DEV017319 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure S1 -

  Fig. S1. Expression of the RNA interference UAS-RNAi-Src64B transgene reduces the accuracy of axonal projection of the Sema2b⁺ neurons. (A) The UAS-RNAi-Src64B transgene was expressed in vivo using the Da-GAL4 driver. Total mRNA was prepared from 0- to-24-hour-old embryos and DNase treated to reduce genomic DNA contamination. Src64B (upper panels) and control Rp49 (lower panels) mRNA levels were estimated by RT-PCR of 3-fold serial dilutions of input first-strand cDNA. From this analysis, we conclude that expression of the RNAi-Src64B transgene reduces Src64B mRNA expression levels to ∼10% of that of wild-type controls. Intron-spanning primer sets were used to allow discrimination of the cDNA amplification product from possible contaminating genomic DNA amplification product; the latter was not observed. No template was included in the PCRs in the first lane of each series. The following primers were used: Src64B RTPCR Forward, AAATGCTGCAGCAAGCGACAGGA and Reverse, ACTCGAATGTCGGCCGCTTCTC; Rp49 RTPCR Forward, ATGACCATCCGCCCAGCA and Reverse, TTGGGGTTGGTGAGGCGGAC. (B) AC projections do not cross the midline in ∼25% of the segments in embryos with reduced SRC64B expression (UAS-RNAi-SRC64B/Sema2b-GAL4; Sema2b-τ-myc/+); small arrows indicate abnormal AC projections. Sema2b⁺ neurons were visualized with anti-MYC. AC, anterior commissure; PC, posterior commissure.

• Supplemental Figure S2 -

  Fig. S2. Midline and lateral glial fate and morphology in the Src42A and Src64B single and double mutants. Stage 16 embryos of the indicated genotypes were stained with REPO mAb (A-F) to label all lateral glia or for Wrapper (G-L) to label the midline glia. Wild type (A,G), Src42A^E1 (B,H), Src64B^KO (C,I), Src42A^E1; Src64B^KO/+ (D,J), Src42A^E1/+; Src64B^KO (E,K) and Src42A^E1; Src64B^KO (F,L) are shown. Normal positions and organization of the lateral and midline glia are observed in individuals homozygous for one of the SFK mutants and heterozygous for the other, except that the lateral glial pattern is disorganized in Src42A/+; Src64B (compare white arrows in A and E). This lateral glial phenotype is also observed in the double-homozygote embryos (white arrow in F); furthermore, the midline glia in this genotype are more closely positioned together (white arrow in L), while appearing wild-type in the other genotypes. Anterior is up.

• Supplemental Figure S3 -

  Fig. S3. SRC42A weakly co-immunoprecipitates with DRL. S2 cells were transfected as follows: lysates were immunoprecipitated with anti-DRL and protein complexes immunoblotted with anti-MYC to detect the SFK species. Whole-cell lysates were immunoblotted to confirm expression. Lane 1, DRL-HA only; lane 2, SRC64B-myc (WT) only; lane 3, DRL-HA + SRC64B-myc (WT); lane 4, SRC42A-myc (WT) only; lane 5, SRC42A-myc (WT) + DRL-HA.

• Supplemental Figure S4 -

  Fig. S4. SRC64B does not efficiently co-immunoprecipitate with the membrane protein Wrapper. Kc cells were transfected with the indicated plasmids and immunoprecipitated with anti-HA (DRL) or anti-Wrapper antibodies and immunoblotted with anti-MYC (SRC64B). SRC64B was efficiently immunoprecipitated with DRL (lane 3), whereas only trace amounts of SRC64B were immunoprecipitated with Wrapper (lane 8).

• Supplemental Figure S5 -

  Fig. S5. Quantitation of SRC64B activation by DRL domain mutants. Kc cells were transfected in triplicate in 6-well dishes with the indicated plasmids, whole-cell lysates prepared and immunoblotted using anti-PY434SRC64B antiserum and a fluorescently tagged secondary antibody on an Odyssey scanner. PY434SRC64B was quantitated using the Odyssey software and plotted. SRC64B-myc expression levels as assayed by anti-MYC immunoblot were highly consistent within and between the triplicates (data not shown). These results indicate that the DRL cytoplasmic and WIF domains are required for its activation of SRC64B.