|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 July 2008
doi: 10.1242/dev.021493
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Medicine, University of Michigan Medical School, Ann Arbor, MI
48109-0678. USA.
2 Departments of Internal Medicine and Pharmacology, UT Southwestern Medical
Center, Dallas, TX 75390-8857, USA.
Author for correspondence (e-mail:
ghammer{at}umich.edu)
Accepted 28 May 2008
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Adrenal cortex, β-Catenin, Cre-loxP, Gene knockout, Steroidogenic factor 1
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Kim and Hammer, 2007). A
distinct adrenal primordium is first detected around the 8th week of gestation
in humans and embryonic day 12 (E12.0) in mice
(Zubair et al., 2006). After
formation of the adrenal primordium, the adrenal cortex undergoes further
maturation and development to form a transient fetal zone (x-zone), which is
particularly well developed in the human adrenal gland, and the definitive
(adult) cortex. After birth, the fetal zone regresses, while presumptive
`stem/progenitor' cells adjacent to the capsule proliferate and renew the
definitive cortex through centripetal cellular repopulation
(Else and Hammer, 2005;
Kim and Hammer, 2007).
Analyses of humans with congenital adrenal hypoplasia and knockout mice
have identified various factors required for the initial specification and
subsequent development of the adrenal cortex, including the nuclear receptors
Sf1 and dosage-sensitive sex reversal, adrenal hypoplasia critical region, on
chromosome X, gene 1 (Dax1, Nr0b1); the transcriptional co-activator
CREB-binding protein/p300-interacting transactivator, with ED-rich tail, 2
(Cited2); and the Pre-B-cell leukemia homeobox1 (Pbx1)
(Bamforth et al., 2001;
Luo et al., 1994;
Moore et al., 1998;
Sadovsky et al., 1995;
Schnabel et al., 2003;
Zanaria et al., 1994). In
addition to transcriptional regulators, paracrine and morphogenic factors play
key roles in the development of the adrenal cortex. Targeted disruption of
Wnt4, a member of the `wingless-like MMTV integration site' family of
morphogens, was associated with abnormal differentiation of the definitive
zone of the adrenal cortex and ectopic expression of `adrenal-like' cells in
the gonads that was attributed to abnormal migration of adrenocortical
progenitor cells (Heikkila et al.,
2002; Jeays-Ward et al.,
2003; Val et al.,
2007). Analysis of a kindred with a complex phenotype that
includes renal and adrenal hypoplasia and lung abnormalities similarly
implicated WNT4 in human adrenal development
(Mandel et al., 2008).
Wnt members participate in various developmental processes during
embryogenesis; in adult tissues such as the skin, mammary gland, and
hematopoietic and central nervous systems, Wnts function in proliferation,
specification of cell fate, stem cell maintenance and differentiation
(Blanpain et al., 2007;
Logan and Nusse, 2004). In
this manuscript, we have focused on the role of the β-catenin signaling.
In the absence of Wnt ligands, the pool of β-catenin is sequestered to
the cellular membrane/cell adherence junctions and the cytoplasmic
concentration is maintained at low levels by ubiquitin-mediated proteolysis
through a degradation complex consisting of Axin/adenomatous polyposis
coli/glycogen synthase kinase 3 beta (Axin/Apc/Gsk3β). Upon binding of
Wnt ligands to their respective frizzled receptors, the degradation complex is
disrupted, which permits cytoplasmic and nuclear accumulation of
β-catenin. Inside the nucleus, β-catenin interacts with members of
the lymphoid enhancer-binding factor/T-cell factor (Lef/Tcf) family of
transcription factors to activate expression of target genes. β-Catenin
has also been shown to interact functionally with Sf1 to activate target genes
synergistically, including Nr0b1 (Dax1), Inha
(inhibin-
), Star (steroidogenic acute regulatory protein),
Hsd3b1 (3β-hydroxysteroid dehydrogenase), Cyp19a1
(aromatase) and Lhb (β-subunit of luteinizing hormone)
(Gummow et al., 2003;
Jordan et al., 2003;
Mizusaki et al., 2003;
Parakh et al., 2006;
Salisbury et al., 2007). These
studies raised the possibility that β-catenin also plays important roles
in adrenocortical development and function. Knockout (KO) mice that are
globally deficient in β-catenin undergo embryonic lethality during
gastrulation and lack mesoderm, precluding analysis of these potential defects
in adrenal development (Haegel et al.,
1995).
To define the role of β-catenin in the adrenal cortex, we used the Cre-loxP transgenic strategy to conditionally inactivate β-catenin alleles in the adrenal cortex. Depending on the extent of β-catenin inactivation, these studies revealed either complete adrenal aplasia during development or defects in maintenance of the adult cortex resulting in depletion of adrenocortical cells. Thus, β-catenin plays a crucial role in development and maintenance of the adrenal cortex.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
); other
sites of expression include pituitary gonadotropes, the ventromedial
hypothalamic nucleus, somatic cells of the gonads and the spleen. The
Sf1/Crelow transgene is a single-copy transgene that is
expressed at lower levels in the same sites. Mice carrying the floxed
β-catenin allele (Ctnnb1tm2kem) were purchased from
The Jackson Laboratory (Bar Harbor, ME); this conditional allele contains
loxP sites flanking exons 2-6, resulting in complete inactivation
upon Cre-mediated recombination (Brault et
al., 2001). The Cre-dependent reporter Z/AP
[Tg(ACTB-Bgeo/ALPP)1Lbe] was purchased from The Jackson Laboratory
(Lobe et al., 1999). The
LEF/Tcf-LacZ (Wnt-Gal) reporter transgenic mice were generously provided by
Daniel Dufort (Mohamed et al.,
2004).
Following timed matings, embryos were staged by designating noon of the day
on which the copulatory plug was detected as E0.5. Correct staging was
verified by appropriate morphological criteria as described
(Kaufman, 1992). Genotyping
for the Sf1/Cre transgenes and the β-catenin loxP alleles was
performed on the amnion of each embryo and in adult mice, as previously
described (Bingham et al.,
2006; Brault et al.,
2001; Truett et al.,
2000). Sexes were determined by PCR analysis with primers specific
for the Y-chromosome gene Zfy
(Jeyasuria et al., 2004).
Analysis of adrenal histology, immunohistochemistry and in situ hybridization analysis
Adrenal glands were collected at the indicated ages and fixed for 2-3 hours
in 4% paraformaldehyde/phosphate-buffered saline (PBS). Tissues were
dehydrated in graded ethanol solutions and embedded in paraffin before
sectioning. Sections were cut at 6 µm and processed using standard
procedures.
For immunohistochemical analyses, adrenal glands were processed as above and washed in Tris-buffered saline/0.1% Tween-20 (TBST, pH 7.5). Antigen retrieval was performed by boiling rehydrated sections in 10 mM sodium citrate (pH 6.0) for 20 minutes, followed by one wash in deionized water and two washes in TBST at room temperature. Antibody staining was conducted using VECTASTAIN ABC kits and Vector Mouse on Mouse (M.O.M.) kits according to manufacturer's protocol (Vector Laboratories, Burlingame, CA). Tissue sections were blocked in antibody diluent solution for 1 hour, and then incubated overnight at 4°C with anti-β-catenin (H-102) (1:500, Santa Cruz Biotechnology, Santa Cruz, CA), anti-tyrosine hydroxylase (1:500, Pel-Freez Biologicals, Rogers, AR) or either of two antibodies against Sf1: A (1:1000 dilution and generously provided by Dr Ken Morohashi) or B [1:1500 dilution of a rabbit antiserum raised against recombinantly expressed, full-length SF1 protein that was affinity purified as a GST fusion protein and then liberated by thrombin cleavage using standard methods (Invitrogen, Carlsbad, CA)]. The next day, sections were washed, exposed to secondary antibodies and processed for signal detection according to the manufacturer's protocol.
For X-gal staining, tissues were collected at indicated ages. The tissues were prefixed in a lacZ fixation solution (2.7% formaldehyde, 0.20% glutaraldehyde, 2 mM MgCl2, 5 mM EGTA, 0.02% NP-40, PBS) for 10 minutes, followed by three washes in PBS. The X-gal staining was performed using the β-Gal Staining Set (Roche Applied Science, Indianapolis, IN) following the manufacturer's protocol. The tissues were stained for 24 hours and then post-fixed in 4% formaldehyde/PBS solution for 1 hour. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay for DNA fragmentation was performed using the In Situ Cell Death Detection Kit (Roche Applied Science, Indianapolis, IN) following the manufacturer's protocol.
For in situ hybridization, embryos were collected at the indicated stages, fixed for 4 hours in 4% paraformaldehyde (PFA) and cryoprotected in 20% sucrose overnight. Embryos were embedded in OCT compound (Tissue Tek Sakura, Torrance, CA) and transverse sections were cut at 12 µm. Nonradioactive in situ hybridization analysis using digoxigenin-labeled probes was performed according to standard procedure; a specific protocol is available from the authors upon request. Probes used in this study were 3β-hydroxysteroid dehydrogenase (3β-HSD, Accession Number NM_008293, 512-1523), side-chain cleavage enzyme (Cyp11a1, Accession Number NM_019779, 132-691) and 21-hydroxylase (Cyp21, Accession Number NM_009995, 469-1554).
To examine cell proliferation in E12.5 and E13.5 embryos, the BrdU Labeling and Detection Kit II (Roche, Indianapolis, IN) was used. Pregnant mothers were injected at the appropriate stages with BrdU (B-500, Sigma-Aldrich, St Louis, MO; 50 mg/kg body weight) and embryos were harvested 1 hour later and then processed as described above. Slides containing 5 µm sagittal sections were treated according to the manufacturer's protocol with alkaline phosphatase (AP) as the detection agent, followed by NBT/BCIP visualization. The slides were then stained with anti-Sf1 antiserum B to identify adrenocortical cells. Singly- and doubly-stained nuclei were counted in serial (at least three) sections of each genotype (wild type and knockout) at each age. Statistical significance was calculated using Student's t-test.
Southern blotting
The Sf1/Crehigh and Sf1/Crelow
transgenic mouse lines were prepared and analyzed as previously described
(Bingham et al., 2006), except
that copy number was determined by ImageJ (NIH, Bethesda, MD). Briefly, the
probe contains sequences from the first intron of Sf1; following digestion of
genomic DNA with restriction endonucleases (EcoRI, EcoRV,
NcoI), the probe hybridizes to DNA fragments of 4 kb (endogenous
gene) and 2.6 kb (Sf1/Cre transgene), respectively. The copy number is
determined by relative intensities of the signal for the endogenous gene (two
copies) and that produced by the transgene (five copies for
Sf1/Crehigh and one copy for Sf1/Crelow).
Real-time PCR
Adrenal glands were removed, cleaned and snap frozen. Frozen tissues were
lysed in Trizol reagent using an electric tissue homogenizer, and total RNA
was prepared according to the manufacturer's protocol. Total RNA was treated
with DNase (Ambion, Austin, TX) to remove residual genomic DNA and quantitated
by UV spectrometry. Total RNA (1 µg) was used to synthesize cDNA using the
iScript kit (Bio-Rad, Hercules, CA) according to the manufacturer's protocol.
The final cDNA products were purified and eluted in 50 µl of Tris-EDTA
buffer using PCR purification columns (QIAGEN, Hilden, Germany) or directly
diluted to final volume. Primer sequences for each gene are: human placental
alkaline phosphatase (hAP), fwd-5' ctgctgccctccagacat and
rev-5' cgggttctcctcctcaact; Axin2, fwd-5'
gcaggagcctcacccttc and rev-5' tgccagtttctttggctctt; tyrosine hydroxylase
(Th), fwd-5' cccaagggcttcagaagag and rev-5'
gggcatcctcgatgagact; Sf1, fwd-5' acaagcattacacgtgcacc and
rev-5' tgactagcaaccaccttgcc; glyceraldehyde 3-phosphate dehydrogenase
(Gapdh), fwd-5' aatgtgtccgtcgtggatct and rev-5'
cccagctctccccatcacta; Hsd3b1 (3β-Hsd), fwd-5'
cagtttgtgtcttgggcttaaca and rev-5' gcagatcacagtgggagtga;
Cyp11b2, fwd-5' gcaccaggtggagagtatgc and rev-5'
gccattctggcccatttag; Cyp21a1, fwd-5' gacccaggagttctgtgagc and
rev-5' tccaaaagtgaggcaggaga; Star, fwd-5'
aaggctggaagaaggaaagc and rev-5' ccacatctggcaccatctta; Actb1
(β-actin), fwd-5' ctaaggccaaccgtgaaaadg and rev-5'
accagaggcatacagggaca.
For quantitative, real-time PCR (qRT-PCR) analyses of mRNA abundance, reactions were performed with a 2x SYBR Green PCR mastermix (Applied Biosystems, Foster City, CA) and gene-specific primers in the ABI 7300 thermocycler (Applied Biosystems, Foster City, CA). Each quantitative measurement was normalized to Rox dye as an internal standard and performed in triplicate. Transcript abundance was normalized in each sample to the average Ct value for mouse Gapdh and β-actin (Livak et al., 2001). For mRNA quantitation, a minimum of three samples from differing genotypes was analyzed. Statistical significance was calculated using Student's t-test.
|
ACTH measurements
All mice were individually housed for 24 hours preceding all procedures in
a low stress environment. Baseline blood samples were obtained at 09:00 hours
by decapitation and collection of core-trunk blood within 30 seconds of
initial mouse handling to minimize stress-induced ACTH secretion. Blood plasma
was collected using the Microvette CB 300 blood collection tube (Sarstedt,
Germany) and stored at -80°C prior to analysis. The ACTH analysis was
conducted through Vanderbilt Hormone Assay & Analytical Services Core
(Vanderbilt University, Nashville, TN). Statistical significance was
calculated using one-way analysis of variance (ANOVA) and Tukey post-hoc
test.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
At E12.5, lacZ staining (indicative of canonical Wnt signaling) was seen in a few cells in the outer region of the gland, immediately adjacent to the emerging adrenal capsule. The establishment of the capsule and the restricted subcapsular localization of lacZ were more evident at E18.5. In the newborn adrenal gland (Fig. 1, P0), active canonical Wnt signaling, as visualized by lacZ expression, was seen in discrete clusters of cells at the periphery of the adrenal cortex, again immediately beneath the capsule. By 3 weeks of age, lacZ expression in the immediate subcapsular region was more uniform and corresponded more closely to the expression pattern for β-catenin. Moreover, the expression and the active β-catenin signaling in the fetal/X-zone are not observed. These observations were confirmed using a different Wnt-reporter strain (BAT-Gal, data not shown). Importantly, we observed active β-catenin signaling - as revealed by lacZ expression - in only a subset of subcapsular cells expressing β-catenin protein (Fig. 1). This observation is consistent with the premise that only a subset of adrenocortical cells maintains active canonical β-catenin signaling through Lef/Tcf transcription factors at any given time. Together, these data define the establishment of canonical Wnt signaling, which activates β-catenin dependent transcription in the presumptive adrenocortical stem/progenitor cells of the definitive cortex as it organizes under the developing capsule.
|
). To visually and quantitatively determine the
efficiency of the Cre-mediated recombination in the adrenal cortices of the
two Sf1/Cre transgenic lines, we generated mice carrying the Cre transgenes
and the Cre-dependent reporter Z/AP
(Lobe et al., 1999). These
reporter mice initially express the lacZ reporter gene; following
Cre-mediated recombination, they silence lacZ and express human
placental alkaline phosphatase (hAP). As revealed by expression of
lacZ (Fig. 2B), the
recombination efficiencies of the two Sf1/Cre transgenes differed in adrenal
glands at 6 weeks of age. The Sf1/Crelow transgene
mediated only partial recombination of the reporter gene, as evidenced by
persistent lacZ staining in some cortical cells. By contrast, the
Sf1/Crehigh transgene completely abolished lacZ
expression in the adrenal cortex, suggesting that it mediates Cre-dependent
recombination in the adrenal cortex in a highly efficient manner. Moreover,
quantitative PCR analyses of adrenal expression of hAP confirmed the different
efficiencies of Cre-mediated recombination for the two Sf1/Cre transgenes
(Fig. 2C), with approximately
threefold higher expression of hAP in Z/AP mice carrying the
Sf1/Crehigh transgene than in those with the
Sf1/Crelow transgene. The results indicate that the Cre
protein in Sf1/Crelow adrenals is expressed in a lower number of
cells of the cortex than that in Sf1/Crehigh mice.
β-catenin KO mediated by the Sf1/Crehigh transgene causes adrenal aplasia
Having characterized the relative efficiencies of the two Sf1/Cre
transgenes in driving Cre-mediated recombination, we next examined their
functional effect on the conditional β-catenin allele
(Ctnnb1tm2kem), crossing mice with either the
Sf1/Crelow or the Sf1/Crehigh
transgene and one copy of the floxed β-catenin allele with mice that were
homozygous for the floxed β-catenin allele.
Direct effects of Sf1/Crehigh-mediated β-catenin KO on β-catenin expression were examined using immunohistochemical assays with an anti-β-catenin antibody. As shown in Fig. 3A (and similar to results in Fig. 1), β-catenin at E12.5 was expressed in the wild-type adrenal primordium, as well as in other regions of the embryo (top panels). Thereafter (E14.5 and E16.5), the cells that expressed β-catenin again localized as a thin layer of cells near the subcapsular zone at the periphery of the adrenal cortex. In the Sf1/Crehigh-mediated β-catenin KO mice, by contrast, adrenal immunoreactivity for β-catenin was not detected in sections at any of these stages (Fig. 3C, bottom panels), indicating that the Sf1/Crehigh transgene caused complete ablation of β-catenin expression. These studies document that Cre recombinase driven by the Sf1/Crehigh transgene abrogates expression of β-catenin at very early stages of adrenal development.
Based on the striking effect on β-catenin expression, we next examined adrenal development at different stages, focusing both on histology (Fig. 3B) and on expression of Sf1 (Fig. 3C). At E12.5, the developing testis was visible as a group of cells under the coelomic epithelium, some of which expressed Sf1. Immediately adjacent to this gonadal precursor are cells that comprise the adrenal primordium, which also expressed Sf1 (Fig. 3B). At this early developmental stage, we observed relatively subtle histological differences between wild-type and β-catenin KO mice (Fig. 3 B), although the apparent decrease in the number of Sf1-positive cells (Fig. 3C) suggests that the adrenal primordium is already affected by the conditional β-catenin KO.
By E14.5, the β-catenin KO adrenal glands were smaller than their wild-type counterparts (Fig. 3B) and contained considerably fewer Sf1-positive cells (Fig. 3C); very similar findings were observed in sections from E16.5 embryos. In fact, many of the cells remaining in the region where the adrenal gland normally resides at E16.5 expressed Th, identifying them as chromaffin cell precursors derived from the neural crest. Finally, by E18.5, all remnants of an adrenal gland, including the presumptive chromaffin cells (Fig. 3B), had disappeared.
Based on the striking effect of β-catenin inactivation on adrenal structure, we also used in situ hybridization analyses to examine the effect on expression of several steroidogenic enzymes. As shown in Fig. 4, the cholesterol side-chain cleavage enzyme (Cyp11a1), 3β-hydroxysteroid dehydrogenase (3β-HSD) and 21-hydroxylase (Cyp21) normally are expressed in a subset of cells within the adrenal primordium at E12.5, with higher expression seen at E13.5. By marked contrast, expression of Cyp11a1 and 3β-HSD was decreased relative to wild-type levels at E12.5; even greater apparent differences in expression of all three steroidogenic enzymes in β-catenin KO mice was apparent at E13.5. These studies suggest that β-catenin is directly or indirectly required for the expression of multiple components of the steroidogenic pathway in the adrenal gland from very early stages of differentiation.
|
),
whereas studies in mice with Leydig cell-specific disruption of Sf1 showed
that gonadal proliferation is markedly decreased
(Jeyasuria et al., 2004). We
therefore used BrdU labeling to assess proliferation in mice with
Sf1/Crehigh-driven ablation of β-catenin. As shown in
Fig. 5, BrdU incorporation in
the region of the adrenal primordium in the KO mice did not differ from that
seen in wild-type mice at E12.5 but was decreased considerably at E13.5.
Consistent with our previous observation that the absence of β-catenin
affects adrenal development from very early stages
(Fig. 3B), the total number of
Sf1-expressing cells in the KO mice was significantly decreased at both time
points. The decreased number of cells labeled with BrdU supports an important
role for β-catenin in regulating cell proliferation in the embryonic
adrenal gland. By contrast, apoptosis - as revealed by TUNEL staining for DNA
fragmentation - did not differ significantly in the same region of the
developing adrenal gland (data not shown). Thus, decreased proliferation
apparently is the predominant factor in the adrenocortical regression seen in
mice with β-catenin KO driven by the Sf1/Crehigh
transgene.
|
|
To explore the effects of the Sf1/Crelow-mediated
disruption of β-catenin on postnatal adrenocortical function, we examined
the extent of inhibition of subcapsular canonical Wnt signaling mediated by
the Sf1/Crelow transgene. Crossing the
Sf1/Crelow transgene into the Lef/Tcf-lacZ
(Wnt-Gal) reporter revealed that the field of subcapsular cells still
expressing lacZ was diminished by 
50% in these mice
(Fig. 6B), coincident with a
roughly comparable decrease in the expression of the canonical
Wnt/β-catenin target gene Axin2 (Fig.
6C). Therefore, the Sf1/Crelow transgene
inactivates the β-catenin gene (and hence canonical Wnt signaling) in
only a subset of adrenocortical cells. This finding was supported by direct
analysis of Cre-mediated recombination of β-catenin in genomic DNA
samples from adrenal glands of mice with the differing genotypes
(Fig. 6D). Although the
presence of adrenal medullary cells can potentially influence these analyses,
the cortical-specific expression of the Sf1/Cre transgene and lack of
active Wnt signaling in the medulla makes these concerns negligible.
Therefore, these data are consistent with the model that partial but not
complete recombination of β-catenin occurs in the
Sf1/Crelow mice. Similarly, the presence of
lacZ-positive cortical cells in Sf1/Crelow/Z/AP
mice (Fig. 2B) indicates that
some cells in the Sf1/Crelow adrenal did not undergo Cre-mediated
recombination, which presumably permits survival of cells that have the
potential to engage β-catenin signaling.
|
To explore the mechanism of this postnatal adrenocortical depletion, we performed TUNEL staining to assess DNA fragmentation, which is indicative of apoptosis (Fig. 7). Although the adrenal glands in the Sf1/Crelow β-catenin KO mice at 15 weeks were relatively intact histologically, an increase in TUNEL staining in the adrenal cortex was consistent with increased cell death via apoptosis occurring at this time. The marked increase in TUNEL staining in the adrenals of Sf1/Crelow β-catenin KO mice at 30 weeks (Fig. 7) indicates that the loss of β-catenin in the adrenal cortex progressively contributes to loss of adrenocortical tissue via apoptosis. We also observed increased TUNEL staining in the adrenal medulla of 30-week old Sf1/Crelow β-catenin KO mice (Fig. 7), consistent with the known roles of the cortex in maintaining medullary function.
Following the observation of cortical thinning and disorganization in 50% of conditional β-catenin KO mice at 30 week, we stratified these mice into two groups (histological failure versus no histological failure) and analyzed these mice in more detail with regards to adrenal size, ACTH levels and steroidogenic enzyme expression. We predicted that mice with histological failure would have smaller adrenal glands with a compensatory elevation in ACTH levels with or without a decrease in steroidogenic enzyme expression. As shown in Table 1, the KO mice with clear histological failure (n=3) have a significant reduction in adrenal mass compared with both wild-type and the KO mice without evidence of histological failure, consistent with the observed stochastic rate of cortical depletion. In addition, these mice have significantly elevated basal ACTH levels compared with wild type (n=6) and with KO mice without histological failure (n=3). Last, the expression of a panel of steroidogenic genes in individual KO mice with histological failure was routinely decreased compared with mean values in wild-type mice (Fig. 8). These qPCR studies also supported the apparent decrease in immunohistochemical detection of Sf1 described above. The reciprocal elevation in ACTH and reduction in cortical size with concordant decrease in steroidogenic enzyme expression is consistent with developing adrenal failure.
|
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), perhaps owing to potential roles of Wnt4 in additional
noncanonical Wnt signaling (Brisken et al.,
2000; Stark et al.,
1994; Vainio et al.,
1999), to the activation of the canonical pathway in the adrenal
gland by additional Wnt ligands, or to Wnt-independent actions of
β-catenin (Hino et al.,
2005; Taurin et al.,
2006).
Regardless, β-catenin can be included in the small group of
transcriptional regulators, including Sf1, Dax1, Wt1 Pbx1 and Cited2, the
deficiency of which causes complete adrenal absence. Although further studies
will be needed to define the molecular mechanisms of β-catenin signaling
in adrenocortical cells, the reported synergy between β-catenin and Sf1
suggests that these two genes may interact to regulate the expression of
crucial target gene(s) whose expression is essential to stimulate
adrenocortical proliferation and/or inhibit apoptosis. Of interest, proposed
target genes of both β-catenin and Sf1 include a number of genes that
regulate proliferation, providing plausible candidates for this co-regulation
(Doghman et al., 2007;
Gummow et al., 2003;
Jordan et al., 2003;
Mizusaki et al., 2003;
Parakh et al., 2006;
Salisbury et al., 2007).
Moreover, mutations and/or amplification of both Sf1 and β-catenin have
been linked to adrenocortical tumorigenesis in humans, again suggesting that
these two genes play key roles in adrenocortical cell proliferation in vivo
(Figueiredo et al., 2005;
Tissier et al., 2005). Sf1
exhibits marked dose-dependent effects on growth, as revealed by the impaired
adrenal development seen in mice with Sf1 haploinsufficiency
(Beuschlein et al., 2002;
Bland et al., 2004;
Bland et al., 2000). By
contrast, haploinsufficiency for β-catenin apparently is compatible with
normal adrenocortical function, as we observed no obvious adrenal phenotype in
mice carrying the Sf1/Crehigh transgene and one
conditional β-catenin allele. Given our model that these transcriptional
co-regulators cooperate in adrenocortical organogenesis, the basis for their
differing dose dependence is an important area for further investigation.
|
The presence of cells that express Th in the region of the adrenal
gland argues strongly that the common sympathoadrenal precursors can
differentiate into chromaffin cells, despite the marked depletion of
Sf1-expressing adrenocortical cells. Although cell culture studies suggested
an obligatory role for steroid hormones in the differentiation of these
precursors into chromaffin cells (Anderson,
1993), studies with Sf1 KO mice demonstrated that the complete
loss of steroidogenic adrenocortical cells was compatible with the
differentiation of sympathoadrenal precursors into cells that exhibited
several characteristics of chromaffin cells
(Gut et al., 2005). Although
we have not explored the function of these cells in detail, they apparently
disappear from the region of the adrenal gland by E18.5, arguing that the
adrenal cortex plays important roles in supporting their continued survival.
The enhanced TUNEL staining in the postnatal adrenal medulla of mice with
Sf1/Crelow-mediated β-catenin KO
(Fig. 6) is consistent with
this model.
The Sf1/Cre transgenes are expressed in the anterior pituitary gland
(Bingham et al., 2006), and
defects in pituitary expression of corticotropin are associated with impaired
development of the adrenal cortex. However, the Sf1/Cre transgenes are not
expressed in pituitary corticotropes, and even complete absence of
corticotropin does not cause agenesis/aplasia of the adrenal gland. Moreover,
ACTH levels in the Sf1/Crelow β-catenin KO mice with
histological failure were higher than those in wild-type mice and KO mice
without clear histological failure, suggesting a primary defect in adrenal
function. Although defining the effects of Sf1/Cre-mediated disruption of
β-catenin in other sites such as the anterior pituitary, ventromedial
hypothalamic nucleus and gonads is an important area for future studies, the
finding that surviving adrenal cells are those that have not inactivated the
floxed lacZ Cre reporter (Fig.
2) argues that these are cell-autonomous adrenal effects rather
than the result of external perturbations. Thus, it is extremely unlikely that
the phenotype observed here reflects secondary effects on the adrenal cortex
due to disruption in other sites.
The available data from other tissues suggest the importance of canonical
Wnt signaling in the development and maintenance of organ systems
(Dessimoz et al., 2005;
Huelsken et al., 2001;
Reya and Clevers, 2005;
Rulifson et al., 2007;
Zechner et al., 2003). For
example, Wnt signaling in hair follicles is localized to the stem cell
population. Within the adrenal cortex, active canonical signaling is seen in
the developing adrenal primordium from E12.5. As the definitive cortex
subsequently emerges, Wnt signaling increasingly becomes restricted to the
subcapsular area of the cortex, coincident with the organization of the
surrounding capsule. Although definitive studies identifying the capsular and
subcapsular cells as the bona fide adrenocortical niche/stem-progenitor unit
are lacking (Kim and Hammer,
2007), the data presented here indicate that canonical Wnt
signaling in these cells is crucial for the development of the definitive
cortex and maintenance of the adult gland.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Anderson, D. J. (1993). Molecular control of cell fate in the neural crest: the sympathoadrenal lineage. Annu. Rev. Neurosci. 16,129 -158.[Medline]
Bamforth, S. D., Braganca, J., Eloranta, J. J., Murdoch, J. N., Marques, F. I., Kranc, K. R., Farza, H., Henderson, D. J., Hurst, H. C. and Bhattacharya, S. (2001). Cardiac malformations, adrenal agenesis, neural crest defects and exencephaly in mice lacking Cited2, a new Tfap2 co-activator. Nat. Genet. 29,469 -474.[CrossRef][Medline]
Beuschlein, F., Mutch, C., Bavers, D. L., Ulrich-Lai, Y. M.,
Engeland, W. C., Keegan, C. and Hammer, G. D. (2002).
Steroidogenic factor-1 is essential for compensatory adrenal growth following
unilateral adrenalectomy. Endocrinology
143,3122
-3135.
Bingham, N. C., Verma-Kurvari, S., Parada, L. F. and Parker, K. L. (2006). Development of a steroidogenic factor 1/Cre transgenic mouse line. Genesis 44,419 -424.[CrossRef][Medline]
Bland, M. L., Jamieson, C. A., Akana, S. F., Bornstein, S. R.,
Eisenhofer, G., Dallman, M. F. and Ingraham, H. A. (2000).
Haploinsufficiency of steroidogenic factor-1 in mice disrupts adrenal
development leading to an impaired stress response. Proc. Natl.
Acad. Sci. USA 97,14488
-14493.
Bland, M. L., Fowkes, R. C. and Ingraham, H. A.
(2004). Differential requirement for steroidogenic factor-1 gene
dosage in adrenal development versus endocrine function. Mol.
Endocrinol. 18,941
-952.
Blanpain, C., Horsley, V. and Fuchs, E. (2007). Epithelial stem cells: turning over new leaves. Cell 128,445 -458.[CrossRef][Medline]
Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P., Sommer, L., Boussadia, O. and Kemler, R. (2001). Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128,1253 -1264.[Abstract]
Brisken, C., Heineman, A., Chavarria, T., Elenbaas, B., Tan, J.,
Dey, S. K., McMahon, J. A., McMahon, A. P. and Weinberg, R. A.
(2000). Essential function of Wnt-4 in mammary gland development
downstream of progesterone signaling. Genes Dev.
14,650
-654.
Dessimoz, J., Bonnard, C., Huelsken, J. and Grapin-Botton, A. (2005). Pancreas-specific deletion of beta-catenin reveals Wnt-dependent and Wnt-independent functions during development. Curr. Biol. 15,1677 -1683.[CrossRef][Medline]
Doghman, M., Karpova, T., Rodrigues, G. A., Arhatte, M., De
Moura, J., Cavalli, L. R., Virolle, V., Barbry, P., Zambetti, G. P.,
Figueiredo, B. C. et al. (2007). Increased steroidogenic
factor-1 dosage triggers adrenocortical cell proliferation and cancer.
Mol. Endocrinol. 21,2968
-2987.
Else, T. and Hammer, G. D. (2005). Genetic analysis of adrenal absence: agenesis and aplasia. Trends Endocrinol. Metab. 16,458 -468.[CrossRef][Medline]
Figueiredo, B. C., Cavalli, L. R., Pianovski, M. A., Lalli, E.,
Sandrini, R., Ribeiro, R. C., Zambetti, G., DeLacerda, L., Rodrigues, G. A.
and Haddad, B. R. (2005). Amplification of the steroidogenic
factor 1 gene in childhood adrenocortical tumors. J. Clin.
Endocrinol. Metab. 90,615
-619.
Gummow, B. M., Winnay, J. N. and Hammer, G. D.
(2003). Convergence of Wnt signaling and steroidogenic factor-1
(SF1) on transcription of the rat inhibin alpha gene. J. Biol.
Chem. 278,26572
-26579.
Gut, P., Huber, K., Lohr, J., Bruhl, B., Oberle, S., Treier, M.,
Ernsberger, U., Kalcheim, C. and Unsicker, K. (2005). Lack of
an adrenal cortex in Sf1 mutant mice is compatible with the generation and
differentiation of chromaffin cells. Development
132,4611
-4619.
Haegel, H., Larue, L., Ohsugi, M., Fedorov, L., Herrenknecht, K. and Kemler, R. (1995). Lack of beta-catenin affects mouse development at gastrulation. Development 121,3529 -3537.[Abstract]
Heikkila, M., Peltoketo, H., Leppaluoto, J., Ilves, M.,
Vuolteenaho, O. and Vainio, S. (2002). Wnt-4 deficiency
alters mouse adrenal cortex function, reducing aldosterone production.
Endocrinology 143,4358
-4365.
Hino, S., Tanji, C., Nakayama, K. I. and Kikuchi, A.
(2005). Phosphorylation of beta-catenin by cyclic AMP-dependent
protein kinase stabilizes beta-catenin through inhibition of its
ubiquitination. Mol. Cell. Biol.
25,9063
-9072.
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and Birchmeier, W. (2001). beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105,533 -545.[CrossRef][Medline]
Jeays-Ward, K., Hoyle, C., Brennan, J., Dandonneau, M., Alldus,
G., Capel, B. and Swain, A. (2003). Endothelial and
steroidogenic cell migration are regulated by WNT4 in the developing mammalian
gonad. Development 130,3663
-3670.
Jeyasuria, P., Ikeda, Y., Jamin, S. P., Zhao, L., De Rooij, D.
G., Themmen, A. P., Behringer, R. R. and Parker, K. L.
(2004). Cell-specific knockout of steroidogenic factor 1 reveals
its essential roles in gonadal function. Mol.
Endocrinol. 18,1610
-1619.
Jordan, B. K., Shen, J. H., Olaso, R., Ingraham, H. A. and
Vilain, E. (2003). Wnt4 overexpression disrupts normal
testicular vasculature and inhibits testosterone synthesis by repressing
steroidogenic factor 1/beta-catenin synergy. Proc. Natl. Acad. Sci.
USA 100,10866
-10871.
Kaufman, M. (1992). The Atlas of Mouse Development. London: Academic Press.
Kim, A. C. and Hammer, G. D. (2007). Adrenocortical cells with stem/progenitor cell properties: recent advances. Mol. Cell. Endocrinol. 265-266,10 -16.
Livak, K. J., Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25,402 -408.[CrossRef][Medline]
Lobe, C. G., Koop, K. E., Kreppner, W., Lomeli, H., Gertsenstein, M. and Nagy, A. (1999). Z/AP, a double reporter for cre-mediated recombination. Dev. Biol. 208,281 -292.[CrossRef][Medline]
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 20,781 -810.[CrossRef][Medline]
Luo, X., Ikeda, Y. and Parker, K. L. (1994). A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77,481 -490.[CrossRef][Medline]
Mandel, H., Shemer, R., Borochowitz, Z. U., Okopnik, M., Knopf, C., Indelman, M., Drugan, A., Tiosano, D., Gershoni-Baruch, R., Choder, M. et al. (2008). SERKAL syndrome: an autosomal-recessive disorder caused by a loss-of-function mutation in WNT4. Am. J. Hum. Genet. 82,39 -47.[CrossRef][Medline]
Mizusaki, H., Kawabe, K., Mukai, T., Ariyoshi, E., Kasahara, M.,
Yoshioka, H., Swain, A. and Morohashi, K. (2003). Dax-1
(dosage-sensitive sex reversal-adrenal hypoplasia congenita critical region on
the X chromosome, gene 1) gene transcription is regulated by wnt4 in the
female developing gonad. Mol. Endocrinol.
17,507
-519.
Mohamed, O. A., Clarke, H. J. and Dufort, D. (2004). Beta-catenin signaling marks the prospective site of primitive streak formation in the mouse embryo. Dev. Dyn. 231,416 -424.[CrossRef][Medline]
Moore, A. W., Schedl, A., McInnes, L., Doyle, M., Hecksher-Sorensen, J. and Hastie, N. D. (1998). YAC transgenic analysis reveals Wilms' tumour 1 gene activity in the proliferating coelomic epithelium, developing diaphragm and limb. Mech. Dev. 79,169 -184.[CrossRef][Medline]
Parakh, T. N., Hernandez, J. A., Grammer, J. C., Weck, J.,
Hunzicker-Dunn, M., Zeleznik, A. J. and Nilson, J. H. (2006).
Follicle-stimulating hormone/cAMP regulation of aromatase gene expression
requires beta-catenin. Proc. Natl. Acad. Sci. USA
103,12435
-12440.
Reya, T. and Clevers, H. (2005). Wnt signalling in stem cells and cancer. Nature 434,843 -850.[CrossRef][Medline]
Rulifson, I. C., Karnik, S. K., Heiser, P. W., ten Berge, D.,
Chen, H., Gu, X., Taketo, M. M., Nusse, R., Hebrok, M. and Kim, S. K.
(2007). Wnt signaling regulates pancreatic beta cell
proliferation. Proc. Natl. Acad. Sci. USA
104,6247
-6252.
Sadovsky, Y., Crawford, P. A., Woodson, K. G., Polish, J. A.,
Clements, M. A., Tourtellotte, L. M., Simburger, K. and Milbrandt, J.
(1995). Mice deficient in the orphan receptor steroidogenic
factor 1 lack adrenal glands and gonads but express P450 side-chain-cleavage
enzyme in the placenta and have normal embryonic serum levels of
corticosteroids. Proc. Natl. Acad. Sci. USA
92,10939
-10943.
Salisbury, T. B., Binder, A. K., Grammer, J. C. and Nilson, J.
H. (2007). Maximal activity of the luteinizing hormone
beta-subunit gene requires beta-catenin. Mol.
Endocrinol. 21,963
-971.
Schnabel, C. A., Selleri, L. and Cleary, M. L. (2003). Pbx1 is essential for adrenal development and urogenital differentiation. Genesis 37,123 -130.[CrossRef][Medline]
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P. (1994). Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372,679 -683.[CrossRef][Medline]
Taurin, S., Sandbo, N., Qin, Y., Browning, D. and Dulin, N.
O. (2006). Phosphorylation of beta-catenin by cyclic
AMP-dependent protein kinase. J. Biol. Chem.
281,9971
-9976.
Tissier, F., Cavard, C., Groussin, L., Perlemoine, K., Fumey,
G., Hagnere, A. M., Rene-Corail, F., Jullian, E., Gicquel, C., Bertagna, X. et
al. (2005). Mutations of beta-catenin in adrenocortical
tumors: activation of the Wnt signaling pathway is a frequent event in both
benign and malignant adrenocortical tumors. Cancer
Res. 65,7622
-7627.
Truett, G. E., Heeger, P., Mynatt, R. L., Truett, A. A., Walker, J. A. and Warman, M. L. (2000). Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 29,52 -54.[Medline]
Vainio, S., Heikkila, M., Kispert, A., Chin, N. and McMahon, A. P. (1999). Female development in mammals is regulated by Wnt-4 signalling. Nature 397,405 -409.[CrossRef][Medline]
Val, P., Martinez-Barbera, J. P. and Swain, A.
(2007). Adrenal development is initiated by Cited2 and Wt1
through modulation of Sf1 dosage. Development
134,2349
-2358.
Zanaria, E., Muscatelli, F., Bardoni, B., Strom, T. M., Guioli, S., Guo, W., Lalli, E., Moser, C., Walker, A. P., McCabe, E. R. et al. (1994). An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 372,635 -641.[CrossRef][Medline]
Zechner, D., Fujita, Y., Hulsken, J., Muller, T., Walther, I., Taketo, M. M., Crenshaw, E. B., 3rd, Birchmeier, W. and Birchmeier, C. (2003). beta-Catenin signals regulate cell growth and the balance between progenitor cell expansion and differentiation in the nervous system. Dev. Biol. 258,406 -418.[CrossRef][Medline]
Zubair, M., Ishihara, S., Oka, S., Okumura, K. and Morohashi,
K. (2006). Two-step regulation of Ad4BP/SF1 gene
transcription during fetal adrenal development: initiation by a Hox-Pbx1-Prep1
complex and maintenance via autoregulation by Ad4BP/SF1. Mol. Cell.
Biol. 26,4111
-4121.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  A. C. Kim, F. M. Barlaskar, J. H. Heaton, T. Else, V. R. Kelly, K. T. Krill, J. O. Scheys, D. P. Simon, A. Trovato, W.-H. Yang, et al. In Search of Adrenocortical Stem and Progenitor Cells Endocr. Rev., May 1, 2009; 30(3): 241 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Hoeflich and M. Bielohuby Mechanisms of adrenal gland growth: signal integration by extracellular signal regulated kinases1/2 J. Mol. Endocrinol., March 1, 2009; 42(3): 191 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bielinska, H. Parviainen, S. Kiiveri, M. Heikinheimo, and D. B. Wilson REVIEW PAPER: Origin and Molecular Pathology of Adrenocortical Neoplasms Vet. Pathol., March 1, 2009; 46(2): 194 - 210. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-F. Liu, N. Bingham, K. Parker, and H. H.-C. Yao Sex-specific roles of {beta}-catenin in mouse gonadal development Hum. Mol. Genet., February 1, 2009; 18(3): 405 - 417. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
