|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 28 May 2008
doi: 10.1242/dev.019547
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 The Rockefeller University, Laboratory of Developmental Genetics, 1230 York
Avenue, New York, NY 10065, USA.
2 Department of Genome Sciences, University of Washington, Seattle, WA 98195,
USA.
3 Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle,
WA 98105, USA.
* Author for correspondence (e-mail: shaham{at}rockefeller.edu)
Accepted 12 May 2008
| SUMMARY |
|---|
|
|
|---|
Key words: C. elegans, Glia, hlh-17, mls-2, Oligodendrocytes, vab-3
| INTRODUCTION |
|---|
|
|
|---|
Despite burgeoning interest in glia and their functions, technical challenges in understanding their effects on neuronal activity and development remain. Importantly, because of their neurotrophic functions, glia manipulation often leads to neuronal death, preventing the study of glial contributions to other neuronal activities. Identification of systems in which glia are not required for neuronal viability could allow unprecedented access to understanding glial influences on neurons.
The Caenorhabditis elegans hermaphrodite contains 50 glial cells
associated with sensory organs of the animal
(Heiman and Shaham, 2007
;
Shaham, 2006
). Although the
morphology and anatomy of these glia have been characterized
(Ward et al., 1975
;
White et al., 1986
), their
functions are not well understood. Of these glia, four cephalic sheath (CEPsh)
glia, which associate with CEP dopaminergic sensory dendrites
(Fig. 1A), also send sheet-like
processes that envelop the nerve ring, a neuropil generally viewed as the
animal's brain (Fig. 1B,C).
Roles for CEPsh glia in synaptogenesis have been suggested
(Colón-Ramos et al.,
2007
).
Here we show that C. elegans CEPsh glia are not required for neuronal survival, enabling in vivo studies of their influences on neuronal development. We show that ventral and dorsal CEPsh glia develop through molecularly distinguishable pathways regulated by the Nkx/Hmx-related gene mls-2 and the Pax6/7-related gene vab-3, respectively. These genes regulate glial expression of the C. elegans Olig1/2-related gene hlh-17. Using mls-2 mutants, vab-3 mutants, and cell ablations, we describe roles for CEPsh glia in dendrite extension and axon branching/guidance, showing that these latter functions are mediated by UNC-6/Netrin.
Our results suggest that C. elegans might provide a novel setting for exploring in vivo aspects of glial cell development and glia-neuron interactions.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The following extrachromosomal arrays were used: nsEx646 [hlh-17::myrGFP + lin15(+)], nsEx725 [hlh-31 promoter::RFP + lin15(+)], nsEx729 [hlh-32 promoter::RFP + lin15(+)], nsEx1420 [C39E6 + rol-6 (su1006)], nsEx1419 [mls-2 promoter::mls-2 + rol-6 (su1006)], nsEx1404 [F14F3 + rol-6 (su1006)], nsEx1463 [heat-shock promoter::mls-2 + rol-6 (su1006)], nsEx1464 [heat-shock promoter::vab-3 + rol-6 (su1006)], nsEx1577 [mls-2 promoter::vab-3::mls-2::mls-2 3' UTR + rol-6 (su1006)], nsEx1717 [C39E6 + nhr-38::GFP + elt-2::GFP].
Mutagenesis and mapping
hlh-17::GFP animals were mutagenized with 30 mM ethyl
methanesulfonate (Sulston and Hodgkin,
1988
) and plated on 9-cm NGM agar plates. F1 adults were
individually plated on 1600 plates and F2 progeny were screened for CEPsh glia
defects. Mutants were mapped by crossing to strain CB4856, followed by
isolation of homozygous mutant animals and SNP genotyping
(Wicks et al., 2001
).
Plasmid constructs
hlh-31 promoter::RFP
We amplified by PCR a 1.5 kb DNA fragment from cosmid F38C2 containing 1.2
kb sequences upstream of the hlh-31 first ATG as well as the coding
sequence for the first 32 amino acids. The amplicon was ligated to the RFP
gene digested with SphI and BamHI. No expression was
detected for hlh-31.
hlh-32 promoter::RFP
We amplified a 3 kb DNA fragment upstream of the hlh-32 ATG from
the YAC Y105C5. The amplicon was ligated to the RFP gene digested with
SphI and BamHI. The hlh-32 transgene was expressed
in two unidentified neurons in the head.
hlh-17::GFP
To define an hlh-17 promoter element, we sequenced hlh-17
cDNAs and identified some containing the SL1 trans-spliced leader
(Krause and Hirsh, 1987
),
enabling identification of a putative ATG. To generate the reporter we
amplified a 2.7 kb DNA fragment from cosmid F38C2 containing 1.9 kb of
sequences upstream of the hlh-17 ATG and sequences encoding the first
58 amino acids. The 1.9 kb promoter fragment included a 96 bp segment
immediately upstream of the ATG. This segment was not present in a transgene
previously described (Fig. 1E)
(McMiller and Johnson, 2005
).
The amplicon was ligated to pPD95.69
(Miller et al., 1999
) digested
with SphI and BamHI.
hlh-17::myrGFP
We amplified a 4 kb DNA fragment from cosmid F38C2 containing sequences
upstream of the hlh-17 ATG. The amplicon was ligated to the myrGFP
gene (Adler et al., 2006
)
digested with SphI and BamHI.
ptr-10::myrRFP
We amplified a 300 bp DNA fragment from cosmid F55F8 containing genomic
sequence upstream of the ptr-10 ATG. The amplicon was ligated to the
myrRFP gene (Adler et al.,
2006
) digested with SphI and XmaI.
mls-2 promoter::GFP::mls-2::mls-2 3' UTR
See Jiang et al. (Jiang et al.,
2005
).
mls-2 promoter::vab-3::mls-2::mls-2 3' UTR
vab-3 isoform A cDNA was digested with SalI and ligated
into the mls-2 promoter::GFP::mls-2::mls-2 3'
UTR construct digested with SalI, replacing GFP with
vab-3.
Heat-shock promoter::mls-2/vab-3
mls-2/vab-3 isoform A cDNAs were digested with
AgeI and EcoRI and ligated into the same sites of vector
pPD95.75 (Miller et al.,
1999
). The heat-shock promoter was amplified from vector pPD49.78
(Fire et al., 1990
), digested
with SphI and BamHI, and ligated into the same sites as the
cDNA vectors.
8.3 kb C39E6 subclone
We amplified an 8.3 kb DNA fragment from cosmid C39E6 containing 5.5 kb of
sequences upstream of the mls-2 ATG, the mls-2 coding
sequence, and 300 bp downstream of the mls-2 stop codon. The amplicon
was digested with PstI and EcoRI and ligated into the same
sites of pPD95.75.
Transgenic strains
Germline transformations were carried out as published
(Mello and Fire, 1995
).
hlh-17::GFP (50 ng/µl) and ttx-1::RFP (3 ng/µl) were
injected into N2 animals. ptr-10::myrRFP (50 ng/µl) was injected
into lin-15(n765) animals with plasmid pJM23 (20 ng/µl)
containing lin-15 (Huang et al.,
1994
). Extrachromosomal transgenes were integrated using
4,5',8-trimethylpsoralen followed by insertion homozygote identification
(Yandell et al., 1994
).
For mls-2 rescue experiments, cosmid C39E6 and its 8.3 kb subclone
were injected into mls-2(ns156) animals (1 ng/µl). For
vab-3 rescue experiments, cosmid F14F3 or a 24 kb
AscI-PmeI subclone were injected into
vab-3(ns157) animals (1 ng/µl). The mls-2
promoter::vab-3::mls-2::mls-2 3' UTR
construct was injected into N2 animals with plasmid pRF4 (40 ng/µl)
containing the dominant marker rol-6 (su1006)
(Mello et al., 1991
) (20
ng/µl). Other reporter constructs were injected into animals at 30-50
ng/µl with either pRF4, pJM23 or elt-2::GFP
(Fukushige et al., 1998
) as
transformation markers (30-40 ng/µl).
Ablations
Strains used for ablation contained either hlh-17::GFP or
ptr-10::myrRFP together with a neuronal marker to facilitate scoring
of CEPsh glia fate and axonal defects. In some cases, ablated strains
contained unc-119::GFP (Maduro
and Pilgrim, 1995
). Precursor cells of CEPsh glia were ablated in
embryos at the 250-300 minute stage in a drop of S-basal buffer on 5% agar
pads using a micropoint laser set up
(Bargmann and Avery, 1995
).
These cells were identified by following the cell division patterns of embryos
(Sulston et al., 1983
).
Ablations were scored as successful if CEPsh glia were absent 2 days
later.
Isolation of deletion mutants
Deletion alleles were isolated using published methods (Jansen et al.,
1997; Hess et al., 2004). The following primer pairs (5' to 3')
were used for screening: hlh-17: poison primer,
GCATGACTTAAACGAGGCACTTGACG; outer primers, ATGGGGTCCCTGGGGACTC and
CCGATTTCCGCTTCAACTGGGAG; inner primers, TCCCTGGGGACTCTCCTCG and
CGATTTTTGCTGCTAATGGGCAACAC. hlh-31: poison primer,
GCATGACTTAAACGAGGCACTTGACG; outer primers, CAGTCCGGATGGAATGAACAAAAGGG and
CTACATGGTCGCT TGATGGCTTCAC; inner primers, TTGCAGCCAACTCAAAGTTGGGTC and
GGGAGACCAATACACTGAGCTCC. hlh-32: poison primer,
GCATGACTTAAACGAGGCACTTGACG; outer primers, GCCTCTGGTAGTCTACGGC and
CTAATCTCCTTCGGATGGTGTTGACACGG; inner primers, GCTTCCGTTTTTGGGAAACAAGAG and
CTTAGCTCTTCGATTGCTTTTGCCTG.
cDNA isolation
cDNAs for hlh-17, hlh-31, hlh-32, mls-2 and vab-3 were
isolated by amplification using PCR of a plasmid-based cDNA library
(Schumacher et al., 2005) using primers within the vector and within the
genes.
Mosaic analyses
C39E6, nhr-38::GFP and elt-2::GFP were co-injected at 1
ng/µl, 50 ng/µl and 20 ng/µl, respectively, into a strain of genotype
nsIs105 (hlh-17::GFP); nsIs145
(ttx-1::RFP); mls-2(ns156). Animals harboring the
extrachromosomal array were selected using elt-2::GFP expression
under a fluorescence dissecting microscope, mounted for observation on a
compound microscope in M9 medium, and assessed for appearance of
hlh-17::GFP and nhr-38::GFP expression in the ventral CEPsh
glia and AFD neurons, respectively. Similar studies were performed for
vab-3 mosaic studies, except that the vab-3 cosmid, F14F3,
was injected together with ptr-10::myrRFP into
vab-3(ns157) mutants carrying an integrated
hlh-17::GFP reporter, and animals lacking hlh-17::GFP
expression in subsets of CEPsh glia were examined.
For the unc-6 mosaic studies, we used an elt-2::GFP
reporter (Fukushige et al.,
1998
) to follow transgenic animals.
Microscopy
Animals were examined by epifluorescence using either a fluorescence
dissecting microscope (Leica), an Axioplan II compound microscope (Zeiss), or
a spinning disc confocal microscope (Zeiss) equipped with a Perkin-Elmer
UltraView spinning disk confocal head. For the compound microscope, images
were captured using an AxioCam CCD camera (Zeiss) and analyzed using the
Axiovision software (Zeiss). For the spinning disk confocal microscope, images
were captured using an EMCCD (C9100-12) gain camera (Hamamatsu) and analyzed
using MetaMorph software (UIC). Electron microscopy was carried out on serial
sections as previously described (Perens
and Shaham, 2005
).
Heat-shock studies
Heat-shock constructs were injected at 20 ng/µl with pRF4 (40 ng/µl)
as the transformation marker. Animals were placed at 34°C for 30 minutes,
allowed to recover at 20°C, and scored for induction of reporters 60-150
minutes later.
Southern hybridizations
Preparation of genomic DNA, agarose gel electrophoresis and Southern
blotting were performed using standard techniques (Ausubel et al., 1989).
Probes were prepared from hlh-17 cDNA by PCR.
Lineage analysis
Lineage tracing was performed essentially as described by Murray et al.
(Murray et al., 2006). Three-dimensional time-lapse image series were
collected for wild-type (n=2), mls-2(ns156)
(n=4) and vab-3(ns157) (n=4) embryos
carrying a nuclear-localized his-72::H3.3-GFP reporter using a Zeiss
LSM510 confocal microscope. We used StarryNite
(Bao et al., 2006
) to
automatically trace the lineage from the images, and AceTree (Boyle et al.,
2006) to identify and edit errors in the StarryNite annotations. Lineages were
followed through the 350-cell stage and the CEPsh-producing lineages (ABarpa,
ABplpaa, ABprpaa) selectively traced through the birth of the CEPsh glia.
Because StarryNite makes significantly more errors at and beyond the 350-cell
stage than it does at earlier stages, we followed each cell by eye in each
lineage throughout its lifespan and corrected all errors. Tree displays and 3D
projections were generated in AceTree.
| RESULTS |
|---|
|
|
|---|
As a second approach to identify CEPsh glia reporters, we turned to our
previous studies demonstrating that DAF-6 protein, which is related to the
Hedgehog receptor Patched, is expressed in glia of amphid and phasmid sensory
organs (Perens and Shaham,
2005
). C. elegans encodes 24 Patched-related proteins
(Kuwabara and Labouesse, 2002
;
Kuwabara et al., 2000
) and we
hypothesized that some might be expressed in CEPsh glia. We found that a
myristoylated RFP, under the control of a 300 bp ptr-10 promoter
fragment, was expressed in CEPsh glia (Fig.
1G,H) and in sheath and socket glia of inner and outer labial
sensilla, and of the deirid (see Fig. S1G-L in the supplementary
material).
CEPsh glia are important for CEP neuron dendrite extension
The availability of CEPsh glia reporters allowed us to explore the
functions of these cells during nervous system development. For example, the
association of CEPsh glial processes with CEP neuron dendritic processes
(Fig. 1A) suggests that
blocking CEPsh glia formation might result in CEP dendritic defects. To test
this, we ablated direct precursors of CEPsh glia in animals carrying either
hlh-17::GFP or ptr-10::myrRFP reporters using a laser
microbeam, confirming ablations by the absence of reporter expression.
Importantly, we never observed neuronal death following ablations: 205/206
operated animals examined in the studies described in this paper showed normal
neuronal marker expression.
We found that 4/4 animals in which the ventral left CEPsh glia precursor,
ABplpaaapap, was ablated, had shortened ventral left CEP neuron dendrites, as
assessed by expression of the CEP neuron reporter dat-1::GFP
(Nass et al., 2005
).
Similarly, 4/4 animals in which the dorsal left CEPsh glia precursor,
ABarpaaaapp, was ablated, displayed shortened dorsal left CEP dendrites
(Fig. 2), suggesting that CEPsh
glia are important for CEP neuron dendrite extension.
CEPsh glia also control axon guidance and branching in the nerve ring
CEPsh glia also associate with the nerve ring and ventral ganglion
(Fig. 1A-C). Thus, we surmised
that eliminating CEPsh glia might, in addition to perturbing dendrite
extension, affect nerve ring axon outgrowth [a similar hypothesis was proposed
by Wadsworth et al. (Wadsworth et al.,
1996
)].
The axons of the AWC, AFD and ADF sensory neurons enter the nerve ring
through the ventral ganglion (White et
al., 1986
). To assess the effects of CEPsh glia on the development
of these axons, we ablated ventral CEPsh glia precursors in animals carrying
the reporters odr-1::RFP [AWC
(L'Etoile and Bargmann 2000
)],
ttx-1::DsRed [AFD (Satterlee et
al., 2001
)] or T08G3.3::RFP [ADF
(Sagasti et al., 1999
)].
Whereas the axon shapes and lengths of the three neurons are highly regular in
wild-type animals, we observed multiple defects in these neurites in operated
animals, ranging from a lack of ventrally directed processes to abnormal
branching. Major defect classes are depicted in
Fig. 3A-H. Defects were more
pronounced for AWC and AFD axons than for ADF axons
(Fig. 3I). Guidance and
branching defects of these neurons were generally observed when ventral, but
not dorsal, CEPsh glia precursors were ablated
(Fig. 3I).
Taken together, these studies demonstrate that CEPsh glia play spatially restricted roles in axon guidance within the nerve ring. Importantly, these guidance roles appear to be neuron specific.
One explanation for the differential effects of ventral CEPsh glia on
different axons is that at certain points within the nerve ring and ventral
ganglion, some axons are closer to ventral CEPsh glia processes than others.
To determine whether such regions of the nerve ring exist, we examined
previous electron microscopy (EM) reconstructions of the nerve ring
(White et al., 1986
). Indeed,
axons of the AWC and AFD neurons are situated adjacent to CEPsh glia processes
at two different locations along their lengths, on the outer surfaces of the
nerve ring and ventral ganglion (see Fig. S2 in the supplementary material).
By contrast, ADF axons are distal to CEPsh glia processes. These observations
suggest that short-range signals from CEPsh glia to specific axons might
determine axon guidance and branching decisions.
|
To determine in which cells unc-6 functions for AWC axon guidance,
we generated unc-6(ev400) animals containing an integrated
AWC reporter and an unstable extrachromosomal array consisting of
hlh-17::GFP and plasmid
pSM containing a rescuing
unc-6 gene (Colón-Ramos et
al., 2007
). Twenty-four out of 25 animals expressing
hlh-17::GFP in ventral CEPsh glia had normal axon outgrowth. By
contrast, 12/23 animals expressing hlh-17::GFP in dorsal but not
ventral CEPsh glia had normal axon outgrowth, similar to animals lacking
unc-6. These results, together with the unc-6 expression
pattern, strongly suggest that UNC-6 functions within ventral CEPsh glia to
control AWC axon guidance.
CEPsh glia may control nerve ring assembly
During our ablation studies, we noticed that 17/91 animals in which ventral
CEPsh glia were ablated arrested development in the L1 larval stage. L1 arrest
was not observed in mock-ablated animals and was rarely seen when cells near
the CEPsh precursors were ablated (1/26 ablated animals). AWC, AFD and ADF
neurons in arrested larvae displayed severe defects in axon projections,
suggesting global defects in nerve ring assembly. To examine the integrity of
the nerve ring in ablated animals, we ablated ventral CEPsh glia precursors in
animals carrying the unc-119::GFP pan-neuronal reporter. Six out of
30 animals examined exhibited L1 arrest, highly disorganized nerve rings and
anteriorly displaced neuronal cell bodies
(Fig. 3R-U). The incomplete
penetrance of these defects might reflect functions of the remaining dorsal
CEPsh cells, which could not be reliably ablated in animals operated
ventrally, and/or neuron-intrinsic cues allowing self-assembly. The early
onset of nerve ring defects suggests problems with assembly and not
maintenance of the structure. Consistent with this notion, ablation of all
CEPsh glia in L1 animals does not affect nerve ring structure or axon guidance
in adults (n=120; M. Katz, S.Y. and S.S., unpublished).
|
The development of ventral and dorsal CEPsh glia are molecularly distinguishable
To understand the molecular basis of CEPsh glia development, we sought to
identify mutants with defects similar to those of CEPsh glia-ablated animals.
We mutagenized animals carrying an integrated hlh-17::GFP reporter
and scanned F2 progeny for alterations in reporter expression.
Four mutants we isolated form two complementation groups consisting of the three alleles ns156, ns158, ns159, and the single allele ns157, and had reciprocal effects on ventral and dorsal CEPsh glia development (Fig. 1F-N). As shown in Fig. 4, most ns156 (as well as ns158 and ns159) animals lacked expression of hlh-17::GFP and ptr-10::myrRFP in ventral CEPsh glia, whereas reporter expression was usually maintained in dorsal CEPsh glia. Reciprocally, most ns157 animals lacked hlh-17::GFP and ptr-10::myrRFP expression in dorsal CEPsh glia, whereas nearly half expressed these reporters in ventral CEPsh glia. Expression of reporter genes in at least some cells other than the CEPsh glia was essentially unaffected in these mutants (data not shown). Although defects in reporter transgene expression could be found in all CEPsh glia, the dorsal/ventral bias in these defects demonstrates that despite morphological similarities, the development of dorsal and ventral CEPsh glia are molecularly distinguishable.
CEPsh glia are abnormal in ns156 and ns157 mutants
The absence of reporter transgene expression in ns156 and
ns157 mutants could reflect defects in either CEPsh glia fate
specification or generation. To distinguish between these possibilities, we
used automated 4D lineage tracking (Bao et
al., 2006
) to follow cell divisions leading to CEPsh glia
generation in ns156 and ns157 mutants. In 4/4 ns156
and 4/4 ns157 animals examined, all CEPsh glia were generated (see
Fig. S3 in the supplementary material) and were properly positioned, with the
exception of a single anteriorly displaced dorsal CEPsh cell in one
ns156 embryo. These results suggest that the ns156 and
ns157 mutations do not block CEPsh glia generation and that CEPsh
glia precursors are grossly normal. Thus, these mutations probably disrupt
CEPsh glia terminal differentiation or fate specification.
To determine whether CEPsh glia features other than reporter expression were perturbed in these mutants, we used EM to examine whether CEPsh glia ensheathed the nerve ring and ventral ganglion leading into the nerve ring. In 2/2 ns157 animals examined, ensheathment was observed (data not shown). However, in 2/2 ns156 animals, ventral ensheathment was absent (see Fig. S4 in the supplementary material). Furthermore, ventral ganglia of both ns156 mutants were disorganized, lacking characteristic bilateral symmetry (see Fig. S4 in the supplementary material). These results suggest that ns156 disrupts CEPsh glia differentiation/specification more severely than ns157.
To further assess CEPsh glia defects in ns156 and ns157 mutants, we examined CEP dendrite extension in these animals. We found that CEP dendrites in these mutants are shorter than in wild-type animals (Fig. 2E,F), although the shortened dendrites still possessed cilia (Fig. 2E), as in CEPsh glia-ablated animals. Consistent with the defects in hlh-17 and ptr-10 reporter expression, CEP dendritic defects in ns156 mutants are mostly restricted to ventral dendrites (Fig. 2G). In ns157 mutants, defects were seen in 20% and 17% of dendrites of dorsal and ventral CEP neurons, respectively (Fig. 2G), consistent with the EM studies suggesting that ns157 mutants have subtler defects than ns156 mutants (see Fig. S4 in the supplementary material).
|
Finally, we also noted that 38% of ns156 mutants examined (n=577) arrest as L1 larvae and display nerve ring assembly defects resembling those seen in CEPsh glia-ablated animals.
Taken together, the studies described above strongly support the notion that the ns156 and ns157 mutations affect genes important for CEPsh glia differentiation. Furthermore, these studies support the idea that CEPsh glia play key roles in regulating axon guidance, nerve ring assembly and CEP dendrite extension.
|
To determine where mls-2 functions to regulate CEPsh glia differentiation, we generated animals carrying a rescuing transgene in which we inserted GFP upstream of mls-2 coding regions in an 8.3 kb mls-2 rescuing genomic fragment (see Fig. S5E in the supplementary material). We found that GFP::mls-2 was expressed in nuclei of the precursor cells of the left and right ventral CEPsh glia, ABplpaaapap and ABprpaaapap, respectively (Fig. 5D-J), and probably within CEPsh cells themselves (although the high density of cells in this region precluded reliable identification, and expression was extinguished postembryonically). GFP expression was also detected in the precursors of dorsal CEPsh glia (Fig. 5K-N), consistent with our observations that mls-2 mutants weakly affect hlh-17::GFP and ptr-10::myrRFP expression in these glia (Fig. 4).
To further confirm that mls-2 functions in the CEPsh glia lineage we performed a mosaic analysis aimed at defining the site of mls-2 function in directing AFD axon guidance. We generated mls-2 mutants carrying integrated hlh-17::GFP and ttx-1::DsRed reporters to label the CEPsh glia and AFD neurons, respectively. Into these mutants, we introduced the mls-2 rescuing cosmid and the AFD-specific reporter, nhr-38::GFP, both on an unstable extrachromosomal array. Ventral hlh-17::GFP expression presumably indicated the array was present in ventral CEPsh glia (an assumption that gave the most parsimonious interpretation of the data in Fig. 3V). The presence of this array in AFD was scored by nhr-38::GFP expression. As shown in Fig. 3V, when the array was absent from both CEPsh glia and AFD neurons, all animals displayed axon defects. However, when the array was present in both AFD neurons and CEPsh glia, most animals had no axonal defects. The ttx-1::DsRed reporter had a weak (10%) effect on AFD axon guidance on its own. These results support the notion that the ns156 axonal defects are caused by the mls-2 lesion.
We then examined animals in which the array was present in one or the other cell type. We found that in 60% of animals in which the array was present in ventral CEPsh glia, but absent from AFD neurons, axon guidance was rescued. However, if the array was present only in AFD neurons, 23% of animals had wild-type axons, consistent with the idea that mls-2 affects axon guidance non-autonomously and that mls-2 activity resides within the CEPsh glia lineage.
|
To determine whether vab-3 functions within CEPsh glia to regulate their differentiation, we performed a mosaic analysis. We introduced an extrachromosomal array containing the vab-3 cosmid and ptr-10::myrRFP into vab-3(ns157) mutants carrying an integrated hlh-17::GFP reporter and searched for animals lacking hlh-17::GFP expression. We found a perfect correlation between ptr-10::myrRFP and hlh-17::GFP expression in dorsal CEPsh glia (Fig. 6D). Importantly, we never observed ptr-10::myrRFP expression in CEPsh cells lacking hlh-17::GFP (n=12), consistent with vab-3 functioning within, or in cells closely related to, CEPsh glia to control differentiation.
To confirm the mosaic studies, we inserted a vab-3 isoform A cDNA directly downstream of the 5.5 kb mls-2 promoter in the mls-2 rescuing genomic clone, and introduced this transgene into vab-3(ns157) mutants. The transgene exhibited weak but reproducible rescue of hlh-17 and ptr-10 reporter expression in dorsal CEPsh glia: 18/100 (18%) animals carrying the transgene expressed hlh-17::GFP in both dorsal left and right CEPsh glia, whereas only 3/104 (2.9%) animals without the transgene expressed hlh-17::GFP in these cells.
To further confirm that vab-3 functions in the CEPsh lineage, we took advantage of the observation that vab-3(ns157) mutants show partially penetrant defects in hlh-17::GFP expression in ventral CEPsh cells (Fig. 4). As shown in Fig. 3I, AWC, AFD and ADF axon defects in vab-3(ns157) mutants were more severe if hlh-17::GFP expression was also disrupted in ventral CEPsh glia, consistent with the idea that vab-3 functions in CEPsh glia and that CEPsh glia are required for axon morphogenesis.
Different VAB-3 domains may regulate hlh-17 and ptr-10 expression in dorsal and ventral CEPsh glia
Although vab-3(ns157) mutants show a bias towards dorsal
defects in reporter transgene expression, the molecular lesion in these
animals may not abolish vab-3 function and, thus, the phenotype of
vab-3(ns157) animals might not represent the
vab-3(null) phenotype. To test this, we examined CEPsh reporter
transgene expression in animals homozygous for two vab-3 alleles,
e648 and ju468, that eliminate most, if not all, activity of
vab-3 isoform A (Fig.
6B) (Chisholm and Horvitz,
1995
; Cinar and Chisholm,
2004
). We were unable to detect hlh-17::GFP expression in
either dorsal or ventral CEPsh glia in these animals
(Fig. 4), suggesting that
vab-3 is important for differentiation of all CEPsh glia, and that
the weaker phenotype of ns157 mutants is due to residual
vab-3 function.
The vab-3(ns157) lesion promotes defects preferentially in dorsal CEPsh glia. Interestingly, we found a similar bias in vab-3(k109) PD mutants, suggesting that the PD might have unique roles in these cells (Fig. 4). To uncover the function of the vab-3 HD, we examined reporter expression in vab-3(e1796) animals containing missense mutations in the VAB-3 HD (Fig. 6B). Although hlh-17 expression was abrogated in both dorsal and ventral CEPsh glia in these animals, we found a surprising ventral bias in the failure to activate ptr-10 expression (Fig. 4). Dorsal CEPsh glia expressing ptr-10::myrRFP but not hlh-17::GFP still possess normal posterior extensions ensheathing the nerve ring, consistent with our EM results (see Fig. S4 in the supplementary material).
|
|
|
Finally, we note that a previous study suggested that the
hlh-17(ok487) mutation promotes lethality
(McMiller and Johnson, 2005
).
However, our extensive genetic studies of this mutation suggest that the
lethality is not associated with the hlh-17 lesion (data not shown).
Furthermore, the ok487 lesion is not a deletion, as previously
reported, but an insertion of DNA into the hlh-17 locus (see Fig. S5B
in the supplementary material).
vab-3 but not mls-2 is sufficient to promote hlh-17 transcription
To determine whether mls-2 and/or vab-3 are sufficient to
promote CEPsh gene transcription, we examined whether expression of heat-shock
promoter::cDNA transgenes promoted ectopic
hlh-17::GFP/ptr-10::myrRFP expression. We found that
subjecting non-transgenic (n=160) or heat-shock
promoter::mls-2 embryos (n>100) to a 30-minute 34°C
heat pulse failed to induce reporter expression. Strikingly, however,
hlh-17::GFP (and ptr-10::myrRFP, data not shown) was induced
within 60 minutes of heat exposure throughout heat-shock
promoter::vab-3 embryos (Fig.
6E-H). Induction required a 500 bp vab-3-responsive
element immediately upstream of the hlh-17 translation start site
(data not shown).
hlh-17::GFP induction was independent of mls-2, as vab-3-induced expression was still evident in mls-2(ns156) mutants (n=160, two lines examined). Furthermore, a heat-shock promoter::vab-3 cDNA transgene was unable to induce ectopic expression of an mls-2 promoter::GFP::mls-2::mls-2 3' reporter (n=50, two lines observed). Thus, vab-3 is sufficient to induce hlh-17 expression. Furthermore, the rapid appearance of GFP suggests that vab-3 might activate hlh-17 directly.
Surprisingly, we found that mls-2::GFP expression in anterior
cells was greatly reduced or absent in 200- to 350-minute
vab-3(ns157) embryos (n>100), but was present at
wild-type levels at later stages (n>50). VAB-3 protein (detected
by antisera), however, was expressed in a grossly wild-type pattern in
mls-2(ns156) mutants (data not shown). These results suggest
that vab-3 might also activate hlh-17 via mls-2.
Such feed-forward loops are common transcriptional motifs
(Shen-Orr et al., 2002
). Given
the minor role of mls-2 in regulating hlh-17 expression in
dorsal CEPsh glia, this alternative activation branch might be more important
in ventral CEPsh glia (Fig.
7).
| DISCUSSION |
|---|
|
|
|---|
Interestingly, in Pax6 mutant mice, oligodendrocyte precursor cell
generation is delayed (Sun et al.,
1998
), suggesting that Pax6 might control Nkx6. We observed a
similar relationship between VAB-3 and MLS-2, demonstrating that VAB-3 acts at
early time points to control MLS-2 expression.
Together, our results hint at possible similarities between CEPsh glia
development in C. elegans and the development of vertebrate
oligodendrocytes; however, differences are also notable. Importantly, mice
carrying Olig2 mutations have fewer oligodendrocytes than wild-type
animals (Zhou and Anderson,
2002
), suggesting developmental roles for this gene. However,
hlh-17 mutations do not grossly perturb CEPsh glia generation or
differentiation. One explanation for this may be redundancy: in vertebrates,
Olig2 and Olig1 control oligodendrocyte numbers
(Zhou and Anderson, 2002
;
Lu et al., 2002
). We
identified two proteins highly related to HLH-17, showing that triple
hlh mutants display more penetrant axon guidance defects in a
vab-3 mutant background than hlh-17 mutants alone. Although
these defects could reflect redundancy in C. elegans Olig gene
function, HLH-17 might also be redundant with other factors, or might
primarily regulate CEPsh function post-developmentally. The persistence of
hlh-17 expression in CEPsh glia throughout adulthood is consistent
with this possibility. Olig2 and Olig1 may function in
controlling nervous system repair following injury
(Ligon et al., 2006
) and it is
possible that HLH-17 and its relatives also have similar roles.
C. elegans CEPsh glia control neurite extension and guidance
We showed that ventral CEPsh glia play key roles in axon guidance,
attributed at least in part to UNC-6/Netrin expression, which may function as
a local cue to regulate guidance. These results might explain previous
observations that the shapes of CEPsh glia and RIA neuron axons are correlated
(Colón-Ramos et al.,
2007
). Short-range functions for Netrin-related proteins have been
described (Baker et al., 2006
),
and Netrin is present on the periaxonal myelin of oligodendrocytes in the
spinal cord, suggesting that it might serve local adhesive roles in these glia
(Manitt et al., 2001
).
The idea of UNC-6-directed local axon guidance raises the possibility that
synaptogenesis defects recently reported in mutants lacking UNC-6 or its
receptor, UNC-40 (Colón-Ramos et
al., 2007
), might not be due to direct roles in synapse formation,
but to subtle neuronal guidance defects. Mosaic analysis, fluorescence imaging
and gain-of-function experiments provided correlative evidence that ventral
CEPsh glia influence the position of synapses between the AIY and RIA neurons.
However, EM studies demonstrating that this correlation is not secondary to
local axon positioning roles of CEPsh glia were not performed. Indeed, EM
studies of wild-type animals show that ventral CEPsh glia are not apposed to
AIY/RIA synapses; rather, glia contact the opposite side of the AIY axon from
that where synapses occur. Furthermore, indirect extracellular glial access to
these synapses is obstructed [(White et
al., 1986
); see supplementary fig. 1O of Colón-Ramos et al.
(Colón-Ramos et al.,
2007
); Y.L. and S.S., unpublished], suggesting indirect roles for
CEPsh glia in synaptogenesis. Definitive resolution of these issues awaits
examination of AIY-RIA synapses in animals lacking CEPsh glia, and EM
reconstructions of unc-6/unc-40 mutants.
In addition to UNC-6, other axon guidance/branching proteins in the nerve
ring are known, including SAX-3/Robo
(Zallen et al., 1999
),
VAB-1/Eph (George et al.,
1998
; Zallen et al.,
1999
) and UNC-40/DCC (Chan et
al., 1996
). Whereas SAX-3 function in peripheral C.
elegans neurons is regulated by SLT-1/Slit ligand, the nerve ring defects
of sax-3 mutants might reflect redundant interactions of SAX-3 with
SLT-1 and a different ligand (Hao et al.,
2001
). sax-3 defects include anteriorly displaced nerve
rings and cell bodies, anterior axon projections, and defects in ventral
projections and axon elongation (Zallen et
al., 1999
). Although most animals lacking ventral CEPsh glia show
only axon guidance and branching defects, about 20% arrest development in the
L1 stage, exhibiting anteriorly displaced nerve rings and cell bodies
(Fig. 3). It is possible,
therefore, that CEPsh glia also secrete a SAX-3/Robo ligand regulating nerve
ring positioning, assembly and axon guidance. The weak penetrance of the
sax-3-like defects we observed might reflect our inability to ablate
all four CEPsh glia simultaneously.
A unique genetic system for studying glia in vivo
A major obstacle to studying glia and their interactions with neurons has
been their trophic support of neurons. Manipulation of glia, in vivo or in
vitro, often leads to the death of associated neurons, precluding detailed
studies of glial effects on other neuronal functions. One approach to
circumvent this difficulty has been to culture neurons with survival factors,
examining the consequences of glia re-addition. This approach uncovered roles
for glia-secreted cholesterol in neuronal activity
(Mauch et al., 2001
) and for
glia-produced thrombospondin in synapse formation
(Christopherson et al., 2005
).
However, in vivo verification of these studies remains challenging.
Our studies reveal that the C. elegans CEPsh glia, while possessing morphological, functional and molecular similarities to vertebrate glia, differ from their vertebrate counterparts in that they are not required for neuronal survival. This observation has allowed us to explore glial function in vivo and to demonstrate key roles for these cells in dendrite and axon extension. Our results suggest that C. elegans might, therefore, be useful for identifying glial contributions to the development and function of all nervous systems.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/13/2263/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Adler, C. E., Fetter, R. D. and Bargmann, C. I.
(2006). UNC-6/Netrin induces neuronal asymmetry and defines the
site of axon formation. Nat. Neurosci.
9, 511-518.[CrossRef][Medline]
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman,
D. J. (1990). Basic local alignment search tool.
J. Mol. Biol. 215,403
-410.[CrossRef][Medline]
Baker, K. A., Moore, S. W., Jarjour, A. A. and Kennedy, T.
E. (2006). When a diffusible axon guidance cue stops
diffusing: roles for netrins in adhesion and morphogenesis. Curr.
Opin. Neurobiol. 16,529
-534.[CrossRef][Medline]
Bao, Z., Murray, J. I., Boyle, T., Ooi, S. L., Sandel, M. J. and
Waterston, R. H. (2006). Automated cell lineage tracing in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA
103,2707
-2712.[CrossRef]
Bargmann, C. I. and Avery, L. (1995). Laser
killing of cells in Caenorhabditis elegans. Methods Cell
Biol. 48,225
-250.
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J.
(2000). A homeodomain protein code specifies progenitor cell
identity and neuronal fate in the ventral neural tube.
Cell 101,435
-445.[CrossRef][Medline]
Cai, J., Qi, Y., Hu, X., Tan, M., Liu, Z., Zhang, J., Li, Q.,
Sander, M. and Qiu, M. (2005). Generation of oligodendrocyte
precursor cells from mouse dorsal spinal cord independent of Nkx6 regulation
and Shh signaling. Neuron
45, 41-53.[CrossRef][Medline]
Chan, S. S., Zheng, H., Su, M. W., Wilk, R., Killeen, M. T.,
Hedgecock, E. M. and Culotti, J. G. (1996). UNC-40, a C.
elegans homolog of DCC (Deleted in Colorectal Cancer) is required in motile
cells responding to UNC-6 netrin cues. Cell
87,187
-195.[CrossRef][Medline]
Chisholm, A. D. and Horvitz, H. R. (1995).
Patterning of the Caenorhabditis elegans head region by the
Pax-6 family member vab-3. Nature
377, 52-55.
Christopherson, K. S., Ullian, E. M., Stokes, C. C., Mullowney,
C. E., Hell, J. W., Agah, A., Lawler, J., Mosher, D. F., Bornstein, P. and
Barres, B. A. (2005). Thrombospondins are astrocyte-secreted
proteins that promote CNS synaptogenesis. Cell
120,421
-433.[CrossRef][Medline]
Cinar, H. N. and Chisholm, A. D. (2004).
Genetic analysis of the Caenorhabditis elegans pax-6 locus:
roles of paired domain-containing and nonpaired domain-containing isoforms.
Genetics 168,1307
-1322.
Colón-Ramos, D. A., Margeta, M. A. and Shen, K.
(2007). Glia promote local synaptogenesis through UNC-6(netrin)
signaling in C. elegans. Science
318,103
-106.
Edmondson, J. C., Liem, R. K., Kuster, J. E. and Hatten, M.
E. (1988). Astrotactin: a novel neuronal cell surface antigen
that mediates neuron-astroglial interactions in cerebellar microcultures.
J. Cell Biol. 106,505
-517.
Fire, A., Harrison, S. W. and Dixon, D. (1990).
A modular set of lacZ fusion vectors for studying gene
expression in Caenorhabditis elegans. Gene
93,189
-198.
Fishell, G. and Hatten, M. E. (1991).
Astrotactin provides a receptor system for CNS neuronal migration.
Development 113,755
-765.[Abstract]
Fogarty, M., Richardson, W. D. and Kessaris, N.
(2005). A subset of oligodendrocytes generated from radial glia
in the dorsal spinal cord. Development
132,1951
-1959.
Fukushige, T., Hawkins, M. G. and McGhee, J. D.
(1998). The GATA-factor elt-2 is essential for
formation of the Caenorhabditis elegans intestine. Dev.
Biol. 198,286
-302.
George, S. E., Simokat, K., Hardin, J. and Chisholm, A. D.
(1998). The VAB-1 Eph receptor tyrosine kinase functions in
neural and epithelial morphogenesis in C. elegans.
Cell 92,633
-643.[CrossRef][Medline]
Hao, J. C., Yu, T., Fujisawa, K., Culotti, J. G., Gengyo-Ando,
K., Mitani, S., Moulder, G., Barstead, R., Tessier-Lavigne, M. and Bargmann,
C. (2001). C. elegans slit acts in midline,
dorsal-ventral, and anterior-posterior guidance via the SAX-3/Robo receptor.
Neuron 32,25
-38.[CrossRef][Medline]
Heiman, M. G. and Shaham, S. (2007). Ancestral
roles of glia suggested by the nervous system of Caenorhabditis
elegans. Neuron Glia Biol. 3,55
-61.
Hosoya, T., Takizawa, K., Nitta, K. and Hotta, Y.
(1995). glial cells missing: a binary switch between neuronal and
glial determination in Drosophila. Cell
82,1025
-1036.[CrossRef][Medline]
Huang, L. S., Tzou, P. and Sternberg, P. W.
(1994). The lin-15 locus encodes two negative
regulators of Caenorhabditis elegans vulval development. Mol.
Biol. Cell 5,395
-411.
Jessell, T. M. (2000). Neuronal specification
in the spinal cord: inductive signals and transcriptional codes.
Nat. Rev. Genet. 1,20
-29.[CrossRef][Medline]
Jiang, Y., Horner, V. and Liu, J. (2005). The
HMX homeodomain protein MLS-2 regulates cleavage orientation, cell
proliferation and cell fate specification in the C. elegans
postembryonic mesoderm. Development
132,4119
-4130.
Jones, B. W., Fetter, R. D., Tear, G. and Goodman, C. S.
(1995). glial cells missing: a genetic switch that controls glial
versus neuronal fate. Cell
82,1013
-1023.[CrossRef][Medline]
Jostes, B., Walther, C. and Gruss, P. (1990).
The murine paired box gene, Pax7, is expressed specifically during the
development of the nervous and muscular system. Mech.
Dev. 33,27
-37.[CrossRef][Medline]
Kidd, T., Bland, K. S. and Goodman, C. S.
(1999). Slit is the midline repellent for the robo receptor in
Drosophila. Cell 96,785
-794.[CrossRef][Medline]
Krause, M. and Hirsh, D. (1987). A
trans-spliced leader sequence on actin mRNA in C. elegans.
Cell 49,753
-761.[CrossRef][Medline]
Kuwabara, P. E. and Labouesse, M. (2002). The
sterol-sensing domain: multiple families, a unique role? Trends
Genet. 18,193
-201.[CrossRef][Medline]
Kuwabara, P. E., Lee, M. H., Schedl, T. and Jefferis, G. S.
(2000). A C. elegans patched gene,
ptc-1, functions in germ-line cytokinesis. Genes
Dev. 14,1933
-1944.
L'Etoile, N. D. and Bargmann, C. I. (2000).
Olfaction and odor discrimination are mediated by the C.
elegans guanylyl cyclase ODR-1. Neuron
25,575
-586.
Ligon, K. L., Fancy, S. P., Franklin, R. J. and Rowitch, D.
H. (2006). Olig gene function in CNS development and disease.
Glia 54,1
-10.[CrossRef][Medline]
Liu, R., Cai, J., Hu, X., Tan, M., Qi, Y., German, M.,
Rubenstein, J., Sander, M. and Qiu, M. (2003).
Region-specific and stage-dependent regulation of Olig gene expression and
oligodendrogenesis by Nkx6.1 homeodomain transcription factor.
Development 130,6221
-6231.
Lu, Q. R., Yuk, D., Alberta, J. A., Zhu, Z., Pawlitzky, I.,
Chan, J., McMahon, A. P., Stiles, C. D. and Rowitch, D. H.
(2000). Sonic hedgehog-regulated oligodendrocyte lineage genes
encoding bHLH proteins in the mammalian central nervous system.
Neuron 25,317
-329.[CrossRef][Medline]
Lu, Q. R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C. D.
and Rowitch, D. H. (2002). Common developmental requirement
for Olig function indicates a motor neuron/oligodendrocyte connection.
Cell 109,75
-86.[CrossRef][Medline]
Maduro, M. and Pilgrim, D. (1995).
Identification and cloning of unc-119, a gene expressed in the
Caenorhabditis elegans nervous system. Genetics
141,977
-988.
Manitt, C., Colicos, M. A., Thompson, K. M., Rouselle, E.,
Peterson, A. C. and Kennedy, T. E. (2001). Widespread
expression of netrin-1 by neurons and oligodendrocytes in the adult mammalian
spinal cord. J. Neurosci.
21,3911
-3922.
Mauch, D. H., Nagler, K., Schumacher, S., Goritz, C., Muller, E.
C., Otto, A. and Pfrieger, F. W. (2001). CNS synaptogenesis
promoted by glia-derived cholesterol. Science
294,1354
-1357.
McMiller, T. L. and Johnson, C. M. (2005).
Molecular characterization of HLH-17, a C. elegans bHLH
protein required for normal larval development. Gene
356, 1-10.
Mello, C. and Fire, A. (1995). DNA
transformation. Methods Cell Biol.
48,451
-482.[Medline]
Mello, C. C., Kramer, J. M., Stinchcomb, D. and Ambros, V.
(1991). Efficient gene transfer in C. elegans:
extrachromosomal maintenance and integration of transforming sequences.
EMBO J. 10,3959
-3970.
Meyer-Franke, A., Kaplan, M. R., Pfrieger, F. W. and Barres, B.
A. (1995). Characterization of the signaling interactions
that promote the survival and growth of developing retinal ganglion cells in
culture. Neuron 15,805
-819.[CrossRef][Medline]
Miller, D. M., 3rd, Desai, N. S., Hardin, D. C., Piston, D. W.,
Patterson, G. H., Fleenor, J., Xu, S. and Fire, A. (1999).
Two-color GFP expression system for C. elegans.
Biotechniques 26,914
-918.
Nass, R., Hahn, M. K., Jessen, T., McDonald, P. W., Carvelli, L.
and Blakely, R. D. (2005). A genetic screen inCaenorhabditis elegans for dopamine neuron insensitivity to
6-hydroxydopamine identifies dopamine transporter mutants impacting
transporter biosynthesis and trafficking. J. Neurochem
.
94,774
-785.
Nicolay, D. J., Doucette, J. R. and Nazarali, A. J.
(2007). Transcriptional control of oligodendrogenesis.
Glia 55,1287
-1299.[CrossRef][Medline]
Noctor, S. C., Flint, A. C., Weissman, T. A., Dammerman, R. S.
and Kriegstein, A. R. (2001). Neurons derived from radial
glial cells establish radial units in neocortex.
Nature 409,714
-720.[CrossRef][Medline]
Novitch, B. G., Chen, A. I. and Jessell, T. M.
(2001). Coordinate regulation of motor neuron subtype identity
and pan-neuronal properties by the bHLH repressor Olig2.
Neuron 31,773
-789.[CrossRef][Medline]
Perens, E. A. and Shaham, S. (2005). C.
elegans daf-6 encodes a patched-related protein required for lumen
formation. Dev. Cell 8,893
-906.[CrossRef][Medline]
Rowitch, D. H. (2004). Glial specification in
the vertebrate neural tube. Nat. Rev. Neurosci.
5, 409-419.[Medline]
Sagasti, A., Hobert, O., Troemel, E. R., Ruvkun, G. and
Bargmann, C. I. (1999). Alternative olfactory neuron fates
are specified by the LIM homeobox gene lim-4. Genes
Dev. 13,1794
-1806.[CrossRef]
Satterlee, J. S., Sasakura, H., Kuhara, A., Berkeley, M., Mori,
I. and Sengupta, P. (2001). Specification of thermosensory
neuron fate in C. elegans requires ttx-1, a homolog
of Otd/Otx. Neuron 31,943
-956.
Serafini, T., Colamarino, S. A., Leonardo, E. D., Wang, H.,
Beddington, R., Skarnes, W. C. and Tessier-Lavigne, M.
(1996). Netrin-1 is required for commissural axon guidance in the
developing vertebrate nervous system. Cell
87,1001
-1014.[CrossRef][Medline]
Shaham, S. (2006). Glia-neuron interactions in
the nervous system of C. elegans. Curr. Opin.
Neurobiol. 16,522
-528.[CrossRef][Medline]
Shen-Orr, S. S., Milo, R., Mangan, S. and Alon, U.
(2002). Network motifs in the transcriptional regulation network
of Escherichia coli. Nat. Genet.
31, 64-68.
Sulston, J. E. and Hodgkin, J. (1988). Methods.
In The Nematode Caenorhabditis elegans (ed. W. B.
Wood), pp. 587-606. Cold Spring Harbor: Cold Spring
Harbor Laboratory Press.
Sulston, J. E., Schierenberg, E., White, J. G. and Thomson, J.
N. (1983). The embryonic cell lineage of the nematode
Caenorhabditis elegans. Dev. Biol.
100,64
-119.
Sun, T., Pringle, N. P., Hardy, A. P., Richardson, W. D. and
Smith, H. K. (1998). Pax6 influences the time and site of
origin of glial precursors in the ventral neural tube. Mol. Cell.
Neurosci. 12,228
-239.[CrossRef][Medline]
Takebayashi, H., Nabeshima, Y., Yoshida, S., Chisaka, O.,
Ikenaka, K. and Nabeshima, Y. (2002). The basic
helix-loop-helix factor Olig2 is essential for the development of motoneuron
and oligodendrocyte lineages. Curr. Biol.
12,1157
-1163.[CrossRef][Medline]
Vallstedt, A., Muhr, J., Pattyn, A., Pierani, A., Mendelsohn,
M., Sander, M., Jessell, T. M. and Ericson, J. (2001).
Different levels of repressor activity assign redundant and specific roles to
Nkx6 genes in motor neuron and interneuron specification.
Neuron 31,743
-755.[CrossRef][Medline]
Vallstedt, A., Klos, J. M. and Ericson, J.
(2005). Multiple dorsoventral origins of oligodendrocyte
generation in the spinal cord and hindbrain. Neuron
45, 55-67.[CrossRef][Medline]
Wadsworth, W. G., Bhatt, H. and Hedgecock, E. M.
(1996). Neuroglia and pioneer neurons express UNC-6 to provide
global and local netrin cues for guiding migrations in C. elegans.
Neuron 16,35
-46.[CrossRef][Medline]
Wang, W., Lo, P., Frasch, M. and Lufkin, T.
(2000). Hmx: an evolutionary conserved homeobox gene family
expressed in the developing nervous system in mice and Drosophila.
Mech. Dev. 99,123
-137.
Ward, S., Thomson, N., White, J. G. and Brenner, S.
(1975). Electron microscopical reconstruction of the anterior
sensory anatomy of the nematode Caenorhabditis elegans. J. Comp.
Neurol. 160,313
-337.
White, J. G., Southgate, E., Thomson, J. N. and Brenner, S.
(1986). The structure of the nervous system of the nematode
Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B Biol.
Sci. 314,1
-340.[CrossRef]
Wicks, S. R., Yeh, R. T., Gish, W. R., Waterston, R. H. and
Plasterk, R. H. (2001). Rapid gene mapping inCaenorhabditis elegans using a high density polymorphism map.
Nat. Genet.
28,160
-164.
Yandell, M. D., Edgar, L. G. and Wood, W. B.
(1994). Trimethylpsoralen induces small deletion mutations in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA
91,1381
-1385.[CrossRef]
Zallen, J. A., Kirch, S. A. and Bargmann, C. I.
(1999). Genes required for axon pathfinding and extension in theC. elegans nerve ring. Development
126,3679
-3692.
Zhou, Q. and Anderson, D. J. (2002). The bHLH
transcription factors OLIG2 and OLIG1 couple neuronal and glial subtype
specification. Cell 109,61
-73.[CrossRef][Medline]
Zhou, Q., Wang, S. and Anderson, D. J. (2000).
Identification of a novel family of oligodendrocyte lineage-specific basic
helix-loop-helix transcription factors. Neuron
25,331
-343.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. R. Kennerdell, R. D. Fetter, and C. I. Bargmann Wnt-Ror signaling to SIA and SIB neurons directs anterior axon guidance and nerve ring placement in C. elegans Development, November 15, 2009; 136(22): 3801 - 3810. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Bacaj, M. Tevlin, Y. Lu, and S. Shaham Glia Are Essential for Sensory Organ Function in C. elegans Science, October 31, 2008; 322(5902): 744 - 747. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||