|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 14 May 2008
doi: 10.1242/dev.015719
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MRC Centre for Developmental and Biomedical Genetics and Department of Biomedical Science, University of Sheffield, Western Bank, Sheffield S10 2TN, UK.
* Author for correspondence (e-mail: p.w.ingham{at}sheffield.ac.uk)
Accepted 15 April 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Myotome, Fibre type, Slow myosin heavy chain, Troponin, Prox1, Shh, Blimp1, u-boot, prdm1, Craniofacial
| INTRODUCTION |
|---|
|
|
|---|
and MyHCβ gene pair (Myh6 and
Myh7 - Mouse Genome Informatics) with MyHCβ providing the slow
MyHC isoform for skeletal as well as cardiac muscle
(Lompre et al., 1984
In contrast to the single MyHCβ gene in the mammalian genome, the
chick has a tandem array of three slow MyHC genes with differing developmental
expression patterns (Chen et al.,
1997
; Page et al.,
1992
; Sacks et al.,
2003
). Analysis of chick MyHC isoforms demonstrated that embryonic
muscle fibres are initially patterned as slow or fast twitch independently of
neural activity (Crow and Stockdale,
1986
).
In teleost fish, such as carp and medaka, different MyHC genes are
expressed during different developmental stages and at different water
temperatures (Liang et al.,
2007
; Nihei et al.,
2006
; Ono et al.,
2006
). The previously described zebrafish smyhc1 gene
(Bryson-Richardson et al.,
2005
; Nakano et al.,
2004
; Rauch et al.,
2003
) is within a tandem array of five MyHC genes that has been
extensively studied on a genomic sequence basis as a classic example of gene
conversion events (McGuigan et al.,
2004
).
In the zebrafish embryo, the first muscle fibres to form are of the slow
twitch type (Devoto et al.,
1996
; van Raamsdonk et al.,
1978
). These fibres derive from precursors known as adaxial cells,
so called because they lie adjacent to the axial midline structures that
secrete Hedgehog (Hh) family proteins
(Devoto et al., 1996
). Adaxial
cells respond to Hh signalling by expressing the Prdm1 transcription factor,
the activity of which is both necessary and sufficient for adaxial cells to
adopt the slow twitch fibre identity
(Baxendale et al., 2004
) and
express slow MyHC (Bryson-Richardson et
al., 2005
; Devoto et al.,
1996
), and the homeodomain protein Prox1
(Glasgow and Tomarev, 1998
;
Roy et al., 2001
). Once
specified, the cells undergo a radial migration from their original medial
location to form a superficial monolayer of slow twitch muscle fibres covering
the embryonic myotome and subsequently a lateral wedge-shaped strip of slow
muscle called the lateralis superficialis in juveniles
(Devoto et al., 1996
).
Following the initial wave of primary fibre differentiation in the
zebrafish, further slow twitch fibres differentiate in a variety of locations.
The specification of some of these secondary slow twitch fibres has been shown
to be independent of Hh signalling (Barresi
et al., 2001
). Here, we have investigated the molecular identity
of these secondary slow fibres and explored the role of Prdm1 in their
specification. We show that Prdm1 activity is required only by a specific
subset of these slow fibres that are distinguished from other secondary slow
fibres by their expression of the smyhc1 gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Smyhc cDNA
RT-PCR from 14-somite stage embryos using CODEHOP
(Rose et al., 1998
) primer
pairs gaatccgaatctgccgaaarggnttycc+cacgcccatgaaggctckdatrttcca and
gaagatggagggagacctgaaygaratgga+ctgctccttcttcagctcctcngccatcat followed by
5' and 3' Smart RACE (Clontech) gave products used to design the
primer pair cggggacacaggacaactcgaggtaag+gctagattagaaccagtacttgaacatggc used to
amplify an RT-PCR product spanning the smyhc1 (Accession Number
EF030714)-coding sequence cloned as psmyhc1-CDS. This is the same
gene as described by Bryson-Richardson et al.
(Bryson-Richardson et al.,
2005
) and Rauch et al. (Rauch
et al., 2003
). smyhc2 (Accession Number BK006466) is
represented by the existing cDNA IMAGE_7433531, smyhc3 (Accession
Number BK006465) is represented by cDNA IMAGE_7041248. 5' Smart RACE
from 120 hpf embryos with primer tggcgggttctgagggtgacagt gave EU526313
(Accession Number) with the smyhc2 5'UTR, whereas primer
gctcccggtccgacttcctgaga gave EU218877 (Accession Number) with the
smyhc3 5'UTR.
In situ hybridisation and immunofluorescence
Whole-mount in situ hybridisation
(Thisse and Thisse, 1998
) and
cryosection in situ hybridisation
(Braissant and Wahli, 1998
)
were as previously described. Probes were from plasmids pBlimp1
(Baxendale et al., 2004
) for
prdm1, pslowtroponinC-ISH subcloned from IMAGE_6899234 for
slowtroponinC zgc:86932 (Thisse
et al., 2001
; Xu et al.,
2006
), psmyhc1-CDS with bp 1-6128 of EF030714,
psmyhc1 (1 to 249 bp) with bp 1-249 of EF030714, psmyhc2 (1
to 324 bp) with bp 1-324 of EU526313, psmyhc2 (1 to 155 bp) with bp
1-155 of EU526313 and psmyhc3 (1 to 129 bp) with bp 1-129 of
EU218877. psmyhc1-CDS detects the smyhc1, smyhc2 and
smyhc3 transcripts. psmyhc2 (1 to 324 bp) provides more
sensitive detection of smyhc2 than does psmyhc2 (1 to 155
bp) but requires high stringency conditions to avoid cross-hybridisation to
smyhc1. Chromogenic in situ hybridisation microscopy used a Zeiss
Axioplan with Spot4 digital camera.
Immunofluorescence followed Devoto et al.
(Devoto et al., 1996
),
Serbedzija et al. (Serbedzija et al.,
1998
) Hamade et al. (Hamade et
al., 2006
) and Hernandez et al.
(Hernandez et al., 2005
)
using: mouse monoclonals F310 anti-fast myosin light chain (1:50, DSHB), MF20
anti-light meromyosin (1:500, DSHB), S58 anti-slow MyHC (1:10, DSHB), II-II6B3
anti-collagen 2a (1:500 DSHB), 15B8 anti-β-catenin (1:500 Sigma) and
Bu20a anti-bromodeoxyuridine (1:100, DakoCytomation); and rabbit polyclonals
anti-GFP (1:1000, Torrey Pines Biolabs) and anti-Prox1 (1:5000). Anti-Prox1
was raised against recombinant zebrafish Prox1 purified from E. coli
(A. M. Taylor, personal communication). TOTO-3 iodide (Molecular Probes) was
used at 200 nM. Imaging used Leica TCS SP, Olympus Fluoview FV1000 or Zeiss
LSM 510 confocal microscopes with ImageJ software
(Abramoff, 2004
).
Fluorescent in situ hybridisation used anti-digAP and Fast Red (Roche) or anti-digPOD (at 1:10,000) and TSA Cyanine3 (Perkin Elmer).
smyhc1:gfp transgenesis
A GFP-SV40pA-FRT-Kn-FRT recombineering targeting cassette and red
recombineering system in EL250 cells were used to insert EGFP with an SV40
polyadenylation site at the smyhc1 ATG start site in BAC ZC227E6
(Lee et al., 2001
), which has
at least 80 kb of upstream sequence and an insert size of 170 kb, as
determined by CHEF electrophoresis and Southern blotting. This modified BAC,
linearised with PI-SceI, was used to generate stable transgenic line
Tg(BAC smyhc1:gfp)i108
(Higashijima et al., 1997
).
Reporter plasmid p9.7kbsmyhc1:gfp-I-SceI was constructed with
I-SceI sites flanking 9.7kb of smyhc1 upstream sequence
joined at the smyhc1 ATG start site to EGFP with an SV40
polyadenylation site. p9.7kbsmyhc1:gfp-I-SceI was used to generate five stable
Tg(9.7kb smyhc1:gfp) transgenic lines. Lines Tg(9.7kb
smyhc1:gfp)i101, i102, i103 and
i104 have the same expression pattern as Tg(BAC
smyhc1:gfp)i108. Line Tg(9.7kb
smyhc1:gfp)i105 differs in having additional ectopic
expression in the brain. For this work, we used the two lines that gave the
strongest signal: Tg(BAC smyhc1:gfp)i108 and Tg(9.7kb
smyhc1:gfp)i104.
prdm1:gfp transgenesis
A GFP-SV40pA-FRT-CmR-FRT recombineering targeting cassette was used to
insert EGFP with an SV40 polyadenylation site at the prdm1 ATG start
site in PAC F2219 (Amemiya and Zon,
1999
; Baxendale et al.,
2004
). The modified PAC, linearised with NotI, was used
to generate stable transgenic lines Tg(PACprdm1:gfp)i106
and Tg(PACprdm1:gfp)i107
(Higashijima et al., 1997
). A
further red recombineering step removed all sequences downstream of the SV40
polyadenylation site. This PAC, linearised with Not1, was used to
generate stable transgenic line Tg(-60prdm1:gfp)i111.
Tg(PACprdm1:gfp)i106 was used in smo mutants.
Tg(PACprdm1:gfp)i106 and
Tg(PACprdm1:gfp)i107 partially rescue the
ubotp39 phenotype and so
Tg(-60prdm1:gfp)i111 was used in ubo (prdm1)
mutants. Tg(-60prdm1:gfp)i111 gives the same expression
pattern as Tg(PACprdm1:gfp)i106 and
Tg(PACprdm1:gfp)i107 when transmitted from males, but
gives ubiquitous maternal expression. Tg(-60prdm1:gfp)i111
males were crossed to non-transgenic females to provide the embryos used for
this study.
BrdU analysis
BrdU pulse labelling followed Park and Appel
(Park and Appel, 2003
). Fixed,
BrdU-labelled embryos were exposed to 1.7 N HCl for 60 minutes prior to a 90
minute 10 µgml-1 proteinase K digestion and standard
immunofluorescence. Specimens were examined over a three-somite wide view at
the level of the anus. The full thickness of the myotome was scanned at 0.57
µm intervals by confocal microscopy and all the individual images in the
confocal stack were inspected to count BrdU labelled nuclei.
| RESULTS |
|---|
|
|
|---|
|
From 48 hpf, a series of muscles differentiate with slow twitch fibres that express smyhc2 but not smyhc1 (Fig. 1D-G, see Fig. S1 and Table S1 in the supplementary material). The third gene in the tandem array, which we call smyhc3, has very short UTR sequences, making detection by in situ hybridisation difficult. Nevertheless, we could observe at the limit of detection smyhc3 expression in some of the smyhc2-positive trunk muscles (Fig. 1H; see Table S1 in the supplementary material).
In contrast to the differential expression of the Smyhc genes, slow
troponin C is expressed in all slow MyHC-expressing fibres throughout the
embryo (see Fig. S2 in the supplementary material)
(Thisse et al., 2001
).
Expression is restricted to S58-positive fibres except in the pectoral fin
muscle that is S58 negative but strongly expresses slow troponin C
(see Fig. S2 in the supplementary material); the physiological status of this
muscle is unclear.
There is expression of smyhc2 at 72 hpf and smyhc3 at 96
hpf in a few fibres lateral to the horizontal myoseptum that we have called
the embryonic lateralis superficialis (Fig.
1D,F,H; see Fig. S1 in the supplementary material). These few
fibres may later become incorporated into the lateralis superficialis muscle
that forms at this location in juveniles predominantly from adaxially derived
fibres (Devoto et al., 1996
).
At 32 dpf, smyhc1 and smyhc2 are co-expressed in the
lateralis superficialis (Fig.
2A). By 42 days post fertilisation (dpf), the trunk lacks
smyhc1 expression (data not shown), and smyhc2 and
smyhc3 are expressed in the lateralis superficialis muscles
(Fig. 2C). GFP is known to
persist long after reporter transcription has ceased
(Tallafuss and Bally-Cuif,
2003
). This presumably explains why lateral fibres of the 42 dpf
lateralis superficialis are still marked with smyhc1:gfp
(Fig. 2B). The adult lateralis
superficialis lacks smyhc1 expression (data not shown) and has a
complex complementary expression of smyhc2 and smyhc3
(Fig. 2D).
|
Despite the limitations of the smyhc3 probe, intense smyhc3 expression was detected in the levator arcus palatini muscle that lacks smyhc1 expression (Fig. 3A). Weaker smyhc3 expression was detected in certain other craniofacial muscles (Fig. 3A,B).
Using S58 staining, Barresi et al.
(Barresi et al., 2001
) showed
that slow fibres are added all along the dorsal and ventral margins of the
primary superficial slow fibre layer after 24 hpf. As most of this region is
devoid of smyhc2 and smyhc3
(Fig. 1D; see Fig. S1 in the
supplementary material) it seems probable that these secondary fibres express
smyhc1. To distinguish such fibres from their primary counterparts,
we adopted the BrdU labelling technique used by Barresi et al.
(Barresi et al., 2001
).
Exposure of smyhc1:gfp embryos to BrdU at 18 hpf, resulted in
extensive labelling of fast muscle and external cell nuclei across all dorsal
ventral levels of the myotome at 48 hpf, in accordance with the recent report
of Stellabotte et al. (Stellabotte et al.,
2007
) (Fig. 4A,B).
By contrast, only smyhc1:gfp-positive slow fibres at the dorsal and
ventral margins of the layer of superficial slow fibres were BrdU labelled
(Fig. 4B-D; see Movie 1 in the
supplementary material). Exposure to BrdU at 35 hpf similarly led by 96 hpf to
BrdU-labelled, smyhc1:gfp positive, fibres only at the dorsal and
ventral margins (Fig. 4C,D).
These findings establish that these fibres do indeed express smyhc1.
We refer to these fibres as `secondary superficial slow fibres' to distinguish
them from the series of smyhc2-expressing secondary slow fibres.
smyhc1 and smyhc2 expressing secondary fibres differ in their requirement for Hedgehog signalling
Previous studies have shown that some secondary slow fibres can
differentiate normally in the absence of Hh signalling activity, in contrast
to their primary counterparts (Barresi et
al., 2001
). We investigated the identity of these Hh-independent
fibres using the gene-specific Smyhc probes. Embryos either mutant for the Hh
signal transducer Smoothened (smo) or treated with the Smo antagonist
cyclopamine, have extensive secondary superficial slow fibres at the dorsal
and ventral margins of the posterior trunk and the tail that express
smyhc1 and not smyhc2
(Fig. 5A,C,D). Expression of
smyhc2 in smo mutants is similar to that in wild type;
however, the embryonic lateralis superficialis fibres are absent, as are the
smyhc2-expressing fibres of the tail
(Fig. 5D; see Table S1 in the
supplementary material). This lack of the smyhc2-expressing fibres of
the tail is strikingly similar to the loss of third wave slow muscle reported
for cyclopamine-treated Xenopus embryos
(Grimaldi et al., 2004
). We
treated embryos with cyclopamine from the 20-somite stage to determine whether
zebrafish have a similar requirement for Hh signalling during slow fibre
myogenesis late in embryogenesis. These treated embryos had a normal pattern
of smyhc1:gfp and smyhc2 expression except for the lack of
the tail smyhc2-expressing slow fibres
(Fig. 5E). The posterior tails
of these embryos had a narrower dorsal-ventral extent and lacked any muscle
dorsal or ventral of the smyhc1-expressing layer
(Fig. 5F), suggesting that Hh
signalling is required for the formation of this muscle. This contrasts with
its role in specifying the fibre type of adaxial cells but is strikingly
similar to the generation of third wave slow muscle in Xenopus
(Grimaldi et al., 2004
).
Hedgehog independent smyhc1 expressing secondary superficial slow fibres require prdm1
Using the highly sensitive smyhc1-CDS in situ hybridisation probe,
we have compared the ontogeny of slow twitch muscle fibres in prdm1
mutant, smo mutant and wild-type embryos
(Fig. 6A; we use `Smyhc' to
mean transcripts detected with the smyhc1-CDS probe). Consistent with
the report of Barresi et al. (Barresi et
al., 2001
), we found that in smo mutant embryos, slow
fibres are virtually absent at 24 hpf, but subsequently appear at the dorsal
and ventral margins of the somites at 36 hpf, increasing in number by 48 hpf.
By contrast, in prdm1 mutants at 24 hpf, we found that many fibres
scattered through the myotome show low levels of Smyhc expression, in line
with previous descriptions of the ubo(prdm1)tp39 mutant
phenotype (Roy et al., 2001
).
This Smyhc expression was observed not only in embryos homozygous for the
ubo(prdm1)tp39 mis-sense allele but also in those
homozygous for nrd(prdm1)m805, which has a stop codon at
amino acid 154 and is thus a presumptive null allele
(Hernandez-Lagunas et al.,
2005
) (Fig. 6A).
Notably, a few fibres have a less dramatic reduction in expression and these
tend to be more dorsal and more numerous in posterior somites. By 48 hpf, the
scattered expression of Smyhc throughout the myotome is greatly diminished,
but expression persists in fibres at the dorsal margin. The location of these
latter fibres is similar to that of the secondary superficial slow fibres,
raising the possibility that at least some secondary superficial slow fibres
can form in the absence of prdm1 function. Alternatively, these could
correspond to adaxially derived, primary slow fibres that escape the
requirement for wild-type levels of prdm1 function.
|
|
The craniofacial muscles generally have wild-type levels of expression of
both smyhc1 and smyhc2 in nrd(prdm1)m805
mutants (see Fig. S3B and Table S1 in the supplementary material;
Fig. 6C). The only
perturbations to the craniofacial slow fibres in prdm1 mutants are
associated with the major loss of skeletal elements in the posterior head (see
Fig. S3A in the supplementary material) (see also
Wilm and Solnica-Krezel,
2005
).
prdm1:gfp expression in primary and secondary slow fibres
We next investigated whether prdm1 is expressed in the precursors
of the secondary superficial (smyhc1+ve) slow fibres. Low-level
prdm1 expression can be detected by in situ hybridisation at 35 hpf
in cells tentatively identified as newly forming secondary superficial slow
fibres in smo mutants (Fig.
7A). To characterise this expression further, we took advantage of
the stability of GFP transcript and protein
(Tallafuss and Bally-Cuif,
2003
) to monitor prdm1 expression using
prdm1:gfp reporter lines. The expression of GFP in these lines
(Fig. 7B) recapitulates the
pattern of endogenous prdm1 transcription in adaxial cells
(Baxendale et al., 2004
) but
persists as the cells migrate and differentiate into the superficial layer of
mononucleated slow fibres that covers the mytotome at 24 hpf
(Fig, 7C). As expected, in
smo mutants carrying the prdm1:gfp transgene, no such
labelled fibres are present at 24 hpf (Fig.
7C). At 48 hpf, however, prdm1:gfp-positive fibres are
present at the dorsal and ventral margins of the myotome, locations consistent
with their being secondary superficial slow fibres. Simultaneous staining for
Smyhc or slow troponin C expression confirmed that the
prdm1:gfp-positive fibres are indeed secondary superficial slow
fibres (Fig. 7D). In addition,
we also found that these fibres accumulate Prox1 in their nuclei (although at
lower levels than their primary counterparts)
(Fig. 7E) and lack expression
of the fast muscle F310 antigen (Fig.
7F). Intriguingly, prdm1:gfp is specifically expressed
not only in the smyhc1 expressing slow fibres but also in the slow
fibres of muscles that express smyhc2 and not smyhc1
(Fig. 7G, see also
Fig. 1D,F).
Transformation of secondary superficial slow fibres to a fast twitch character in ubo (prdm1) mutants
We next analysed the fate of primary and secondary superficial slow fibre
precursors in ubo(prdm1)tp39 mutants using the
prdm1:gfp transgene as a lineage marker. At 24 hpf,
prdm1:gfp colocalises with the scattered weakly Smyhc-positive cells
typical of ubo(prdm1)tp39 mutants, indicating that these
are derived from adaxial cells that have failed to migrate properly owing to
the loss of prdm1 function (Fig.
8A). Although by 48 hpf Smyhc expression is lost from all but the
most dorsal fibres, the scattered prdm1:gfp positive cells persist
(Fig. 8A) and differentiate
into fibres that are multinucleate and F310 positive, characteristics that are
typical of fast twitch fibres (Hamade et
al., 2006
; Roy et al.,
2001
) (Fig. 8B,C).
Similarly, even the dorsal fibres in which slow MyHC expression persists are
marked by both prdm1:gfp and the fast muscle F310 antigen
(Fig. 8D) and lack expression
of Prox1 (Glasgow and Tomarev,
1998
) (Fig.
8E).
At 48 hpf, cylopamine-treated transgenic ubo(prdm1)tp39 mutant embryos have the normal complement of prdm1:gfp-positive fibres at the location of the secondary superficial slow fibres in their genetically wild-type siblings. However, unlike those in the latter, these fibres do not express slow MyHC and do express the fast fibre-specific F310 antigen (Fig. 8F).
| DISCUSSION |
|---|
|
|
|---|
|
The evolution of the tandem array genomic structure may have been driven by
transcriptional control constraints. The fact that our 9.7 kb promoter
smyhc1:gfp reporter gene recapitulates the expression of the
endogenous gene, indicates that, for smyhc1 expression, at least, the
adjoining parts of the tandem array are not required in cis for
transcriptional control. The tandem arrangement of mammalian MyHC genes is
constrained by bidirectional expression of MyHC genes and antisense
transcripts required for transcriptional control of adjacent MyHC genes
(Haddad et al., 2003
;
Pandorf et al., 2006
). We do
not know whether such a mechanism exists in zebrafish.
|
There are two additional predicted genes [called myhA and
myhcB by McGuigan et al.
(McGuigan et al., 2004
)] in
the same tandem gene array as the three Smyhc genes we describe here. Although
myhA and myhB are not represented in current EST databases,
we isolated 5'RACE products for two alternative 5'UTRs of
myhA using RNA from 120 hpf embryos. We were unable to detect any
expression in embryos by in situ hybridisation. Possibly, the predicted genes
are expressed principally at later stages of the life cycle or under different
growth conditions.
Prdm1 acts as a transcriptional repressor to drive the differentiation of
adaxial cells into primary slow twitch fibres in response to Hh signalling
(Baxendale et al., 2004
;
von Hofsten et al., 2008
). Our
analysis shows that prdm1 is also required for secondary superficial
slow fibres to adopt a slow twitch character independently of Hh signalling.
How expression of prdm1 is activated in the progenitors of these
secondary superficial slow fibres remains to be determined.
Intriguingly, the specific expression of prdm1:gfp in slow fibres extends beyond the smyhc1-positive fibres and includes the smyhc2-positive fibres for which we could discern no prdm1 requirement. We consider it likely that this prdm1:gfp expression reflects the expression of the endogenous gene, as we have observed it in three independent prdm1:gfp reporter gene lines. It remains possible that prdm1 acts redundantly with some other gene in these fibres or has a subtle role we failed to discern.
|
The origin of the progenitor cells for the various secondary slow fibres
and their relationship to the recently identified, Pax7-positive, secondary
fast muscle progenitors is currently unclear
(Hammond et al., 2007
;
Hollway et al., 2007
;
Stellabotte et al., 2007
). An
additional issue is the mechanism for myogenic induction versus progenitor
maintenance for secondary slow fibres. Hh signalling induces the myogenesis of
primary slow fibres and also of lateral fast fibres in the primary myotome
(Feng et al., 2006
;
Hammond et al., 2007
;
Lewis et al., 1999
). Our data
suggest that Hh signalling is also required for myogenesis of the
smyhc2-expressing slow fibres of the posterior tail. This shows a
striking similarity to third wave slow fibre myogenesis in Xenopus,
suggesting that it is an evolutionarily ancient mechanism
(Grimaldi et al., 2004
).
It is unknown how various slow fibres are specified to express particular
Smyhc genes. This question possibly relates to the more general issue of
muscle identity determination. Muscle identity may be influenced by intrinsic
cues, as well as signalling from other cell types. In zebrafish, anterior
trunk somites have an intrinsic axial identity that enables them to produce
appendicular muscle (Haines et al.,
2004
). Earlier in development, paraxial mesoderm for different
axial levels is specifically determined by different combinations of Nodal,
Bmp and Fgf signals (Szeto and Kimelman,
2006
). Numerous Hox genes are expressed in particular regions of
the paraxial mesoderm (Prince et al.,
1998
). Possibly, certain paraxial mesoderm cells are predisposed
to form certain types of slow fibre by such intrinsic cues. Intrinsic cues may
also influence whether muscle has a fast twitch or slow twitch character
(Nikovits, Jr et al.,
2001
).
|
The different Smyhc genes described here will provide valuable late differentiation markers for experimental studies required to understand the specification of muscle identity.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/12/2115/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abramoff, M. D., Magelhaes, P. J. and Ram, S. J. (2004). Image Processing with ImageJ. Biophotonics Int. 11,36 -42.
Agbulut, O., Noirez, P., Beaumont, F. and Butler-Browne, G. (2003). Myosin heavy chain isoforms in postnatal muscle development of mice. Biol. Cell 95,399 -406.[CrossRef][Medline]
Amemiya, C. T. and Zon, L. I. (1999). Generation of a zebrafish P1 artificial chromosome library. Genomics 58,211 -213.[CrossRef][Medline]
Barresi, M. J., Stickney, H. L. and Devoto, S. H. (2000). The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity. Development 127,2189 -2199.[Abstract]
Barresi, M. J., D'Angelo, J. A., Hernandez, L. P. and Devoto, S. H. (2001). Distinct mechanisms regulate slow-muscle development. Curr. Biol. 11,1432 -1438.[CrossRef][Medline]
Baxendale, S., Davison, C., Muxworthy, C., Wolff, C., Ingham, P. W. and Roy, S. (2004). The B-cell maturation factor Blimp-1 specifies vertebrate slow-twitch muscle fiber identity in response to Hedgehog signaling. Nat. Genet. 36, 88-93.[CrossRef][Medline]
Bottinelli, R. (2001). Functional heterogeneity of mammalian single muscle fibres: do myosin isoforms tell the whole story? Pflugers Arch. 443,6 -17.[CrossRef][Medline]
Braissant, O. and Wahli, W. (1998). A simplified in situ hybridization protocol using non-radioactively labeled probes to detect abundant and rare mRNAs on tissue sections. Biochemica 1,10 -16.[Medline]
Bryson-Richardson, R. J., Daggett, D. F., Cortes, F., Neyt, C., Keenan, D. G. and Currie, P. D. (2005). Myosin heavy chain expression in zebrafish and slow muscle composition. Dev. Dyn. 233,1018 -1022.[CrossRef][Medline]
Buckingham, M. (2007). Skeletal muscle progenitor cells and the role of Pax genes. C. R. Biol. 330,530 -533.[CrossRef][Medline]
Buller, A. J., Eccles, J. C. and Eccles, R. M.
(1960). Interactions between motoneurones and muscles in respect
of the characteristic speeds of their responses. J.
Physiol. 150,417
-439.
Buller, A. J., Mommaerts, W. F. and Seraydarian, K.
(1969). Enzymic properties of myosin in fast and slow twitch
muscles of the cat following cross-innervation. J.
Physiol. 205,581
-597.
Carvajal, J. J., Cox, D., Summerbell, D. and Rigby, P. W. (2001). A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development 128,1857 -1868.[Abstract]
Chen, Q., Moore, L. A., Wick, M. and Bandman, E. (1997). Identification of a genomic locus containing three slow myosin heavy chain genes in the chicken. Biochim. Biophys. Acta 1353,148 -156.[Medline]
Chen, W., Burgess, S. and Hopkins, N. (2001). Analysis of the zebrafish smoothened mutant reveals conserved and divergent functions of hedgehog activity. Development 128,2385 -2396.[Medline]
Cope, M. J., Whisstock, J., Rayment, I. and Kendrick-Jones, J. (1996). Conservation within the myosin motor domain: implications for structure and function. Structure 4, 969-987.[Medline]
Crow, M. T. and Stockdale, F. E. (1986). Myosin expression and specialization among the earliest muscle fibers of the developing avian limb. Dev. Biol. 113,238 -254.[CrossRef][Medline]
Devoto, S. H., Melancon, E., Eisen, J. S. and Westerfield, M. (1996). Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122,3371 -3380.[Abstract]
Feng, X., Adiarte, E. G. and Devoto, S. H. (2006). Hedgehog acts directly on the zebrafish dermomyotome to promote myogenic differentiation. Dev. Biol. 300,736 -746.[CrossRef][Medline]
Glasgow, E. and Tomarev, S. I. (1998). Restricted expression of the homeobox gene prox 1 in developing zebrafish. Mech. Dev. 76,175 -178.[CrossRef][Medline]
Grimaldi, A., Tettamanti, G., Martin, B. L., Gaffield, W.,
Pownall, M. E. and Hughes, S. M. (2004). Hedgehog regulation
of superficial slow muscle fibres in Xenopus and the evolution of tetrapod
trunk myogenesis. Development
131,3249
-3262.
Hadchouel, J., Carvajal, J. J., Daubas, P., Bajard, L., Chang,
T., Rocancourt, D., Cox, D., Summerbell, D., Tajbakhsh, S., Rigby, P. W. et
al. (2003). Analysis of a key regulatory region upstream of
the Myf5 gene reveals multiple phases of myogenesis, orchestrated at each site
by a combination of elements dispersed throughout the locus.
Development 130,3415
-3426.
Haddad, F., Bodell, P. W., Qin, A. X., Giger, J. M. and Baldwin,
K. M. (2003). Role of antisense RNA in coordinating cardiac
myosin heavy chain gene switching. J. Biol. Chem.
278,37132
-37138.
Haines, L., Neyt, C., Gautier, P., Keenan, D. G.,
Bryson-Richardson, R. J., Hollway, G. E., Cole, N. J. and Currie, P. D.
(2004). Met and Hgf signaling controls hypaxial muscle and
lateral line development in the zebrafish. Development
131,4857
-4869.
Hamade, A., Deries, M., Begemann, G., Bally-Cuif, L., Genet, C., Sabatier, F., Bonnieu, A. and Cousin, X. (2006). Retinoic acid activates myogenesis in vivo through Fgf8 signalling. Dev. Biol. 289,127 -140.[CrossRef][Medline]
Hammond, C. L., Hinits, Y., Osborn, D. P., Minchin, J. E., Tettamanti, G. and Hughes, S. M. (2007). Signals and myogenic regulatory factors restrict pax3 and pax7 expression to dermomyotome-like tissue in zebrafish. Dev. Biol. 302,504 -521.[CrossRef][Medline]
Hatta, K., Schilling, T. F., BreMiller, R. A. and Kimmel, C.
B. (1990). Specification of jaw muscle identity in zebrafish:
correlation with engrailed-homeoprotein expression.
Science 250,802
-805.
Hernandez, L. P., Patterson, S. E. and Devoto, S. H. (2005). The development of muscle fiber type identity in zebrafish cranial muscles. Anat. Embryol. 209,323 -334.[CrossRef][Medline]
Hernandez-Lagunas, L., Choi, I. F., Kaji, T., Simpson, P., Hershey, C., Zhou, Y., Zon, L., Mercola, M. and Artinger, K. B. (2005). Zebrafish narrowminded disrupts the transcription factor prdm1 and is required for neural crest and sensory neuron specification. Dev. Biol. 278,347 -357.[CrossRef][Medline]
Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y. and Eguchi, G. (1997). High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin. Dev. Biol. 192,289 -299.[CrossRef][Medline]
Hirsinger, E., Stellabotte, F., Devoto, S. H. and Westerfield, M. (2004). Hedgehog signaling is required for commitment but not initial induction of slow muscle precursors. Dev. Biol. 275,143 -157.[CrossRef][Medline]
Hollway, G. E., Bryson-Richardson, R. J., Berger, S., Cole, N. J., Hall, T. E. and Currie, P. D. (2007). Whole-somite rotation generates muscle progenitor cell compartments in the developing zebrafish embryo. Dev. Cell 12,207 -219.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the Zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Korfage, J. A., Koolstra, J. H., Langenbach, G. E. and van
Eijden, T. M. (2005a). Fiber-type composition of the human
jaw muscles-(part 1) origin and functional significance of fiber-type
diversity. J. Dent. Res.
84,774
-783.
Korfage, J. A., Koolstra, J. H., Langenbach, G. E. and van
Eijden, T. M. (2005b). Fiber-type composition of the human
jaw muscles-(part 2) role of hybrid fibers and factors responsible for
inter-individual variation. J. Dent. Res.
84,784
-793.
Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A. and Copeland, N. G. (2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73,56 -65.[CrossRef][Medline]
Lewis, K. E., Currie, P. D., Roy, S., Schauerte, H., Haffter, P. and Ingham, P. W. (1999). Control of muscle cell-type specification in the zebrafish embryo by Hedgehog signalling. Dev. Biol. 216,469 -480.[CrossRef][Medline]
Liang, C. S., Kobiyama, A., Shimizu, A., Sasaki, T., Asakawa,
S., Shimizu, N. and Watabe, S. (2007). Fast skeletal muscle
myosin heavy chain gene cluster of medaka Oryzias latipes enrolled in
temperature adaptation. Physiol. Genomics
29,201
-214.
Lompre, A. M., Nadal-Ginard, B. and Mahdavi, V.
(1984). Expression of the cardiac ventricular alpha- and
beta-myosin heavy chain genes is developmentally and hormonally regulated.
J. Biol. Chem. 259,6437
-6446.
Mahdavi, V., Chambers, A. P. and Nadal-Ginard, B.
(1984). Cardiac alpha- and beta-myosin heavy chain genes are
organized in tandem. Proc. Natl. Acad. Sci. USA
81,2626
-2630.
McGuigan, K., Phillips, P. C. and Postlethwait, J. H.
(2004). Evolution of sarcomeric myosin heavy chain genes:
evidence from fish. Mol. Biol. Evol.
21,1042
-1056.
Murphy, C. T. and Spudich, J. A. (2000). Variable surface loops and myosin activity: accessories to a motor. J. Muscle Res. Cell Motil. 21,139 -151.[CrossRef][Medline]
Nakano, Y., Kim, R., Kawakami, A., Roy, S., Schier, A. F. and Ingham, P. W. (2004). Inactivation of dispatched 1 by the chameleon mutation disrupts Hedgehog signalling in the zebrafish embryo. Dev. Biol. 269,381 -392.[CrossRef][Medline]
Nihei, Y., Kobiyama, A., Ikeda, D., Ono, Y., Ohara, S., Cole, N.
J., Johnston, I. A. and Watabe, S. (2006). Molecular cloning
and mRNA expression analysis of carp embryonic, slow and cardiac myosin heavy
chain isoforms. J. Exp. Biol.
209,188
-198.
Nikovits, W., Jr, Cann, G. M., Huang, R., Christ, B. and
Stockdale, F. E. (2001). Patterning of fast and slow fibers
within embryonic muscles is established independently of signals from the
surrounding mesenchyme. Development
128,2537
-2544.
Noden, D. M. and Francis-West, P. (2006). The differentiation and morphogenesis of craniofacial muscles. Dev. Dyn. 235,1194 -1218.[CrossRef][Medline]
Ono, Y., Liang, C., Ikeda, D. and Watabe, S. (2006). cDNA cloning of myosin heavy chain genes from medaka Oryzias latipes embryos and larvae and their expression patterns during development. Dev. Dyn. 235,3092 -3101.[CrossRef][Medline]
Page, S., Miller, J. B., DiMario, J. X., Hager, E. J., Moser, A. and Stockdale, F. E. (1992). Developmentally regulated expression of three slow isoforms of myosin heavy chain: diversity among the first fibers to form in avian muscle. Dev. Biol. 154,118 -128.[CrossRef][Medline]
Pandorf, C. E., Haddad, F., Roy, R. R., Qin, A. X., Edgerton, V.
R. and Baldwin, K. M. (2006). Dynamics of myosin heavy chain
gene regulation in slow skeletal muscle: role of natural antisense RNA.
J. Biol. Chem. 281,38330
-38342.
Park, H. C. and Appel, B. (2003). Delta-Notch
signaling regulates oligodendrocyte specification.
Development 130,3747
-3755.
Pownall, M. E., Gustafsson, M. K. and Emerson, C. P., Jr (2002). Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu. Rev. Cell Dev. Biol. 18,747 -783.[CrossRef][Medline]
Prince, V. E., Joly, L., Ekker, M. and Ho, R. K. (1998). Zebrafish hox genes: genomic organization and modified colinear expression patterns in the trunk. Development 125,407 -420.[Abstract]
Rauch, G. J., Lyons, D. A., Middendorf, I., Friedlander, B., Arana, N., Reyes, T. and Talbot, W. S. (2003). Submission and curation of gene expression data. ZFIN Direct Data Submission, http://zfin.org.
Rose, T. M., Schultz, E. R., Henikoff, J. G., Pietrokovski, S.,
McCallum, C. M. and Henikoff, S. (1998). Consensus-degenerate
hybrid oligonucleotide primers for amplification of distantly related
sequences. Nucleic Acids Res.
26,1628
-1635.
Roy, S., Wolff, C. and Ingham, P. W. (2001).
The u-boot mutation identifies a Hedgehog-regulated myogenic switch for
fiber-type diversification in the zebrafish embryo. Genes
Dev. 15,1563
-1576.
Sacks, L. D., Cann, G. M., Nikovits, W., Jr, Conlon, S.,
Espinoza, N. R. and Stockdale, F. E. (2003). Regulation of
myosin expression during myotome formation.
Development 130,3391
-3402.
Schilling, T. F. and Kimmel, C. B. (1997). Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo. Development 124,2945 -2960.[Abstract]
Serbedzija, G. N., Chen, J. N. and Fishman, M. C. (1998). Regulation in the heart field of zebrafish. Development 125,1095 -1101.[Abstract]
Shi, X. and Garry, D. J. (2006). Muscle stem
cells in development, regeneration, and disease. Genes
Dev. 20,1692
-1708.
Shrager, J. B., Desjardins, P. R., Burkman, J. M., Konig, S. K., Stewart, S. K., Su, L., Shah, M. C., Bricklin, E., Tewari, M., Hoffman, R. et al. (2000). Human skeletal myosin heavy chain genes are tightly linked in the order embryonic-IIa-IId/x-ILb-perinatal-extraocular. J. Muscle Res. Cell Motil. 21,345 -355.[CrossRef][Medline]
Stellabotte, F., Dobbs-McAuliffe, B., Fernandez, D. A., Feng, X.
and Devoto, S. H. (2007). Dynamic somite cell rearrangements
lead to distinct waves of myotome growth. Development
134,1253
-1257.
Stiassny, M. (2000). Muscular system. In The Laboratory Fish (ed. G. K. Ostrander), pp.109 -128. New York: Academic Press.
Szeto, D. P. and Kimelman, D. (2006). The
regulation of mesodermal progenitor cell commitment to somitogenesis
subdivides the zebrafish body musculature into distinct domains.
Genes Dev. 20,1923
-1932.
Tallafuss, A. and Bally-Cuif, L. (2003).
Tracing of her5 progeny in zebrafish transgenics reveals the dynamics of
midbrain-hindbrain neurogenesis and maintenance.
Development 130,4307
-4323.
Thisse, B., Pflumio, S., Fürthauer, M., Loppin, B., Heyer, V., Degrave, A., Woehl, R., Lux, A., Steffan, T., Charbonnier, X. Q. and Thisse, C. (2001). Expression of the zebrafish genome during embryogenesis. ZFIN Direct Data Submission, http://zfin.org.
Thisse, C. and Thisse, B. (1998). High resolution whole-mount in situ hybridization. Zebrafish Sci. Monit. 5.
van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al. (1996). Mutations affecting somite formation and patterning in the zebrafish, Danio rerio. Development 123,153 -164.[Abstract]
van Raamsdonk, W., Pool, C. W. and te Kronnie, G. (1978). Differentiation of muscle fiber types in the teleost Brachydanio rerio. Anat. Embryol. 153,137 -155.[CrossRef][Medline]
Varga, Z. M., Amores, A., Lewis, K. E., Yan, Y. L., Postlethwait, J. H., Eisen, J. S. and Westerfield, M. (2001). Zebrafish smoothened functions in ventral neural tube specification and axon tract formation. Development 128,3497 -3509.[Medline]
von Hofsten, J., Elworthy, S., Gilchrist, M. J., Smith, J. C., Wardle, F. C. and Ingham, P. W. (2008). Prdm1 and Sox6 mediated transcriptional repression specifies muscle fibre type in the zebrafish embryo. EMBO Rep. (in press).
Weiss, A., McDonough, D., Wertman, B., Acakpo-Satchivi, L.,
Montgomery, K., Kucherlapati, R., Leinwand, L. and Krauter, K.
(1999). Organization of human and mouse skeletal myosin heavy
chain gene clusters is highly conserved. Proc. Natl. Acad. Sci.
USA 96,2958
-2963.
Weiss, S., Rossi, R., Pellegrino, M. A., Bottinelli, R. and
Geeves, M. A. (2001). Differing ADP release rates from myosin
heavy chain isoforms define the shortening velocity of skeletal muscle fibers.
J. Biol. Chem. 276,45902
-45908.
Westerfield, M. (1995). The Zebrafish Book (2nd edn). Oregon: University of Oregon Press.
Wilm, T. P. and Solnica-Krezel, L. (2005).
Essential roles of a zebrafish prdm1/blimp1 homolog in embryo patterning and
organogenesis. Development
132,393
-404.
Winterbottom, R. (1974). A descriptive synonymy of the striated muscles of the Teleostei. Proc. Acad. Nat. Sci. Philadelphia 125,225 -317.
Wolff, C., Roy, S. and Ingham, P. W. (2003). Multiple muscle cell identities induced by distinct levels and timing of Hedgehog activity in the zebrafish embryo. Curr. Biol. 13,1169 -1181.[CrossRef][Medline]
Xu, J., Srinivas, B. P., Tay, S. Y., Mak, A., Yu, X., Lee, S.
G., Yang, H., Govindarajan, K. R., Leong, B., Bourque, G. et al.
(2006). Genomewide expression profiling in the zebrafish embryo
identifies target genes regulated by Hedgehog signaling during vertebrate
development. Genetics
174,735
-752.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||