics) in mouse (Cremisi et al.,
2003
). However, it remains unclear how cell proliferation is
initially stimulated in the neuroectoderm or neural precursors. Furthermore,
it is unknown whether preceding cell division or proliferation is required for
terminal differentiation of neural precursors, although, in Xenopus,
cell division after the onset of gastrulation has long been thought to be
nonessential for neural differentiation
(Harris and Hartenstein, 1991
;
Rollins and Andrews, 1991
;
Yeo and Gautier, 2003
).
The Fox gene family encodes transcription factors containing a conserved
Forkhead DNA-binding motif (Katoh and
Katoh, 2004
). FoxM1 has been isolated from both mammals and
Xenopus (Pohl et al.,
2005
; Ye et al.,
1997
). In mammalian cultured cells, FoxM1 activates the expression
of many genes, particularly those encoding G2-M cell-cycle regulators, such as
cyclin B and Cdc25B, and thereby promotes cell division
(Laoukili et al., 2005
;
Wang et al., 2005
). Although
Foxm1 is expressed in actively proliferating neural precursors in mouse
(Karsten et al., 2003
), little
is known about whether this expression makes any contribution to the
proliferation or differentiation of neural precursors
(Krupczak-Hollis et al., 2004
;
Schüller et al.,
2007
).
To investigate the possible relationship between cell division and neural differentiation, we have analyzed the role of FoxM1 in early Xenopus development. We show that FoxM1 is expressed in the neuroectoderm and is required for cell division in this region. In addition, BMP inhibition induces cell division by augmenting the expression of FoxM1 and its target G2-M regulators. Furthermore, and importantly, preceding FoxM1-dependent cell division is required for neuronal differentiation but not specification. Thus, our results reveal the primary mechanism of proliferation of neural precursors, and link cell division and neuronal differentiation in early Xenopus embryos.
| MATERIALS AND METHODS |
|---|
|
|
|---|
cDNAs and in vitro transcription
cDNAs encoding Xenopus FoxM1
(Pohl et al., 2005
) (accession
number AJ853462) and cyclin B3 (Hochegger
et al., 2001
) (AJ853462) were isolated by RT-PCR from
Xenopus neurula RNA and subcloned into either the pT7-G (UKII+) or
pCS2+ transcriptional vector (Nakajo et
al., 2000
; Watanabe and
Whitman, 1999
). The FoxM1(
N) cDNA encoding amino acids
215-759 of Xenopus FoxM1 protein was as previously described
(Lüscher-Firzlaff et al.,
2006
). A cDNA encoding Xenopus Cdc25B (AB363840) was
isolated by PCR from a tailbud cDNA library and subcloned into the pT7-G
(UKII+) or pCS2+ transcriptional vector. cDNAs encoding dnBMPR and Noggin were
as previously described (Graff et al.,
1994
; Smith and Harland,
1992
). In vitro transcription of cDNAs was performed as described
(Nakajo et al., 2000
).
RT-PCR
RT-PCR of RNA from whole embryos or animal caps was performed essentially
as described (Watanabe and Whitman,
1999
). The primer sets used for PCR were (5' to 3'; U,
upstream and D, downstream): FoxM1 U, CCGACCACCTCTTCCACTCCCAGC and D,
GTCCAGCAGAATTTTGCTTAGACTGTCGT; Cdc25B U, ACGTGGAAGACTTTCTGCTGAAG and D,
TCTCGCTTGCTCTTGTCTCCGG; cyclin B1 U, GATGGTGGATTATGATATGG and D,
CCATTTCCACAACAACATCT; cyclin B3 U, CTTCCTGCGCAGATTTGCTA and D,
TGTGAGTATTTGCTCCTCAC; cyclin D1 U, ACTGACTGAGGATACCAAGC and D,
GGAGATGTCCACTTCATCCA; Sox2 U, GCTGCCCATGCACCGCTATGATG and D,
TCACATGTGCGACAGAGGCAGCG.
Primer sets for N-CAM, N-tubulin, E-keratin, M-actin and EF1-
are
described in Xenbase
(http://www.xenbase.org/common).
Whole-mount in situ hybridization, β-Gal staining and pH3 staining
Whole-mount in situ hybridization was performed essentially as described
(Sive et al., 2000
); the
constructs used were for Sox2 (Mizuseki et
al., 1998
), Xngnr1 (Ma et al.,
1996
), N-tubulin (Chitnis et
al., 1995
) and MyoD (Hopwood
et al., 1989
). Staining for β-galactosidase (β-Gal) and
phosphorylated histone H3 (pH3) were as described (Saka and Smith, 2002;
Sive et al., 2000
).
Hoechst staining
Neural plates were isolated from embryos at stage (st.) 14, fixed with
MEMFA for 20 minutes, stained for β-Gal and then re-fixed with Fixative 1
[10% formaldehyde, 60 mM HEPES-KOH (pH 7.5)] for 1 hour. They were then
treated with Fixative 2 [10% formaldehyde, 60 mM HEPES-KOH (pH 7.5), 50%
glycerol] containing 5 µg/ml Hoechst for 15 minutes, washed twice with
Fixative 2 (without Hoechst) and then mounted for fluorescence microscopy.
Antibodies and immunoblotting
For immunoblotting, whole embryos or animal caps were homogenized with an
extraction buffer (80 mM β-glycerophosphate, 15 mM MgCl2, 20
mM EGTA, 10 µM pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin,
0.2 mM PMSF, 1 mM NaF, 1 µM microcystin, 1 mM sodium orthovanadate).
Proteins equivalent to one embryo or ten animal caps were analyzed by
immunoblotting using antibodies against histone H3 phospho-Ser10 (Upstate
Biochemistry) or ERK1 (Santa Cruz Biotechnology).
| RESULTS |
|---|
|
|
|---|
70% reduction in the number of pH3-positive cells in the
neural plate on the injected side, whereas injection of control MO caused no
appreciable reduction (Fig.
1B). We also counted the number of cells in the neural plate
(isolated from st. 14 embryos) by staining their nuclei with Hoechst.
Injection of FoxM1-MO, but not of control MO, caused a significant (
25%)
reduction in cell numbers in the neural plate, as well as causing an
enlargement and a stronger staining of nuclei (probably reflecting G2-phase
arrest of the cell cycle) (Fig.
1C). Thus, intriguingly, FoxM1 is essential for normal cell
proliferation in the neural plate, consistent with it being expressed in this
region (Fig. 1A).
FoxM1 activates expression of G2-M cell-cycle regulators in the neural plate
Because FoxM1 activates many genes encoding G2-M cell-cycle regulators,
such as Cdc25B and cyclin B, in cultured cells
(Laoukili et al., 2005
;
Wang et al., 2005
), it might
also do so in the neural plate, thereby promoting cell proliferation in this
region. When analyzed by WISH at the mid-neurula stage (st. 15-16), both
Cdc25B and cyclin B3, like FoxM1, were found to be expressed
in the neural plate (Fig. 1D,
control MO). More importantly, pre-injecting FoxM1-MO into two-cell embryos
significantly suppressed the expression of Cdc25B (in 81% of the
injected embryos, n=52) and cyclin B3 (88%, n=51) in the
neural plate (Fig. 1D,
FoxM1-MO; see the right-hand, injected side of the embryos). To confirm these
results, we also performed RT-PCR analysis of Cdc25B and cyclin B3
using whole embryos. FoxM1-MO injection at the one-cell stage caused a
dramatic reduction in the expression of Cdc25B and cyclin B3 at the
initial neurula stage (st. 13) (Fig.
1E). Furthermore, immunoblotting analysis, like immunostaining
analysis (Fig. 1B), revealed a
substantial decrease in pH3 levels in FoxM1-MO-treated embryos
(Fig. 1E). Importantly, all of
these effects of FoxM1-MO injection were rescued by co-injection of
FoxM1-MO-resistant mRNA encoding wild-type FoxM1 (but not a transcriptionally
inactive FoxM1 mutant, data not shown)
(Fig. 1E). Thus, these results
suggest that FoxM1 promotes cell proliferation in the neural plate, most
probably by transcriptionally activating the expression of G2-M cell-cycle
regulators (see also Fig.
4C).
BMP inhibition induces cell proliferation in the neuroectoderm
Although cell proliferation is pronounced in the proneural region in many
species (Hollyday, 2001
;
Saka and Smith, 2001
)
(Fig. 1B), little is known
about the identity of the signaling that leads to this proliferation. In
vertebrates, including Xenopus, neural induction involves signaling
induced by FGF, Wnt, or by inhibition of BMP
(Muñoz-Sanjuán and
Brivanlou, 2002
; Stern,
2005
). To test whether any of these signaling pathways could
induce cell proliferation in the neural plate
(Fig. 1B), we performed animal
cap assays, in which the effect of a single signaling pathway on neural
induction or differentiation can be tested
(Stern, 2005
). As revealed by
immunoblotting of pH3, BMP inhibition by ectopically expressed Noggin [a BMP
antagonist (Muñoz-Sanjuán
and Brivanlou, 2002
)], but not FGF or Wnt signaling, strongly
induced cell proliferation in the animal cap, although the three signaling
pathways (induced by Noggin, FGF or Wnt) were all effectively activated, as
judged by expression of their downstream genes (N-CAM, Xbra and
M-actin, respectively) (Fig.
2A). Similar to BMP inhibition by Noggin, BMP inhibition by
Chordin (another BMP antagonist) or a dominant-negative BMP receptor (dnBMPR),
also induced cell proliferation in the animal cap (see Fig. S2A in the
supplementary material). Moreover, even overexpression of dnBMPR in early
neurula embryos was able to significantly enhance cell proliferation in the
ventral region (Fig. 2B). In
Xenopus, inhibition of BMP signaling is initiated during gastrulation
and is central to neural induction
(Muñoz-Sanjuán and
Brivanlou, 2002
; Stern,
2005
) (see also below). Thus, these results strongly suggest that
BMP inhibition induces not only neural induction, but also cell proliferation,
in the neural plate (or neuroectoderm) of Xenopus embryos.
|
N)
(Lüscher-Firzlaff et al.,
2006
|
FoxM1 is required for neuronal differentiation but not specification
To investigate the role of FoxM1 in neurogenesis in more detail, we next
examined expression of several neural markers in mid-neurula embryos (st. 14
or 16) by WISH. Treating embryos with FoxM1-MO, but not control MO, markedly
inhibited the expression of N-CAM as a pan-neural marker (91%,
n=51) and of N-tubulin (which was expressed in stripes) (90%,
n=60) (Fig. 3B).
However, expression of Xngnr1, a proneural marker specifying primary
neurons (Ma et al., 1996
), was
not affected by FoxM1-MO treatment (7%, n=43), whereas that of
Sox2, an initial neural marker specifying neuroectoderm
(Kishi et al., 2000
), was
slightly expanded (79%, n=63)
(Fig. 3B). As a control,
expression of MyoD, a mesodermal marker, was not affected by FoxM1-MO
(4%, n=46). In these experiments, the decrease in N-tubulin (and
N-CAM) expression induced by FoxM1-MO could have been due to the
decrease in cell number. However, double staining of nuclei and N-tubulin mRNA
revealed that, in the FoxM1-MO-treated (primary) neuronal region, the cell
number was only moderately reduced (by about 25%), whereas the expression of
N-tubulin was totally suppressed (see Fig.
1C and Fig. S3 in the supplementary material), indicating that the
decrease in N-tubulin expression induced by the FoxM1-MO was not a matter of
cell number. Thus, the present data seemed to suggest that FoxM1 is required
for (primary) neuronal differentiation, but not for neuronal specification, in
early embryos.
To confirm the requirement of FoxM1 for neuronal differentiation (but not
specification), we also performed RT-PCR analysis of various marker genes
using animal caps treated with Activin or Noggin. Activin treatment of animal
caps induced the expression of M-actin, N-CAM and N-tubulin, as
previously reported (Hemmati-Brivanlou and
Melton, 1992
) (Fig.
3C, control MO); notably, however, co-treatment with FoxM1-MO
suppressed the expression of N-CAM and N-tubulin but not of M-actin
(Fig. 3C, FoxM1-MO). By
contrast, Noggin treatment induced the expression of Sox2 and
N-CAM, as previously reported
(Stern, 2005
), and also of
N-tubulin (Fig. 3D, control
MO); however, co-treatment with FoxM1-MO suppressed the expression of
N-CAM and N-tubulin but not of Sox2
(Fig. 3D, FoxM1-MO). Ectopic
expression of FoxM1(
N) alone was not able to induce
expression of the neural markers, including Sox2 (data not shown, but
see Fig. 2D). Finally, and as
expected, the onset of FoxM1 expression in Noggin-treated animal caps
coincided with that of Sox2 but preceded that of N-CAM and
N-tubulin (which occurred in this order)
(Fig. 3E; see also
Fig. 3E legend). Together with
the results shown in Fig. 3B,
these results strongly suggest that FoxM1 is required (albeit not sufficient)
for neuronal differentiation, but not specification, in early
neurogenesis.
|
|
| DISCUSSION |
|---|
|
|
|---|
We also found that FoxM1 is required for neural but not epidermal or
muscular development (Fig. 3A).
More specifically, FoxM1 was required for primary neuronal differentiation but
not specification (Fig. 3B-E).
Furthermore, and interestingly, FoxM1 was involved in neuronal differentiation
via its function in promoting G2-M cell-cycle progression, or primarily via
activating Cdc25B expression (Fig.
4). According to the temporal expression patterns of neural
induction and differentiation markers in Xenopus
(Chitnis et al., 1995
;
Ma et al., 1996
;
Mizuseki et al., 1998
) (see
also Fig. S5 in the supplementary material), neural induction (or
specification) occurs during gastrulation (st. 10-12), whereas primary
neuronal differentiation occurs during the subsequent neurula stages (st.
13-16) (see Fig. 5). Moreover,
according to previous reports (Hartenstein,
1989
; Howe et al.,
1995
; Lamborghini,
1980
), primary neuronal precursors presumably undergo only one or
two rounds of cell division between the onset of gastrulation (st. 10) and
neuronal differentiation (which is accompanied by cell-cycle exit) (st.
13-16). Therefore, our findings that Cdc25B, the FoxM1 target, begins
to be expressed at st. 10 (see Fig. S4A in the supplementary material) and
that FoxM1/Cdc25B-dependent cell division before or at st. 13
(Fig. 1B-E,
Fig. 4C) is required for
neuronal differentiation at st. 14 (Fig.
3B, Fig. 4D), would
seem to suggest that FoxM1 functions to drive the immediate, preceding cell
division(s) of primary neuronal precursors for their terminal differentiation
(Fig. 5). Furthermore, the
continued expression of FoxM1 (and its target G2-M cell-cycle
regulators) in later neural tissues (Fig.
1A), as well as its requirement for head formation and eye
development (Fig. 3A,
Fig. 4B), suggests that
FoxM1-driven cell division is also required to generate secondary neurons
(Harris and Hartenstein, 1991
;
Hartenstein, 1989
). Thus, it
seems that FoxM1 functions to link cell division and neuronal differentiation
in early Xenopus embryos.
|
The requirement of BMP inhibition for neural induction is highly conserved
from Drosophila to mammals
(Muñoz-Sanjuán and
Brivanlou, 2002
; Stern,
2005
). Furthermore, in many species, neural precursors actively
proliferate prior to their terminal differentiation
(Graham et al., 2003
;
Hollyday, 2001
). Thus, given
our results, FoxM1 or some other functionally equivalent transcription
factor(s) might also play an important role in the proliferation and
differentiation of neural precursors in other species.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/11/2023/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bertrand, N., Castro, D. S. and Guillemot, F.
(2002). Proneural genes and the specification of neural cell
types. Nat. Rev. Neurosci.
3, 517-530.[CrossRef][Medline]
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and
Kintner, C. (1995). Primary neurogenesis in Xenopus
embryos regulated by a homologue of the Drosophila neurogenic gene
Delta. Nature 375,761
-766.[CrossRef][Medline]
Cremisi, F., Philpott, A. and Ohnuma, S.
(2003). Cell cycle and cell fate interactions in neural
development. Curr. Opin. Neurobiol.
13, 26-33.[CrossRef][Medline]
Dasso, M. and Newport, J. W. (1990). Completion
of DNA replication is monitored by a feedback system that controls the
initiation of mitosis in vitro: studies in Xenopus.
Cell 61,811
-823.[CrossRef][Medline]
Feng, X. H. and Derynck, R. (2005). Specificity
and versatility in TGF-β signaling through Smads. Annu. Rev.
Cell Dev. Biol. 21,659
-693.[CrossRef][Medline]
Graff, J. M., Thies, R. S., Song, J. J., Celeste, A. J. and
Melton, D. A. (1994). Studies with a Xenopus BMP
receptor suggest that ventral mesoderm-inducing signals override dorsal
signals in vivo. Cell
79,169
-179.[CrossRef][Medline]
Graham, V., Khudyakov, J., Ellis, P. and Pevny, L.
(2003). SOX2 functions to maintain neural progenitor identity.
Neuron 39,749
-765.[CrossRef][Medline]
Harris, W. A. and Hartenstein, V. (1991).
Neuronal determination without cell division in Xenopus embryos.
Neuron 6,499
-515.[CrossRef][Medline]
Hartenstein, V. (1989). Early neurogenesis in
Xenopus: the spatio-temporal pattern of proliferation and cell
lineages in the embryonic spinal cord. Neuron
3, 399-411.[CrossRef][Medline]
Hemmati-Brivanlou, A. and Melton, D. A. (1992).
A truncated activin receptor inhibits mesoderm induction and formation of
axial structures in Xenopus embryos. Nature
359,609
-614.[CrossRef][Medline]
Hochegger, H., Klotzbücher, A., Kirk, J., Howell, M.,
Guellec, K. L., Fletcher, K., Duncan, T., Sohail, M. and Hunt, T.
(2001). New B-type cyclin synthesis is required between meiosis I
and II during Xenopus oocyte maturation.
Development 128,3795
-3807.
Hogan, B. L. (1996). Bone morphogenetic
proteins: multifunctional regulators of vertebrate development.
Genes Dev. 10,1580
-1594.
Hollyday, M. (2001). Neurogenesis in the
vertebrate neural tube. Int. J. Dev. Neurosci.
19,161
-173.[CrossRef][Medline]
Hopwood, N. D., Pluck, A. and Gurdon, J. B.
(1989). MyoD expression in the forming somites is an early
response to mesoderm induction in Xenopus embryos. EMBO
J. 8,3409
-3417.[Medline]
Howe, J. A., Howell, M., Hunt, T. and Newport, J. W.
(1995). Identification of a developmental timer regulating the
stability of embryonic cyclin A and a new somatic A-type cyclin at
gastrulation. Genes Dev.
9,1164
-1176.
Karsten, S. L., Kudo, L. C., Jackson, R., Sabatti, C., Kornblum,
H. I. and Geschwind, D. H. (2003). Global analysis of gene
expression in neural progenitors reveals specific cell-cycle, signaling, and
metabolic networks. Dev. Biol.
261,165
-182.[CrossRef][Medline]
Katoh, M. and Katoh, M. (2004). Human FOX gene
family. Int. J. Oncol.
25,1495
-1500.[Medline]
Kishi, M., Mizuseki, K., Sasai, N., Yamazaki, H., Shiota, K.,
Nakanishi, S. and Sasai, Y. (2000). Requirement of
Sox2-mediated signaling for differentiation of early Xenopus
neuroectoderm. Development
127,791
-800.[Abstract]
Ko, T. C., Sheng, H. M., Reisman, D., Thompson, E. A. and
Beauchamp, R. D. (1995). Transforming growth factor-β1
inhibits cyclin D1 expression in intestinal epithelial cells.
Oncogene 10,177
-184.[Medline]
Krupczak-Hollis, K., Wang, X., Kalinichenko, V. V., Gusarova, G.
A., Wang, I. C., Dennewitz, M. B., Yoder, H. M., Kiyokawa, H., Kaestner, K. H.
and Costa, R. H. (2004). The mouse Forkhead Box m1
transcription factor is essential for hepatoblast mitosis and development of
intrahepatic bile ducts and vessels during liver morphogenesis.
Dev. Biol. 276,74
-88.[CrossRef][Medline]
Lamborghini, J. E. (1980). Rohon-Beard cells
and other large neurons in Xenopus embryos originate during
gastrulation. J. Comp. Neurol.
189,323
-333.[CrossRef][Medline]
Laoukili, J., Kooistra, M. R. H., Brás, A., Kauw, J.,
Kerkhoven, R. M., Morrison, A., Clevers, H. and Medema, R. H.
(2005). FoxM1 is required for execution of the mitotic programme
and chromosome stability. Nat. Cell Biol.
7, 126-136.[CrossRef][Medline]
Lee, J. E., Hollenberg, S. M., Snider, L., Turner, D. L.,
Lipnick, N. and Weintraub, H. (1995). Conversion of
Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix
protein. Science 268,836
-844.
Lüscher-Firzlaff, J. M., Lilischkis, R. and Lüscher,
B. (2006). Regulation of the transcription factor FOXM1c by
Cyclin E/CDK2. FEBS Lett.
580,1716
-1722.[CrossRef][Medline]
Ma, Q., Kintner, C. and Anderson, D. J. (1996).
Identification of neurogenin, a vertebrate neuronal determination gene.
Cell 87,43
-52.[CrossRef][Medline]
Massagué, J., Blain, S. W. and Lo, R. S.
(2000). TGF-β signaling in growth control, cancer, and
heritable disorders. Cell
103,295
-309.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai,
Y. (1998). Xenopus Zic-related-1 and Sox-2, two
factors induced by chordin, have distinct activities in the initiation of
neural induction. Development
125,579
-587.[Abstract]
Muñoz-Sanjuán, I. and Brivanlou, A. H.
(2002). Neural induction, the default model and embryonic stem
cells. Nat. Rev. Neurosci.
3, 271-280.[CrossRef][Medline]
Nakajo, N., Yoshitome, S., Iwashita, J., Iida, M., Uto, K.,
Ueno, S., Okamoto, K. and Sagata, N. (2000). Absence of Wee1
ensures the meiotic cell cycle in Xenopus oocytes. Genes
Dev. 14,328
-338.
Pohl, B. S., Rössner, A. and Knöchel, W.
(2005). The Fox gene family in Xenopus laevis: FoxI2,
FoxM1 and FoxP1 in early development. Int. J. Dev.
Biol. 49,53
-58.[CrossRef][Medline]
Rollins, M. B. and Andrews, M. T. (1991).
Morphogenesis and regulated gene activity are independent of DNA replication
in Xenopus embryos. Development
112,559
-569.[Abstract]
Saka, Y. and Smith, J. C. (2001). Spatial and
temporal patterns of cell division during early Xenopus
embryogenesis. Dev. Biol.
229,307
-318.[CrossRef][Medline]
Schüller, U., Zhao, Q., Godinho, S. A., Heine, V. M.,
Medema, R. H., Pellman, D. and Rowitch, D. H. (2007).
Forkhead transcription factor FoxM1 regulates mitotic entry and prevents
spindle defects in cerebellar granule neuron precursors. Mol. Cell.
Biol. 27,8259
-8270.
Shimuta, K., Nakajo, N., Uto, K., Hayano, Y., Okazaki, K. and
Sagata, N. (2002). Chk1 is activated transiently and targets
Cdc25A for degradation at the Xenopus midblastula transition.
EMBO J. 21,3694
-3703.[CrossRef][Medline]
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis: A
Laboratory Manual. New York: Cold Spring Harbor Laboratory
Press.
Smith, W. C. and Harland, R. M. (1992).
Expression cloning of noggin, a new dorsalizing factor localized to the
Spemann organizer in Xenopus embryos. Cell
70,829
-840.[CrossRef][Medline]
Stern, C. D. (2005). Neural induction: old
problem, new findings, yet more questions. Development
132,2007
-2021.
Vernon, A. E., Devine, C. and Philpott, A.
(2003). The cdk inhibitor p27Xic1 is required for differentiation
of primary neurones in Xenopus. Development
130, 85-92.
Wang, I. C., Chen, Y. J., Hughes, D., Petrovic, V., Major, M.
L., Park, H. Y., Tan, Y., Ackerson, T. and Costa, R. H.
(2005). Forkhead Box M1 regulates the transcriptional network of
genes essential for mitotic progression and genes encoding the SCF (Skp2-Cks1)
ubiquitin ligase. Mol. Cell. Biol.
25,10875
-10894.
Watanabe, M. and Whitman, M. (1999). FAST-1 is
a key maternal effector of mesoderm inducers in the early Xenopus
embryo. Development 126,5621
-5634.[Abstract]
Ye, H., Kelly, T. F., Samadani, U., Lim, L., Rubio, S.,
Overdier, D. G., Roebuck, K. A. and Costa, R. H. (1997).
Hepatocyte nuclear factor 3/fork head homolog 11 is expressed in proliferating
epithelial and mesenchymal cells of embryonic and adult tissues.
Mol. Cell. Biol. 17,1626
-1641.[Abstract]
Yeo, W. and Gautier, J. (2003). A role for
programmed cell death during early neurogenesis in Xenopus. Dev.
Biol. 260,31
-45.[CrossRef]
Related articles in Development:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||