|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 11 June 2008
doi: 10.1242/dev.014902
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 INSERM U833, F-75005, Paris, France.
2 Collège de France, 11 Place Marcelin Berthelot, 75005 Paris,
France.
3 School of Life Science, Xiamen University 361005 Xiamen, Fujian, China.
4 Department of Tumor Biology and Angiogenesis, Genentech, 1 DNA Way, South San
Francisco, CA 94080, USA.
* Author for correspondence (e-mail: liz.jones{at}mcgill.ca)
Accepted 15 May 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Neuropilin 1, VEGF, Hemodynamics, Endothelial cell migration, Arterial-venous differentiation
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
le Noble et al., 2004;
Lucitti et al., 2007). If
blood flow is stopped or is sufficiently abnormal, the blood vessels remain as
a capillary plexus and do not undergo subsequent aspects of cardiovascular
development. Therefore, the role of signaling molecules in the developing
cardiovascular system is often obscured by the varied inputs of an organ
system that has already begun to function.
In many cases, null mutations for genes required for proper vascular
development also perturb proper blood flow. Genes that are expressed in the
endothelium are most often also expressed in the endocardial lining of the
heart, which could affect function. Irregularities in vascular geometry, such
as occlusions or shunts, can also cause abnormal flow
(Jones et al., 2004).
Therefore, if a gene is important enough to visibly perturb cardiovascular
structures, it will often perturb cardiovascular function as well. Over 50
genes have been published that cause a failure of yolk sac remodeling (Mary
Dickinson, personal communication). Though improper blood flow can cause this
phenotype, early circulatory function has been investigated in only a minority
of these embryos. Vascular abnormalities present in the N-cadherin-null mouse
can be rescued by restoring normal blood flow using cardiac-specific
expression of either N- or E-cadherin (Luo
et al., 2001), indicating that the observed vascular abnormalities
are secondary to the abnormal blood flow. Abnormal or absent blood flow has
been shown to cause failure to remodel in embryos
(Lucitti et al., 2007), more
cuboidal endothelial cell shape (May et
al., 2004), vessel regression
(Clark, 1918;
Meeson et al., 1996;
Thoma, 1893), abnormalities in
peripheral cell recruitment (Grazioli et
al., 2006) and changes in vessel diameter
(Thoma, 1893). Proper vascular
development requires a complex interaction of both genetic and physical
signals, where one cannot develop normally without the other. It is therefore
essential to separate when these events occur because of the mutation of
interest and when they are induced by abnormal blood flow.
The neuropilin 1 (Nrp1) receptor was originally identified as a receptor
for the axon guidance molecule semaphorin 3A and is implicated in the
development of the nervous system (He and
Tessier-Lavigne, 1997;
Kolodkin et al., 1997). Nrp1
is also an isoform-specific receptor for VEGF165
(Soker et al., 1998) and plays
an important role in the cardiovascular system, as deletion of the
Nrp1 gene leads to embryonic lethality due to cardiovascular
malformations. Lethality occurs between E10.5 and E13.5, depending on the
genetic background (Kitsukawa et al.,
1997). On a CD1 background, embryos lacking Nrp1 exhibit
defects in the formation of the heart outflow tract and aortic arches
(Kawasaki et al., 1999). In
addition, they exhibit abnormal vascular network formation in the yolk sac
(Kawasaki et al., 1999) and
abnormal sprouting of hindbrain vessels
(Gerhardt et al., 2004).
Furthermore, in endothelial-specific Nrp1 knockouts, certain arterial
markers are missing from arterioles and arteries
(Mukouyama et al., 2005). The
presence of both cardiac and vascular defects indicated that
Nrp1-null embryos could present abnormal blood flow patterns and that
aspects of their phenotype could be induced by improper flow rather than by
loss of function of the receptor. We therefore decided to examine flow
patterns in relation to vascular defects in these embryos.
We investigate here the cardiovascular phenotype of a Nrp1 mutant
allele (Gu et al., 2003) bred
on a C57BL/6 background. Nrp1-/- embryos die at E10.5 with
severe vascular abnormalities that are accompanied by abnormal flow patterns.
In order to separate flow-induced defects from defects induced by the
Nrp1 mutation, we compared wild-type and mutant embryos in the
absence of flow. We find that the yolk-sac vascular defects are not related to
the flow defect but are due to loss of Nrp1 function. Function-blocking
anti-Nrp1 antibodies (Pan et al.,
2007a) injected into wild-type embryos can reproduce the yolk sac
vessel defects observed in Nrp1 mutants in a normal flow environment.
By identifying an aspect of the mutant phenotype that is not dependent on
flow, we are then able to investigate the genetic causes of this defect. We
find that Nrp1-/- endothelial cells exhibit normal
replication, but altered migration and defective arterial differentiation.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
Briefly, a conditional targeted allele contained two loxP sites
flanking exon 2 of the Nrp1 gene was created. Nrp1-null mice
were obtained by crossing mice harboring this conditional allele with mice
expressing Cre recombinase in the germline. The colony was maintained by
breeding heterozygous male mice with wild-type C57BL/6 (Charles River
Laboratories). Genotyping was performed using Ready-to-go PCR beads (Amersham
Pharmacia Biotech, No. 27955801) with forward primer GCCAATCAAAGTCCTGGAAGACAG
and reverse primer CTGCAGATCATGTATACTGGTGAC.
Immunohistochemistry and in situ hybridization
For whole-mount staining, embryos were fixed in Dent's fixation (four parts
methanol: one part DMSO) overnight at 4°C. Embryos were progressively
rehydrated and blocked twice for 1 hour in TNB (Roche No. 11096176001).
Embryos were incubated overnight at 4°C with primary antibodies (1:100) in
TNB (biotinylated 
-Pecam1, BD Bioscience No. 553371; rabbit
-human Collagen IV, Serotec No. 2150-0140; phospho-histone 3, Abcam No.
ab5176-100). Embryos were washed, re-blocked and incubated overnight with
fluorescent streptavidin or fluorescent secondary antibodies (1:400) at
4°C.
For sections, embryos were dissected and fixed in 4% PFA overnight at 4°C. Embryos were washed in 70% ethanol, stained with Eosin, dehydrated and embedded in paraffin. Immunohistochemistry was performed using the Tyramide Signal Amplification system (TSA, NEN Life Science Products, Boston, MA).
In situ hybridization has been described previously
(Moyon et al., 2001a) with
probes for Dll4 (Suchting et al.,
2007), Nrp1 (Yuan et
al., 2002), Efnb2
(Moyon et al., 2001b) and
Cx40 (Mukouyama et al.,
2005).
Quantitation of vascular phenotype
After Pecam1 staining, yolk sacs were mounted and imaged on a fluorescent
microscope (magnification 20x). Using ImageJ, images were filtered and
converted to binary images. Total vessel area was assessed by counting the
number of white versus black pixels in the binary images. Network morphology
was quantified using the Biologic Analyzer, a software program developed by
Nicolas Elie (Centre de Morphologie Mathematiques-ARMINES, France). This
program extracts the skeleton of the vascular network from binary images (S.
Beucher, PhD thesis, École des Mines de Paris, 1990)
(Coster and Chermant, 1985) and
points where the skeleton lines intersect are counted as branchpoints
(Ablameyko and Pridmore, 2000)
(see Fig. S1 in the supplementary material). Segment length was assessed by
dividing the total length of all skeleton lines by the number of
intersections. Vessel diameter was assessed indirectly, by measuring the
average area of an avascular space (hole) between vessels. Four to five images
per yolk sac and a minimum of three yolk sacs per group were analyzed.
Flow assessment and creation of no-flow embryos
Breeding pairs of mice were mated overnight and the presence of a vaginal
plug denoted E0.5. Embryos were collected at E8.5 and cultured as described
(Jones et al., 2002), except
that roller culture rather than static culture was used. For analysis of flow,
embryos were collected at 5 somites and cultured for 6 or 24 hours. The yolk
sac was observed under white light (10x magnification), focusing
especially on the outlet of the dorsal aorta where the fastest and most
visible flow is located. Embryos were time-lapsed by placing them on a heated
stage after culture and images were taken with white light at a rate of 
2
Hz.
To create no-flow embryos, 3- to 4-somite stage embryos were held with No. 5 watchmaker forceps and the yolk sac and inlets to the heart were snipped on both sides of the heart using No. 55 watchmaker forceps. The embryos were then cultured for 24 hours. Most embryos recovered from the injury and had normally inflated yolk sacs (not shown) though the inlet to the heart was deformed and embryos never turned. One or two embryos per litter had deflated yolk sacs or still had blood circulation and were discarded.
Embryo injections and migration assay
Injections were performed using a pulled quartz needle filled with either
70,000 MW Texas Red dextran (Molecular Probes, No. D-1828) for angiograms or
with protein solutions [Nrp1 blocking antibodies
(Pan et al., 2007a) all others
from R&D systems] for Nrp1 blocking experiments. For protein solutions, a
small quantity of 70,000 MW Texas Red dextran was added to visualize
injection. A picospritzer II (General Valve) was used to inject, the volume of
the injections was set by varying the pressure until the desired amount of dye
was expunged. The needle was inserted into the heart of the embryos (10
somites for angiograms, 4 somites for protein solutions), through the yolk
sac. Long thin quartz needles were used to prevent damage to the yolk sac.
Several pulses of solution were injected into the beating heart and dye could
be visualized during injection entering the yolk sac and filling the vessels.
This ensured accurate and specific dosing to only the cardiovascular system.
Approximate dosing of protein solutions was calculated using an order of
magnitude estimation. The dimensions of an embryo are 1 mmx100
µmx100 µm at this stage and the density of an embryo is
approximately equal to that of water. With 10 nl of protein solution
injected (4.4 mg/ml and 7.6 mg/ml for -Nrp-1A and -Nrp-1B,
respectively), the dose is an order of magnitude of
103-104 mg of protein/kg of embryo.
In the case of the migration assay, CM-DiI (Invitrogen, C7001) dye was injected focally onto the yolk sac. Embryos (n=23 wild-type or heterozygotes, n=5 Nrp1-/-) were cultured for 24 hours and then photographed using bright-field and fluorescent light on a Leica fluorescent dissecting microscope. Using Photoshop, the distance from the center of the injection site to the most distant fluorescent endothelial cell was measured.
Isolation of embryonic endothelial cells and quantitative RT-PCR
Embryos were collected at E9.5 or after 24 hours of culture starting at
E8.5. Two to three embryos that appeared to be of the same genotype were
pooled and digested with collagenase for 40 minutes. Endothelial cells were
then separated using Dynabeads (Invitrogen No. 110-35) coated with Pecam1
antibody (BD Bioscience No. 553369), non-endothelial cells were collected for
genotyping. Endothelial cell RNA was extracted using an RNeasy micro kit
(Qiagen No. 74004). Retrotranscription was performed using MMLV reverse
transcriptase and Oligo dT primers. SYBR green PCR mix (Qiagen No. 204145) and
a BioRad iCycler were used to quantitate gene expression in these samples. All
primers were QuantiTect Primer Assays (Qiagen). A total of six sets of two or
three embryos with the correct genotype was used quantitate gene expression in
each group.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Chimeras
were backcrossed on a pure C57BL/6 background for more than seven generations.
We examined the cardiovascular phenotype between E8.0 (4-6 somites) and
E11.5.
|
De novo formation of blood vessels in Nrp1-null embryos appeared identical to wild-type until E8.5 (data not shown), suggesting a possible requirement of Nrp1 during the process of vessel remodeling but not vessel formation. To determine when the mutant phenotype became apparent, we injected fluorescently tagged dextran into the heart of normal (Fig. 1C) and mutant embryos (Fig. 1G) at 10 somites (E8.75), just after the normal onset of blood flow. The dextran highlights the vasculature of the heart, yolk sac and dorsal aortae in both wild-type and knockout embryos, indicating that lumenized vessels are present in Nrp1-/- embryos. However, the large dilated vessels and avascular spaces were already apparent in the mutant yolk sacs at this stage, indicating that the phenotype appears concomitantly with the onset of blood flow.
To quantitate the difference in the vascular phenotypes, we performed morphometric analysis (see Fig. S1 in the supplementary material) and measured total vessel coverage, the number of vessel branch points, segment length and avascular spaces between capillaries on Pecam-stained yolk sacs of wild-type and mutants (Fig. 1D,H). Before the onset of flow (E8.0, 4-6 somites), there was no statistically significant difference in overall vessel coverage, number of branchpoints or segment length between embryos of different genotypes (Fig. 1I-K). Overall vessel coverage remained similar between wild type and Nrp1 mutants at subsequent developmental stages (data not shown). However, the number of vessel branchpoints decreased in the Nrp1 mutant yolk sacs just after the onset of blood flow at 7-10 somites (E8.5) and at 20-25 somites (E9.5) (Fig. 1I). If the total vessel area is constant, and the number of vessel branchpoints is reduced, one expects that the length of individual vessel segments increases, which is what we observed in the Nrp1 mutant compared with wild type (Fig. 1J). The average size of avascular areas (holes) separating capillaries increased in Nrp1-/- mutants compared with wild type both at 7-10 somites and at 20-25 somites (Fig. 1K). With constant vessel area and increased space between vessels, it follows that the individual segments must be thicker. Taken together, this quantification revealed: (1) that Nrp1-null yolk sac vessels show normal overall vessel coverage, but altered vascular geometry, with less branched thicker vessels separated by large avascular spaces; and (2) that these defects appear concomitantly with the onset of blood flow.
Examination of the embryo proper between E8.5 and E9.5 showed that somite
addition in Nrp1-/- embryos occurred at normal rate until
E9.5 (23 to 25 somites), but ceased afterwards. A developmental delay of
Nrp1-/- compared with wild-type or heterozygous
littermates became apparent at E9.5. Live knockout embryos could be recovered
until E10.5, but were severely growth retarded at this stage (data not shown).
Taken together, we observe that Nrp1-/- embryos on the
C57BL/6 background die at E10.5, consistent with previous reports of a
different Nrp1 mutant allele bred on this background
(Kitsukawa et al., 1997), and
exhibit vessel remodeling defects that appear concomitant with the onset of
blood flow.
Nrp1-/- embryos exhibit abnormal blood flow
As proper blood flow is required for remodeling to occur
(le Noble et al., 2004;
Lucitti et al., 2007), we next
investigated whether normal blood flow was present in
Nrp1-/- embryos. In wild-type embryos, the heart starts
beating at the 3-somite stage, initiates a period of plasma flow through the
primitive vascular plexus from 3 somites until 5-6 somites, which is followed
by the gradual entry of erythroblasts into circulation. Continuous
circulation, where vessels are consistently filled with flowing erythroblasts,
is established by 8 somites (Lucitti
et al., 2007). We investigated whether erythroblasts circulated in
Nrp1-/- mutants by placing embryos at E8.5 (5-7 somites)
into culture for 6 or 24 hours, as previously described
(Jones et al., 2004). The
embryos were removed from culture and observed under white light for
circulating erythroblasts (Table
1). Using this method, we saw erythroblasts circulating in 100% of
E8.5 wild-type embryos (n=12; see Movie 1 in the supplementary
material) and 100% of E9.5 wild-type embryos (n=13). By contrast,
normal circulation was not observed at either stage in embryos lacking
Nrp1. In E8.5 mutant embryos, erythroblasts could only be seen
oscillating in place (Table 1,
see Movie 2 in the supplementary material) and continuous movement of
erythroblasts through the early vascular plexus was never observed. By E9.5,
no erythroblast motion was observed in the mutant embryos (n=4) and
circulation had completely arrested. Thus, Nrp1 homozygous mutants
can initiate heart contraction and plasma flow
(Fig. 1G), but fail to initiate
erythroblast circulation.
|
|
Lack of cardiac Nrp1 expression could cause the observed blood
flow defects, as oscillatory flow has previously been seen in embryos that
specifically lack the atrial component of heart contractions
(Lucitti et al., 2007). The
heart of Nrp1-null embryos underwent proper looping at E8.5; however,
the pericardial sac of the mutant embryos was consistently enlarged by E10.5
(n=7) and no trabeculation was observed from E9.5 onwards. At E8.5,
the endocardial lining stained positively for Pecam1 and was present in both
wild-type and mutant embryos (data not shown). The size of the heart also
appeared to be normal. Therefore, the heart appeared morphologically normal at
10 somites when flow problems could already be observed. To determine whether
heart function was normal in the Nrp1-null embryos, we placed embryos
at the 6-somite stage into culture for 6 hours and observed the form of the
heart contraction. Heart contractions initiate at the base of the heart and
move anteriorly in both wild-type and Nrp1 knockout embryos
(n=8 for wild type and n=3 for mutant). Heart rate also did
not differ significantly between wild-type and mutant (51±4.5 bpm and
40±5.7 bpm, respectively; see Movies 1, 2 in the supplementary
material). We therefore conclude that heart function is also grossly normal in
the mutant embryos, although more subtle defects could not be detected with
this method.
As cardiac function appeared grossly normal, we next looked at whether the
vasculature of the embryo proper had formed normally. Pecam1 staining at E8.5
showed that both dorsal aortae were present in wild-type
(Fig. 2B) and mutant embryos
(Fig. 2D). The diameter of
these vessels appeared normal throughout the embryo, but
Nrp1-/- vessels were often collapsed, perhaps impeding
blood flow and circulation, although the dextran injections showed that
vessels were lumenized at this stage (Fig.
1G). At E9.5, collagen IV staining on sections from wild-type
embryos revealed two dorsal aortae on either side of the neural tube
(Fig. 2C). One or both of these
vessels, at the level of the heart, were missing in Nrp1 mutant
embryos (Fig. 2E,G;
Fig. 4B), though they were
generally still present at the caudal end of the embryo. E9.5 Nrp1
mutant embryos also showed delayed vessel sprouting into the intersomitic
regions when compared with wild-type (Fig.
2F,G), though sprouts that progressed far enough interconnected as
in wild-type. The cephalic vascular plexus developed in
Nrp1-/- embryos, although the vessels were thinner and
sparser than in normal embryos and did not appear to be lumenized
(Fig. 2H,I). Smooth muscle
cells, visualized with -SMA staining, surrounded the major vessels of
the embryo in wild-type embryos, but were not present either in the head or
trunk region of homozygous mutant embryos (data not shown).
Separating the role of blood flow from Nrp1 function
As the histological and functional analysis of the cardiovascular system in
Nrp1-null embryos did not reveal a major defect in the mutant heart
or vessels of the embryo proper, the yolk sac vascular phenotype in
Nrp1-/- mice could be due to defective flow causing
defective vessel remodeling or vice versa. We therefore sought to
differentiate primary effects caused by lack of Nrp1 from secondary
defects caused by abnormal flow.
|
), or
embryos that exhibit only oscillatory flow, such as the
Mlc2a-/- embryos that we have previously analyzed
(Lucitti et al., 2007). We
therefore created embryos that completely lacked flow in order to compare the
vasculature of wild-type `no-flow' embryos with those of Nrp1
mutants. By placing wild-type and mutant embryos into the same no-flow mode,
the comparison of the phenotypes reflects only the role of Nrp1 and
not normal versus abnormal or absent flow. We created no-flow embryos by
snipping the inlet to the heart in 4-somite embryos (see Materials and
methods), a stage when the heart has started beating but erythroblast
circulation has not initiated. These embryos are then cultured for 24 hours
using whole embryo roller culture. The presence or absence of flow is
evaluated after culture at a stage when circulation of erythroblasts is
normally evident. The vasculature is then stained using antibodies to Pecam1
and the number of vessel branch points, vessel segment length and avascular
spaces are quantitated. In wild-type embryos with normal flow, key aspects of vascular remodeling were apparent after culture, such as changes in branch angle and the formation of large vessels in the yolk sac. These large, regularly branched vessels are separated by capillary regions (Fig. 3A). As observed in freshly dissected embryos (Fig. 1F), cultured Nrp1 mutants fail to undergo remodeling and to create a hierarchical branching system (Fig. 3A). Though the overall vascular coverage was not affected in Nrp1 mutants (n=12 for wild-type, n=10 for mutant, data not shown), the yolk sac vessels showed decreased branching, increased segment length and large spaces separating vessels. The difference in vessel diameter between wild-type and mutant embryos was also apparent in sections (inlays, Fig. 3A).
Comparing embryos in the no-flow environment, we found that wild-type and knockout embryos did not show the same vascular phenotype (Fig. 3A). In wild-type no-flow embryos, large vessels never formed and the entire vasculature remained reminiscent of the capillary regions of the yolk sac with blood flow. Vessel branching was decreased (Fig. 3B); however, no change in segment length or in the area of avascular spaces was present compared with embryos experiencing normal flow (Fig. 3C,D). Cultured no-flow Nrp1-/- embryos also showed decreased branching (Fig. 3B), but in addition showed increased segment length (Fig. 3C) and increased area of avascular spaces (Fig. 3D), similar to the vascular phenotype of Nrp1-/- embryos in normal flow conditions and in striking contrast to the phenotype of wild-type no-flow embryos. Thus, all aspects of the Nrp1-/- yolk sac vessel phenotype develop in no-flow culture conditions, indicating that the phenotype is due to loss of Nrp1 function.
Blocking Nrp1 function reproduces the Nrp1-/- yolk sac vessel phenotype
Having determined that loss of Nrp1 function, rather than disturbed blood
flow, was responsible for the altered vascular geometry in the yolk sac of
Nrp1-/- embryos, we reasoned that blocking Nrp1 function
in wild-type embryos should reproduce the vascular phenotype observed in
Nrp1-null mutants. We used antibodies that specifically block either
Sema3A or VEGFA binding to Nrp1 (Pan et
al., 2007a). Treated embryos were cultured for 24 hours, Pecam1
stained (Fig. 4A-D), and yolk
sac vessel branching and avascular spaces were quantified
(Fig. 4E-G). To optimize
protein delivery to the yolk sac, we first compared direct addition of protein
to the medium of cultured embryos and intracardiac injection of protein
solution, using VEGF120, which is expected to increase vessel
coverage. We found that intracardiac injection was preferable as
VEGF120 could not diffuse across the yolk sac when added directly
to the medium (data not shown). Injection of VEGF120 led to an
increase in the vascular coverage (from 74.1±1.1% to 85.9±1.1%)
such that most of the yolk sac stained positive for Pecam1
(Fig. 4B). Having optimized
protein delivery, we analyzed the effects of intracardiac injection of Nrp1
blocking antibodies (Pan et al.,
2007a). Anti-Nrp1A antibody blocks Sema3A binding and anti-Nrp1B
is specific for the VEGF binding domain of Nrp1, though both prevent receptor
dimerization with Vegfr2. Both antibodies were capable of decreasing vessel
branching and increasing segment length
(Fig. 4C-F). Anti-Nrp-1A had no
effect on the area of avascular regions, but anti-Nrp1B was able to create
large avascular regions similar to those seen in the
Nrp1-/- embryos (Fig.
4C,D,G). Injection of both antibodies together did not create a
synergistic effect on branching, and effects on avascular spaces were similar
to the ones seen with anti-Nrp1B alone
(Fig. 4G). Attempts at blocking
Nrp1 function by injection of soluble Nrp1, which should sequester Nrp1
ligands including VEGF165
(Gagnon et al., 2000), had no
effect on yolk sac vasculature (Fig.
4E-G). Injection of the Nrp1 ligand Sema3A, which had previously
been shown to compete with VEGF165 for Nrp1 binding
(Miao et al., 1999), also had
no significant effects (Fig.
4E-G), consistent with recent data showing directly that Sema3A
and VEGF do not compete for binding to Nrp1
(Appleton et al., 2007), and
that Sema3A mutant mice lack an observable vascular phenotype
(Vieira et al., 2007). Though
no effects were observed in these injection experiments, it was not possible
to assess whether larger quantities of protein could have elicited a response.
The embryo and its network of blood vessels are small at this stage and limit
how much protein solution can be injected into the embryo without causing
injury. However, inhibition of Nrp1 function with a blocking antibody to the
VEGF binding domain in wild-type embryos could clearly reproduce the altered
vascular geometry observed in Nrp1 knockout yolk sacs, confirming
that this aspect of the phenotype was due to loss of Nrp1 function and not to
altered blood flow.
|
),
migration (Pan et al., 2007b)
and proliferation of endothelial cells
(Soker et al., 1998). We
therefore investigated how endothelial cell behavior in the yolk sac was
different between mutant and wild-type embryos. Endothelial cell replication
was assessed at various developmental stages in wild-type and mutant embryo
yolk sacs using phospho-histone H3 and Pecam1 double-staining
(Fig. 5A). No significant
difference in the number of dividing endothelial cells was observed between
the two groups at all stages investigated (n=3-4 embryos per group
with five images per embryo). Replication of smooth muscle cells and of total
cells in the yolk sac at E9.5 was also similar between Nrp1 knockouts
and wild type (not shown). Taken together with the similar total vessel
coverage observed in wild-type and knockouts, these results indicate that
endothelial replication is unlikely to account for the observed yolk sac
vessel defects in Nrp1 knockouts. The sprouting and regression of
vessels was assessed by counting the number of Pecam1 stained endothelial
cells extending into avascular spaces of the yolk sac, such that they formed
dead-ended vessels (unconnected extensions). No differences were observed
between the different groups and the presence or absence of flow did not
affect this measure (Fig.
5B). Endothelial cell migration was assessed by focal injection of a lipophilic carbocyanine dye (DiI) using a picospritzer into a capillary region of the yolk sac (red arrow, Fig. 5D,E) followed by culture to allow marked cells to migrate. Regions where the fluorescence is continuous from cell to cell indicate endothelial cells migrating away from the site of injections (Fig. 5F,G). In wild-type embryos, marked cells migrate but remain confined within proximity to the injection site (Fig. 5C,D,F, n=23). Nrp1 knockout DiI-positive cells migrate along the abnormally formed yolk sac capillaries and are found at greater distances from the injection area than wild-type cells (Fig. 5C,E,G, n=5). Quantification of the distance of cell migration confirmed that endothelial cells migrated further away from the injection site in Nrp1-/- compared with wild-type yolk sacs (Fig. 5C), indicating that they exhibit abnormal migration.
Defective arterial differentiation in Nrp1-/- embryos is not flow related
Previous reports have indicated that arterial differentiation is defective
in endothelial-specific Nrp1 knockouts
(Mukouyama et al., 2005).
Though arterial identity is established before the onset of flow, the
expression of arterial markers remains plastic and changes with the flow that
endothelial cells are exposed to. If an embryonic artery is ligated to create
an environment where the vessels experience venous flow, expression of markers
such as ephrin B2 will be downregulated and expression of venous markers will
be upregulated (le Noble et al.,
2004). Other groups have also shown that endothelial cells change
their gene expression depending on the waveform of the flow that they are
exposed to (Blackman et al.,
2002). We therefore investigated whether changes in
arterial-venous gene expression in Nrp1 mutants were created by the
abnormal flow present in these embryos.
|
To further explore differences in gene expression between
Nrp1-/- and wild-type embryos, we used quantitative
RT-PCR. Endothelial cells were isolated from two or three embryos using
Dynabeads coated with antibodies against Pecam1 (see Materials and methods).
From this cell population, RNA was extracted and analyzed. To rule out effects
of flow induced gene expression, we also tested endothelial cell gene
expression in wild-type and mutant embryos that lacked flow. In all, six sets
of two or three embryos were analyzed per group. The relative expression
levels were measured for 11 cardiovascular genes
(Fig. 6G): four
pan-endothelial, four arterial and three venous. These were normalized to
three housekeeping genes, β-actin, -tubulin and Gapdh.
Most genes showed no significant difference in expression level between
wild-type, Nrp1-/-, no-flow wild type and no-flow knockout
(Hif1a, Vegfr2, VE-cadherin (Cdh5 - Mouse Genome
Informatics), Dll4, Nrp2 and Ephb4). Expression of
Vegfa and Unc5b was altered in endothelial cells of
Nrp1 mutants compared with wild type
(Fig. 6G). Stopping flow,
however, eliminated the difference between wild-type and mutant, indicating
that no difference is seen when observed on the same flow background.
COUP-TF2 (Nr2f2 - Mouse Genome Informatics) levels were
unaffected by the Nrp1 mutation but were decreased in no-flow
conditions (Fig. 6G). In
contrast to these genes, expression of the arterial markers Efnb2 and
Cx40 was specifically downregulated in Nrp1 mutants
(Fig. 6G), as reported
previously in endothelial-specific Nrp1 knockouts
(Mukouyama et al., 2005). The
decrease in Efnb2 levels was modest, confirming the in situ
hybridization results, indicating that not all vessels lost Efnb2
expression, while expression of Cx40 was strongly decreased in
Nrp1 mutants. Downregulation of Efnb2 and Cx40 was
not flow related but specific to loss of Nrp1, as the difference was
also present between no-flow wild-type and knockout embryos.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Cardiovascular defects in Nrp1 mutants were so far
only analyzed in the CD-1 mutants
(Kawasaki et al., 1999) and in
endothelial-specific conditional mutants, which also die at E13.5
(Gerhardt et al., 2004;
Gu et al., 2003;
Mukouyama et al., 2005). In
agreement with the initial report
(Kitsukawa et al., 1997), our
extensive analysis of an Nrp1 mutant allele bred on C57BL/6 showed
lethality at E10.5. In fact, these Nrp1-/- embryos show
arrest of all cardiovascular progress one day after cardiovascular function
normally begins. The heart has looped but no trabeculations form. The dorsal
aortae form normally at E8.5 but are regressing by E9.5, and smooth muscle
cells do not surround large vessels. Yolk sac vessels fail to remodel into
arteries and veins, show reduced branching, diameter increase and enlarged
avascular spaces. The embryo begins to appear necrotic by E9.5 and is slowly
resorbed by E11.5. Analysis of flow patterns showed that normal flow was never
observed in Nrp1 null mutants. As vascular defects appear
concomitantly with blood flow defects, they could be secondary to the flow
defects or caused by the Nrp1 mutation.
|
). As
heart development continues, plasma flow increases and eventually carries
erythroblasts into circulation. Enlarged yolk sac vessels would require a
larger pump (or stronger heart) than normal to create an equivalent velocity
of plasma flow in the vessels given the laws of conservation of mass. If the
plasma is not flowing fast enough, then the erythroblasts cannot circulate.
Nrp1-/- embryos on a CD1 background are not resorbed until
E13.5 (Kitsukawa et al.,
1997), although they show aberrant yolk sac vessel geometry
similar to the one described here
(Kawasaki et al., 1999). We
speculate that the difference in the stage at which the mutant embryos die in
these two backgrounds could be due to slightly increased embryo growth rate,
heart contractility and blood flow in CD1 versus C57BL/6 embryos, which would
be sufficient to initiate blood flow but still encounter altered vascular
geometry and eventually fail to establish proper circulation.
Separating genetic and flow defects in Nrp1-/- mutants
Abnormal flow makes analysis of mouse mutants challenging as it becomes an
issue of whether flow or loss of signaling function cause the mutant
phenotype. In N-cadherin (Cdh2 - Mouse Genome Informatics) mutants,
cardiac-specific rescue of gene expression was sufficient to rescue flow and
cardiovascular defects observed in null mutants
(Luo et al., 2001). As no
obvious cardiac defects were detected in the Nrp1-null mutants, we
did not attempt cardiac-specific re-expression of Nrp1. To identify
aspects of the phenotype caused by loss of Nrp1 function, we sought
to compare embryos in the same flow environment and decided to analyze embryos
in the absence of flow. We find that the geometry of the capillary plexus in
Nrp1-null embryos in a no-flow environment is altered such that there
are fewer branch points, longer vessel segments and larger avascular spaces
between vessels, indicative of increased vessel diameter. This phenotype is
seen in both no-flow and untreated Nrp1-null embryos and therefore
not related to flow. This method allowed us to identify aspects of the
phenotype that are purely due to loss of Nrp1 function. The relative
simplicity of the method, when compared with transgenic rescue experiments,
makes it easily applicable to analysis of numerous mouse mutants for genes
involved in cardiovascular development in which abnormal flow is
suspected.
Formation of defective capillary geometry in Nrp1-/- mutants
To confirm that altered yolk sac vessel geometry in
Nrp1-/- mutants was due to loss of Nrp1 function rather
than to abnormal flow, we injected wild-type embryos with blocking antibodies
specific to either the Sema3A or the VEGF-binding domains of Nrp1. Both
antibodies decreased yolk-sac vessel branching, but only the Nrp1B VEGF
blocking antibody led to phenocopy of all aspects of the
Nrp1-/- vascular morphology. Previous studies have shown
that both antibodies reduce VEGF-driven endothelial cell migration and
sprouting angiogenesis in various in vitro and in vivo models, with anti-Nrp1B
being slightly more potent than anti-Nrp1A
(Pan et al., 2007a). Both
antibodies disrupt complex formation of Nrp1 and Vegfr2, suggesting that both
inhibit VEGF-driven motility via disruption of complex formation and
downstream signaling events. Our results agree with these findings, as
inhibiting the Sema3A-binding domain showed a small effect on vascular
morphology, while injection of antibodies that block the VEGF-binding domain
mimicked multiple aspects of the Nrp1-/- phenotype.
Furthermore, injection of antibody blocking VEGF binding to Nrp1 could induce
the Nrp1-/- capillary phenotype in wild-type embryos
experiencing normal flow. These experiments therefore clearly identify the
aberrant vascular geometry as a primary defect caused by loss of Nrp1
signaling.
Endothelial replication was similar between wild-type and mutants and could
not account for the altered Nrp1-/- yolk sac vessel
geometry. Thus, loss of Nrp1 function does not influence endothelial cell
replication in vivo, confirming previous findings with antibodies blocking
VEGF or Sema3A binding to Nrp1, which failed to inhibit VEGF-driven
endothelial proliferation in vitro (Pan et
al., 2007a). We also found no differences in sprouting/regression
between wild type and Nrp1-/- mutants. However, the number
of Pecam-positive endothelial cells extending into avascular yolk sac areas
was very low (less than 1 per mm2). Time-lapse studies in early
quail embryos have shown that formation of the vascular plexus involves
endothelial cell migration along existing endothelial cord structures as well
as sprouting (Rupp et al.,
2003). Although sprouting appeared to be an important mechanism to
generate new vascular cords, only a small fraction of endothelial cells was
shown to exhibit protrusive behavior over the period of recording
(Perryn et al., 2008). Thus,
sprout formation in yolk sac vessels may be missed in fixed samples. We can
therefore not rule out altered sprouting or regression of yolk sac endothelial
cells as a potential mechanism accounting for the altered vascular morphology
of Nrp1-null yolk sacs.
We found significant differences in the pattern of endothelial migration
between wild-type and Nrp1-/- mutants. Focal DiI
injections showed that Nrp1 knockout cells are found at greater
distances from the injection area than wild-type cells. This observation was
surprising, as one might have expected migration of
Nrp1-/- cells to be decreased. However, the mutant cells
appeared to migrate along existing endothelial cell cords and were never seen
leaving existing vessels. Thus, rather than exhibiting a general block of
migration, it appears that Nrp1 mutant cells fail to migrate in the
proper direction, most probably via loss of VEGF signaling. Migration along
existing capillaries has been shown to require cell-cell rather than
extracellular matrix interactions (Rupp et
al., 2003), suggesting that interactions between endothelial Nrp1
and matrix-bound VEGF may be disrupted in the mutant mice. Loss of Nrp1
function may thus perturb binding of extracellular matrix-bound
VEGF164, complex formation with Vegfr2 and downstream signaling,
leading to inhibition of directional migration and vessel branching, without
affecting other aspects of endothelial function such as proliferation. Such a
mechanism would explain the reduction in branchpoints and larger vessel
diameters as the same numbers of endothelial cells are creating fewer vessels.
Alternatively, as qPCR analysis has shown that Nrp1 mutant
endothelial cells express elevated Vegf mRNA levels, increases in
VEGF signaling through Vegfr2 may cause the increase in endothelial migration
we observe. We find this model unlikely, however, as Vegf levels in
cultured no-flow wild-type or Nrp1-/- mutants are similar,
yet their vascular phenotypes differ. Furthermore, injection of antibodies
blocking VEGF binding to Nrp1 into wild-type embryos with normal flow and
presumably unaltered VEGF levels can reproduce altered capillary geometry.
Endothelial gene regulation by Nrp1
As the maintenance of expression of arterial markers requires flow
(le Noble et al., 2004), we
investigated whether changes in arterial-venous gene expression in
Nrp1 mutants were created by the abnormal flow present in these
embryos. We found that expression levels of arterial markers Cx40 and
Efnb2 were decreased in Nrp1 mutants compared with wild-type
embryos. For Efnb2, this change appears to be linked to
extra-embryonic vessels, as highlighted by the loss of expression in the
vitelline artery. These two genes were previously reported downregulated in
endothelial-specific conditional Nrp1 knockout embryos
(Mukouyama et al., 2005);
however, the effect of flow was not analyzed. Wild-type embryos cultured in
no-flow conditions showed no changes in the expression levels of these two
genes, indicating that the decrease was specific for the Nrp1
mutation and not secondary to altered blood flow, thus confirming and
extending previous reports (Mukouyama et
al., 2005).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/14/2479/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Ablameyko, S. and Pridmore, T. P. (2000).Machine Interpretation of Line Drawing Images
. Secaucus, NJ:
Springer-Verlag.
Appleton, B. A., Wu, P., Maloney, J., Yin, J., Liang, W. C.,
Stawicki, S., Mortara, K., Bowman, K. K., Elliott, J. M., Desmarais, W. et
al. (2007). Structural studies of neuropilin/antibody
complexes provide insights into semaphorin and VEGF binding. EMBO
J. 26,4902
-4912.[CrossRef][Medline]
Blackman, B. R., Garcia-Cardena, G. and Gimbrone, M. A., Jr
(2002). A new in vitro model to evaluate differential responses
of endothelial cells to simulated arterial shear stress waveforms.
J. Biomech. Eng. 124,397
-407.[CrossRef][Medline]
Chapman, W. B. (1918). The effect of the
heart-beat upon the development of the vascular system in the chick.
Am. J. Anat. 23,175
-203.[CrossRef]
Clark, E. R. (1918). Studies on the growth of
blood vessels in the tail of frog. Am. J. Anat.
23, 37-88.[CrossRef]
Coster, M. and Chermant, J. L. (1985).Precis d'Analyse d'Images
. Paris: Les Editions du
CNRS.
Gagnon, M. L., Bielenberg, D. R., Gechtman, Z., Miao, H. Q.,
Takashima, S., Soker, S. and Klagsbrun, M. (2000).
Identification of a natural soluble neuropilin-1 that binds vascular
endothelial growth factor: In vivo expression and antitumor activity.
Proc. Natl. Acad. Sci. USA
97,2573
-2578.
Gerhardt, H., Ruhrberg, C., Abramsson, A., Fujisawa, H., Shima,
D. and Betsholtz, C. (2004). Neuropilin-1 is required for
endothelial tip cell guidance in the developing central nervous system.
Dev. Dyn. 231,503
-509.[CrossRef][Medline]
Grazioli, A., Alves, C. S., Konstantopoulos, K. and Yang, J.
T. (2006). Defective blood vessel development and
pericyte/pvSMC distribution in alpha 4 integrin-deficient mouse embryos.
Dev. Biol. 293,165
-177.[CrossRef][Medline]
Gu, C., Rodriguez, E. R., Reimert, D. V., Shu, T., Fritzsch, B.,
Richards, L. J., Kolodkin, A. L. and Ginty, D. D. (2003).
Neuropilin-1 conveys semaphorin and VEGF signaling during neural and
cardiovascular development. Dev. Cell
5, 45-57.[CrossRef][Medline]
He, Z. and Tessier-Lavigne, M. (1997).
Neuropilin is a receptor for the axonal chemorepellent Semaphorin III.
Cell 90,739
-751.[CrossRef][Medline]
Jones, E. A., Crotty, D., Kulesa, P. M., Waters, C. W., Baron,
M. H., Fraser, S. E. and Dickinson, M. E. (2002). Dynamic in
vivo imaging of postimplantation mammalian embryos using whole embryo culture.
Genesis 34,228
-235[CrossRef][Medline]
Jones, E. A., Baron, M. H., Fraser, S. E. and Dickinson, M.
E. (2004). Measuring hemodynamic changes during mammalian
development. Am. J. Physiol. Heart Circ. Physiol.
287,H1561
-H1569.
Kawasaki, T., Kitsukawa, T., Bekku, Y., Matsuda, Y., Sanbo, M.,
Yagi, T. and Fujisawa, H. (1999). A requirement for
neuropilin-1 in embryonic vessel formation.
Development 126,4895
-4902.[Abstract]
Kitsukawa, T., Shimizu, M., Sanbo, M., Hirata, T., Taniguchi,
M., Bekku, Y., Yagi, T. and Fujisawa, H. (1997).
Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial
role in peripheral nerve projection in mice. Neuron
19,995
-1005.[CrossRef][Medline]
Kolodkin, A. L., Levengood, D. V., Rowe, E. G., Tai, Y. T.,
Giger, R. J. and Ginty, D. D. (1997). Neuropilin is a
semaphorin III receptor. Cell
90,753
-762.[CrossRef][Medline]
le, Noble, F., Moyon, D., Pardanaud, L., Yuan, L., Djonov, V.,
Matthijsen, R., Breant, C., Fleury, V. and Eichmann, A.
(2004). Flow regulates arterial-venous differentiation in the
chick embryo yolk sac. Development
131,361
-375.
Lucitti, J. L., Jones, E. A., Huang, C., Chen, J., Fraser, S. E.
and Dickinson, M. E. (2007). Vascular remodeling of the mouse
yolk sac requires hemodynamic force. Development
134,3317
-3326.
Luo, Y., Ferreira-Cornwell, M., Baldwin, H., Kostetskii, I.,
Lenox, J., Lieberman, M. and Radice, G. (2001). Rescuing the
N-cadherin knockout by cardiac-specific expression of N- or E-cadherin.
Development 128,459
-469.[Abstract]
May, S. R., Stewart, N. J., Chang, W. and Peterson, A. S.
(2004). A Titin mutation defines roles for circulation in
endothelial morphogenesis. Dev. Biol.
270, 31-46.[CrossRef][Medline]
Meeson, A., Palmer, M., Calfon, M. and Lang, R.
(1996). A relationship between apoptosis and flow during
programmed capillary regression is revealed by vital analysis.
Development 122,3929
-3938.[Abstract]
Miao, H. Q., Soker, S., Feiner, L., Alonso, J. L., Raper, J. A.
and Klagsbrun, M. (1999). Neuropilin-1 mediates
collapsin-1/semaphorin III inhibition of endothelial cell motility: functional
competition of collapsin-1 and vascular endothelial growth factor-165.
J. Cell Biol. 146,233
-242.
Moyon, D., Pardanaud, L., Yuan, L., Breant, C. and Eichmann,
A. (2001a). Plasticity of endothelial cells during
arterial-venous differentiation in the avian embryo.
Development 128,3359
-3370.
Moyon, D., Pardanaud, L., Yuan, L., Breant, C. and Eichmann,
A. (2001b). Selective expression of angiopoietin 1 and 2 in
mesenchymal cells surrounding veins and arteries of the avian embryo.
Mech. Dev. 106,133
-136.[CrossRef][Medline]
Mukouyama, Y. S., Gerber, H. P., Ferrara, N., Gu, C. and
Anderson, D. J. (2005). Peripheral nerve-derived VEGF
promotes arterial differentiation via neuropilin 1-mediated positive feedback.
Development 132,941
-952.
Pan, Q., Chanthery, Y., Liang, W. C., Stawicki, S., Mak, J.,
Rathore, N., Tong, R. K., Kowalski, J., Yee, S. F., Pacheco, G. et al.
(2007a). Blocking neuropilin-1 function has an additive effect
with anti-VEGF to inhibit tumor growth. Cancer Cell
11, 53-67.[CrossRef][Medline]
Pan, Q., Chanthery, Y., Wu, Y., Rahtore, N., Tong, R. K., Peale,
F., Bagri, A., Tessier-Lavigne, M., Koch, A. W. and Watts, R. J.
(2007b). Neuropilin-1 binds to VEGF121 and regulates endothelial
cell migration and sprouting. J. Biol. Chem.
282,24049
-24056.
Perryn, E. D., Czirok, A. and Little, C. D.
(2008). Vascular sprout formation entails tissue deformations and
VE-cadherin-dependent cell-autonomous motility. Dev.
Biol. 313,545
-555.[CrossRef][Medline]
Rupp, P. A., Czirok, A. and Little, C. D.
(2003). Novel approaches for the study of vascular assembly and
morphogenesis in avian embryos. Trends Cardiovasc.
Med. 13,283
-288.[CrossRef][Medline]
Soker, S., Takashima, S., Miao, H. Q., Neufeld, G. and
Klagsbrun, M. (1998). Neuropilin-1 is expressed by
endothelial and tumor cells as an isoform-specific receptor for vascular
endothelial growth factor. Cell
92,735
-745.[CrossRef][Medline]
Suchting, S., Freitas, C., le Noble, F., Benedito, R., Breant,
C., Duarte, A. and Eichmann, A. (2007). The Notch ligand
Delta-like 4 negatively regulates endothelial tip cell formation and vessel
branching. Proc. Natl. Acad. Sci. USA
104,3225
-3230.
Thoma, R. (1893). Untersuchungen
über die Histogenese und Histomechanikdes Gefässsytems.
Stuttgart: Ferdinand Enke.
Vieira, J. M., Schwarz, Q. and Ruhrberg, C.
(2007). Selective requirements for NRP-1 ligands during
neurovascular patterning. Development
134,1833
-1843.
Wakimoto, K., Kobayashi, K., Kuro, O. M., Yao, A., Iwamoto, T.,
Yanaka, N., Kita, S., Nishida, A., Azuma, S., Toyoda, Y. et al.
(2000). Targeted disruption of Na+/Ca2+
exchanger gene leads to cardiomyocyte apoptosis and defects in heartbeat.
J. Biol. Chem. 275,36991
-36998.
Yuan, L., Moyon, D., Pardanaud, L., Breant, C., Karkkainen, M.
J., Alitalo, K. and Eichmann, A. (2002). Abnormal lymphatic
vessel development in neuropilin 2 mutant mice.
Development 129,4797
-4806.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  A. Bagri, M. Tessier-Lavigne, and R. J. Watts Neuropilins in Tumor Biology Clin. Cancer Res., March 15, 2009; 15(6): 1860 - 1864. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Boulday, A. Blecon, N. Petit, F. Chareyre, L. A. Garcia, M. Niwa-Kawakita, M. Giovannini, and E. Tournier-Lasserve Tissue-specific conditional CCM2 knockout mice establish the essential role of endothelial CCM2 in angiogenesis: implications for human cerebral cavernous malformations Dis. Model. Mech., March 1, 2009; 2(3-4): 168 - 177. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Larrivee, C. Freitas, S. Suchting, I. Brunet, and A. Eichmann Guidance of Vascular Development: Lessons From the Nervous System Circ. Res., February 27, 2009; 104(4): 428 - 441. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Aitsebaomo, A. L. Portbury, J. C. Schisler, and C. Patterson Brothers and Sisters: Molecular Insights Into Arterial-Venous Heterogeneity Circ. Res., October 24, 2008; 103(9): 929 - 939. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
