spacer gif spacer gif spacer gif spacer gif spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 28 May 2008
doi: 10.1242/dev.019299

Development 135, 2603-2614 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.019299v1
135/15/2603    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Budi, E. H.
Right arrow Articles by Parichy, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Budi, E. H.
Right arrow Articles by Parichy, D. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Embryonic requirements for ErbB signaling in neural crest development and adult pigment pattern formation

Erine H. Budi, Larissa B. Patterson and David M. Parichy*

Department of Biology, Institute for Stem Cell and Regenerative Medicine, University of Washington, Box 351800, Seattle, WA 98195-1800, USA.

* Author for correspondence (e-mail: dparichy{at}u.washington.edu)

Accepted 19 March 2008


   SUMMARY
TOP
 SUMMARY
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vertebrate pigment cells are derived from neural crest cells and are a useful system for studying neural crest-derived traits during post-embryonic development. In zebrafish, neural crest-derived melanophores differentiate during embryogenesis to produce stripes in the early larva. Dramatic changes to the pigment pattern occur subsequently during the larva-to-adult transformation, or metamorphosis. At this time, embryonic melanophores are replaced by newly differentiating metamorphic melanophores that form the adult stripes. Mutants with normal embryonic/early larval pigment patterns but defective adult patterns identify factors required uniquely to establish, maintain or recruit the latent precursors to metamorphic melanophores. We show that one such mutant, picasso, lacks most metamorphic melanophores and results from mutations in the ErbB gene erbb3b, which encodes an EGFR-like receptor tyrosine kinase. To identify critical periods for ErbB activities, we treated fish with pharmacological ErbB inhibitors and also knocked down erbb3b by morpholino injection. These analyses reveal an embryonic critical period for ErbB signaling in promoting later pigment pattern metamorphosis, despite the normal patterning of embryonic/early larval melanophores. We further demonstrate a peak requirement during neural crest migration that correlates with early defects in neural crest pathfinding and peripheral ganglion formation. Finally, we show that erbb3b activities are both autonomous and non-autonomous to the metamorphic melanophore lineage. These data identify a very early, embryonic, requirement for erbb3b in the development of much later metamorphic melanophores, and suggest complex modes by which ErbB signals promote adult pigment pattern development.

Key words: Erbb, erbb3, HER3, Melanophore, Metamorphosis, Stem cell, Zebrafish


   INTRODUCTION
TOP
 SUMMARY
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The generation of adult form remains an enduring problem. An interesting system for studying the salient genetic and cellular mechanisms is the larva-to-adult transformation, or metamorphosis, of amphibians and fishes (Moran, 1994Go; Parichy, 1998Go; Webb, 1999Go; Brown and Cai, 2007Go). In zebrafish, Danio rerio, metamorphosis includes dramatic changes in the digestive, excretory and sensory systems; the peripheral nervous system; the skeleton, fins and integument; as well as physiology and behavior (Cubbage and Mabee, 1996Go; Brown, 1997Go; Elizondo et al., 2005Go; Tingaud-Sequeira et al., 2006Go; Engeszer et al., 2007Go).

The pigment pattern is another, particularly accessible, trait altered at metamorphosis (Kelsh, 2004Go; Parichy, 2006Go). The early larval pigment pattern develops in the embryo from neural crest-derived pigment cells, or chromatophores; this pattern is completed by 5 days post-fertilization (dpf) and comprises stripes of black melanophores with intervening yellow xanthophores. This pattern persists until metamorphosis (~14 dpf) when melanophores begin to differentiate outside of the early larval stripes. During the next 2 weeks, new adult stripes begin to form as some metamorphic melanophores migrate to sites of adult stripe formation and other melanophores differentiate already at these sites. The result is a juvenile pigment pattern with two `primary' stripes of melanophores, bordering an `interstripe' of xanthophores.

Embryonic/early larval chromatophores and metamorphic chromatophores might have commonalities as well as differences. For example, several mutants lack chromatophore types or pigments both before and after metamorphosis (Lister et al., 1999Go; Parichy et al., 2000bGo; Lamason et al., 2005Go). Others exhibit defects in the adult but not in the embryo (Parichy et al., 2000aGo; Iwashita et al., 2006Go; Watanabe et al., 2006Go). Mutants in this latter class are interesting because they identify genes uniquely required to establish, maintain or recruit latent precursors that contribute to adult form. Included among these are two mutants, puma and picasso, each having a normal early larval pigment pattern but fewer metamorphic melanophores (Fig. 1A,B) (Parichy and Turner, 2003bGo; Parichy et al., 2003Go; Quigley et al., 2004Go). Whereas puma is required autonomously to metamorphic melanophore precursors during pigment pattern metamorphosis, the cellular and temporal requirements for picasso are not known.

Here, we show that picasso is allelic to erbb3b, which encodes an epidermal growth factor receptor (EGFR)-like tyrosine kinase. erbb3b is one of two zebrafish orthologues of human epidermal growth factor receptor 3 (HER3, ERBB3) and part of a larger family that includes EGFR (ERBB1), ERBB2 and ERBB4 (Citri and Yarden, 2006Go; Stein and Staros, 2006Go). Ligands for ErbB receptors include Egf and neuregulins 1, 2 and 3. The receptors form dimers with individual monomers exhibiting different activities and ligand specificities: for example, ErbB3 lacks endogenous kinase activity, while ErbB2 lacks its own high affinity ligand. Whereas several heterodimers are possible, only a subset seems to have biological significance, with ErbB3 acting with ErbB2 (Graus-Porta et al., 1997Go; Jones et al., 1999Go; Oda et al., 2005Go) and potentially with Egfr (Soltoff et al., 1994Go; Frolov et al., 2007Go; Poumay, 2007Go). ErbB receptors function in glial morphogenesis (Lyons et al., 2005Go; Britsch, 2007Go), and their misregulation is associated with a variety of cancers (Breuleux, 2007Go; Sergina and Moasser, 2007Go).

In this study, we find that metamorphic melanophores express erbb3b, suggesting an autonomous activity that occurs late, during the larva-to-adult transformation. Nonetheless, we show that erbb3b functions both autonomously and non-autonomously to the metamorphic melanophore lineage. We also identify a major critical period for ErbB signals during embryonic neural crest cell migration, 2 weeks before metamorphosis, indicating a novel role for ErbB signals in establishing precursors to adult chromatophores. Finally, we demonstrate cryptic requirements for ErbB signals during metamorphosis itself, suggesting redundant functions with other pathways at this later stage. Our study provides new insights into the development of adult form and the genetic requirements of a trait expressed before and after metamorphosis.


   MATERIALS AND METHODS
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Fish stocks
Fish were maintained at 26-28°C, 14L:10D (Westerfield, 2000Go). picasso mutants were recovered in screens for N-ethyl-N-nitrosourea-induced mutations and mapped using the partially inbred strains ABwp and wikwp.

Cell transplantation
Chimeric embryos were generated by transplanting cells at blastula stages (3.3-3.8 hours post-fertilization) and then were reared through metamorphosis (Parichy and Turner, 2003aGo).

Pharmacological Erbb inhibitor treatments
Stock solutions of AG1478 [4-(3-chloroanilino)-6,7-dimethoxyquinazoline; Calbiochem] or PD158780 (4-[(3-bromophenyl)amino]-6-(methylamino)-pyrido[3,4-d]pyridimine; Calbiochem) were diluted in DMSO. Fish were treated with 3 µM of either drug in 10% Hanks solution. To facilitate penetration, 0.5% DMSO was added to all media and embryos were dechorionated prior to treatment. Fish were reared in agar-lined Petri dishes or glass beakers and solutions were changed daily. Fish reared in either drug throughout development invariably died prior to formation of the adult pigment pattern, so could not be analyzed.

Morpholino injection
A splice-blocking morpholino against erbb3b [TGGGCTCGCAACTGGGTGGAAACAA (Lyons et al., 2005Go)] was obtained from GeneTools (Eugene, OR). One- or two-cell embryos were injected with 300-500 pg and reared through formation of the adult pigment pattern.

PCR, genotyping, and sequencing
For RT-PCR, metamorphosing larvae were euthanized and rinsed in 10% Hanks solution, after which tissues were dissected and placed in dissociation medium (1 mg/ml collagenase type IV; 0.1 mM epinephrine; 2 mg/ml bovine serum albumin; 0.1 mg/ml trypsin inhibitor) (Clark et al., 1987Go). Cells were picked and transferred to 5% fetal bovine serum in PBS for 10 minutes, then picked and extracted for RNA. cDNAs were synthesized with the Superscript III CellsDirect cDNA Synthesis System (Invitrogen) and RT-PCRs were performed using the following primers (forward, reverse): erbb3b, ACTCCCTAAAAATCCCTGTGG, GGCGAAGGTGTTGAAGTAAT; erbb2, CACCGGAAGTTTACTCACCAA, GATCTCCAACATTTGACCAT; erbb3a, TGACTCCATCCACTACTGCTG, TTCTTCACCAGCACCTCTGTT; egfr, CCGTTGGTGTGTGTTTTGAG, GCTTTTCAGGAGGGAGACTTTC; dct, ACCTGTGACCAATGAGGAGATT, TACAACACCAACACGATCAACA; β-actin, GTTTTCCCCTCCATTGTT, GGTGTTGAAGGTCTCGAACA; erbb4, CTGCTGCTCAACTGGTGTGT, CCAGTGCCATCACAGCTTCT.

For genotyping picassowp.r2e2, we amplified genomic DNA (pcs-wpr2e2*: TTGGTTACCATTGTGGTTGTTT, TCTTCATGGTAGCTCAGA AACATC) from individual embryos and digested PCR products with RsaI restriction enzyme. The wild-type amplicon cuts with RsaI at position 219, whereas the mutant allele does not cut.

In situ hybridization
Analyses of mRNA distributions in embryos followed standard protocols (Parichy et al., 2000bGo). In situ hybridization on larvae followed (Elizondo et al., 2005Go), but overnight incubation was used for probes and antibodies (a detailed protocol is available at http://protist.biology.washington.edu/dparichy/). For analyses of gene expression in families segregating picasso mutant alleles, individual embryos or larvae were imaged after staining then transferred to DNA extraction buffer and processed to determine genotypes retrospectively.

Immunohistochemistry
Trunks of 12 dpf larvae were fixed in 4% PFA in PBS for 6 hours at room temperature then permeabilized by washing overnight in deionized water. Specimens were equilibrated in PDTX (PBS containing 1% DMSO and 0.3% Triton X-100) three times for 30 minutes each, then blocked with 5% goat serum in PDTX for 4 hours. Larvae were incubated overnight at 4°C with primary antibody mAB 16A11 (Marusich et al., 1994Go; Henion et al., 1996Go) against HuC/D (1:200 in blocking solution), washed in PDTX, incubated with secondary antibody (Alexa Fluor 568; Molecular Probes), then washed and visualized.

Image analyses and statistical methods
Embryos or larvae were viewed with Olympus SZX-12 or Zeiss Lumar stereomicroscopes, or with Zeiss Axioplan 2 or Zeiss Observer compound microscopes. Digital images were collected with Zeiss Axiocam cameras using Zeiss Axiovision and corrected for contrast and color balance when necessary.

Statistical analyses were performed with JMP 7.0 (SAS Institute, Cary, NC). For counts of melanophores, individual cells were distinguished from one another by treating fish with epinephrine to contract melanosomes towards cell bodies. Densities of melanophores were determined by counting melanophores within a rectangular region delimited by: anteriorly, the anterior margin of the dorsal fin insertion; posteriorly, the posterior margin of the anal fin insertion; dorsally, the posterior margin of the dorsal fin insertion; ventrally, the posterior margin of the anal fin insertion. To control for variation in larval development stage, we tested for effects of larval size (measured as flank height at the posterior margin of the anal fin, hpa) as a covariate in analyses (Parichy and Turner, 2003bGo), and retained this factor if P<0.05, though analyses without the co-factor yielded qualitatively equivalent results. Analyses of melanophore densities were treated as multifactorial analyses of variance or covariance with replicates as blocks. Residuals in all analyses were confirmed to be normally distributed and homoscedastic. Least squares means (correcting for size, replicate variation, or both) are presented in figures below, with significant differences assessed by Tukey-Kramer comparisons to preserve an experiment-wide {alpha}=0.05.

For analyses of embryonic critical periods for Erbb signals in kit mutant larvae (see below), adult pigment patterns were scored qualitatively for stripe disruption. Breaks in stripes were considered present when three or fewer melanophores were present over a defined anterior-posterior length, as scaled by hpa (above): stripes exhibiting breaks ≤0.5 hpa were scored `0'; breaks between 0.5 and 1 hpa were scored `1'; breaks >1 hpa were scored `2'. Dorsal and ventral stripes were scored individually, then summed to generate a `stripe break score' of 0-4. To test for differences among treatment groups, we compared ordinal scores using non-parametric Wilcoxon tests and contingency table analyses. Both methods yielded equivalent results; for simplicity, we present only the former (complete analyses available on request).


   RESULTS
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Metamorphic melanophore development requires erbb3b
To learn when picasso mutants first exhibit pigment pattern defects, we examined embryos and early larvae, and we imaged individual fish daily from early larval stages through formation of the adult pigment pattern. Pigment cell complements of embryos and early larvae were normal (Fig. 1C,D). Subsequently, picasso mutants largely failed to develop metamorphic melanophores, particularly in the mid-trunk, and instead retained early larval melanophores even as adults (Fig. 1E-L). In the posterior trunk of picasso mutants, seemingly more complete melanophore stripes form (Fig. 1B). Posterior stripes in picasso mutants appear more complete because more embryonic/early larval melanophores become situated in the position of adult stripes in this region, and because more metamorphic melanophores differentiate near these cells when compared with the mid-trunk (Fig. 2).


Figure 1
View larger version (132K):
[in this window]
[in a new window]

  		Fig. 1. Defective adult pigment pattern but normal embryonic/early larval pigment pattern of picasso mutants. (A) Wild-type adult pigment pattern of picasso heterozygote. (B) Defective pigment pattern of picasso homozygote. (C,D) Pigment patterns of wild-type and mutant siblings were indistinguishable at 5 dpf. (E-H) Repeated images of wild-type (picasso/+) larvae revealed normal development of initially dispersed metamorphic melanophores that organized into stripes (arrow, E), as well as metamorphic melanophores that developed already at sites of stripe formation. (I-L) picasso mutant larvae develop very few metamorphic melanophores (arrow, L), and instead many embryonic/early larval melanophores (arrowhead, K) persisted into the adult. (E,I) 17 dpf. (F,J) 23 dpf. (G,K) 31 dpf. (H,L) 40 dpf.

 


Figure 2
View larger version (144K):
[in this window]
[in a new window]

  		Fig. 2. Regulative posterior adult stripe formation in the picasso mutant. Adult pigment pattern development of wild-type (A-D) and picasso mutant (E-H) larvae. (A-D) In wild type, most embryonic/early larval melanophores remained in a dorsal position, though a few were incorporated into the adult stripe posteriorly (arrowheads in C,D). (E-H) In picasso mutants, more embryonic/early larval melanophores (e.g. arrowheads in G) were incorporated into an incomplete stripe. Additional metamorphic melanophores differentiated (e.g. arrows in G) where persisting embryonic/early larval melanophores contributed to the adult stripe. (A,E) 14 dpf. (B,F) 16 dpf. (C,G) 20 dpf. (D,H) 24 dpf.

 
We mapped picasso to chromosome 23 in the vicinity of erbb3b and found that picasso failed to complement an excess neuromast phenotype of an erbb3b-null allele (all of these alleles are recessive and homozygous viable, though weaker than wild type) (Lyons et al., 2005Go). erbb3b cDNAs had premature stop codons in each of two picasso alleles (Fig. 3), demonstrating that the picasso phenotype arises from mutations in erbb3b.

In embryos, erbb3b is expressed in neural crest cells and glia (Lyons et al., 2005Go). In metamorphosing larvae, we similarly found erbb3b expression in glia (Fig. 4A). To determine whether erbb3b might be expressed in other tissues below the threshold of detection by in situ hybridization, we used RT-PCR. We detected erbb3b transcripts in both isolated melanophores and in juvenile fin (comprising melanophores, melanophore precursors, bone, skin, vasculature and other cell types; Fig. 4C). We also detected the erbb3b paralogue, erbb3a, in glia and fin, though not in metamorphic melanophores (Fig. 4B,C). As ErbB receptors act as heterodimers, we tested where other ErbB genes are expressed (Fig. 4C): erbb2 was expressed in metamorphic melanophores and in fin; egfr was not expressed in metamorphic melanophores, although it was expressed in fin; and we could not detect erbb4 in melanophores or in fin (data not shown). erbb2 and egfr are also widely expressed in zebrafish embryos (Goishi et al., 2003Go; Lyons et al., 2005Go).

To determine what steps in metamorphic melanophore development require erbb3b, we examined molecular markers (Fig. 5A-F). picasso mutants were deficient during metamorphosis for cells expressing early neural crest markers (crestin, sox10), as well as early and late markers of the melanophore lineage (mitfa, dct). picasso mutants also had transiently fewer cells expressing xanthophore lineage markers (xdh, csf1r) and fewer myelin basic protein+ (mbp+) glia (Fig. 5G,H and data not shown).


Figure 3
View larger version (29K):
[in this window]
[in a new window]

  		Fig. 3. picasso is allelic to erbb3b. (A) Schematic of erbb3b cDNA showing picasso lesions. RL, receptor L (ligand-binding) domains; C, furin-like cysteine-rich domains; PK, protein kinase domain; TM, transmembrane domain; arrow, N835 interruption to kinase domain characteristic of erbb3. (B) Premature stop codon in pcswp.r2e2 (C433T: Q145stop). (C) Premature stop codon (arrow) in pcsut.r4e1 (T2043A: Y681stop), as shown versus wild type.

 


Figure 4
View larger version (51K):
[in this window]
[in a new window]

  		Fig. 4. ErbB gene expression in metamorphosing larvae. (A,B) erbb3 loci were expressed in glia (~18 dpf). Arrows, glial cells surrounding midbody lateral line. (A) erbb3b. (B) erbb3a. (C) RT-PCR revealed metamorphic melanophore expression of erbb3b and erbb2, but not erbb3a or egfr. All four ErbB genes were expressed in adult fin. mel, melanophore; dct, dopachrome tautomerase (encoding a melanin synthesis enzyme expressed by melanophores and their precursors). dct is more strongly expressed in melanoblasts (present in fin) compared with melanophores (mel). Scale bar: in A, 0.5 mm for A,B.

 
erbb3b functions autonomously and non-autonomously to the metamorphic melanophore lineage
erbb3b might promote adult pigment pattern formation by acting autonomously to the metamorphic melanophore lineage, but also could have non-autonomous effects if, for example, erbb3b-dependent cells provide signals required by metamorphic melanophores or their precursors. To test these possibilities, we constructed genetic mosaics by transplanting cells between blastula stage embryos.

If erbb3b acts autonomously to the metamorphic melanophore lineage, then wild-type melanophores should develop in picasso mutants and these cells should form wild-type stripes. If erbb3b acts non-autonomously, then wild-type melanophores should develop where picasso mutant melanophores develop (anteriorly and posteriorly), but not where picasso mutant melanophores are absent (mid-trunk) (Fig. 1B). Wild-type (β-actin::EGFP+) -> picasso chimeras developed wild-type metamorphic melanophores at high density anteriorly and posteriorly (Fig. 6A,B), but often developed few if any metamorphic melanophores in the mid-trunk (Fig. 6A,C), like picasso mutants. In reciprocal picasso (β-actin::EGFP+) -> wild-type chimeras, we never found donor picasso mutant metamorphic melanophores in the adult pigment pattern. These findings suggest both non-autonomous and autonomous roles for erbb3b.

Given that metamorphic melanophores express erbb3b and erbb2, differences between wild-type and picasso mutant melanophores could be further revealed as differences in their abilities to populate a flank lacking melanophores. We therefore transplanted wild-type or picasso mutant cells to nacrew2 mutant hosts, which lack their own melanophores because of a mutation in mitfa, which functions cell-autonomously in melanophore specification (Lister et al., 1999Go; Parichy and Turner, 2003aGo). In wild-type -> nacre chimeras, embryonic/early larval melanophores often developed, and metamorphic melanophores differentiated to form patches of stripes (Fig. 6D). In picasso -> nacre chimeras, embryonic/early larval melanophores developed about as often, but metamorphic melanophores did not appear and, instead, embryonic/early larval melanophores persisted into the adult (Fig. 6E). Interestingly, metamorphic melanophores failed to develop in picasso -> nacre chimeras, even anteriorly and posteriorly; this difference from picasso mutants may arise because the melanophore-free nacre background would preclude community effects from contributing to pattern regulation in these regions (Fig. 2) (Parichy et al., 2000bGo; Parichy and Turner, 2003bGo). Together, genetic mosaic analyses indicate that ErbB signals are required autonomously and non-autonomously during metamorphic melanophore development.

ErbB activity is required in the embryo for metamorphic melanophore development
The adult pigment pattern of picasso mutants could reflect erbb3b activities early or late. For example, erbb3b could function in the embryo to establish a population of precursors that differentiates at metamorphosis. Or erbb3b could act later in maintaining or expanding such a population, or still later, during their differentiation into metamorphic melanophores. To distinguish among these possibilities, we blocked ErbB signaling using pharmacological inhibitors AG1478 (Levitzki and Gazit, 1995Go; Lyons et al., 2005Go; Levitzki and Mishani, 2006Go) and PD158780 (Fry et al., 1997Go; Rewcastle et al., 1998Go; Frohnert et al., 2003Go). Preliminary analyses showed that treating wild-type embryos with either AG1478 or PD158780 resulted in excess neuromasts that phenocopy erbb3b mutants (data not shown) (Lyons et al., 2005Go). As both drugs inhibit kinase activity by interfering with ATP-binding sites, and wild-type Erbb3 already has impaired or absent kinase activity (Guy et al., 1994Go), inhibitors presumably suppress signals originating with erbb3b:erbb2, erbb3:egfr or other heterodimers. Functions of these receptors that are independent of kinase activity should not be affected.


Figure 5
View larger version (142K):
[in this window]
[in a new window]

  		Fig. 5. Metamorphic deficiencies for early and late markers of neural crest-derived lineages in picasso mutant larvae. Shown are corresponding regions of the mid-trunk for wild type (above) and picasso mutants during mid-metamorphosis (~18 dpf). Individual melanophores are more spread in picasso mutants, typical of reduced melanophore densities (Parichy and Turner, 2003bGo; Parichy et al., 2003Go). (A,A') crestin marks neural crest-derived cells in embryos (Luo et al., 2001Go) and identifies dispersed cells in the hypodermis of metamorphosing larvae (arrow). crestin+ cells were dramatically fewer in picasso mutants. (B,B') Higher magnification image of crestin+ cells in wild type, and their absence in picasso. (C,C') sox10 marks non-ectomesenchymal neural crest-derived cells in embryos, including pigment cell and glial precursors (Dutton et al., 2001Go; Gilmour et al., 2002Go), and identifies comparable populations in metamorphosing larvae (Parichy et al., 2003Go). sox10+ cells were fewer in picasso compared with wild type. (D,D') Higher magnification showing sox10+ cells along the lateral line (arrowhead) and in the hypodermis (arrow) of wild type, but not picasso. (E,E') mitfa marks melanophore and xanthophore precursors in embryos and is essential for melanoblast specification (Lister et al., 1999Go; Parichy et al., 2000bGo). mitfa+ cells (arrow) were numerous in wild type but not in picasso. (F,F') dct identifies melanophore precursors (arrow) and melanophores (arrowhead) (Kelsh et al., 2000Go); dct+ cells were reduced or absent in picasso. (G,G') Xanthine dehydrogenase (xdh) encodes an enzyme in the pteridine synthesis pathway of xanthophores (Parichy et al., 2000bGo). xdh+ cells (arrow) were numerous in wild type but transiently fewer in picasso. (H,H') Myelin basic protein (mbp) marks mature glia in the peripheral nervous system (Brosamle and Halpern, 2002Go; Lyons et al., 2005Go) and mbp+ cells line the midbody lateral line (arrow) as well as ascending and descending nerve fibers (arrowhead). Although mbp+ cells were present in picasso, they were fewer in number and their associated nerves were misrouted.

 
Wild-type embryos treated with AG1478 developed normal early larval pigment patterns. When these same fish metamorphosed, however, their pigment patterns and melanophore densities were indistinguishable from picasso mutants (Fig. 7B,E). By contrast, fish treated with AG1478 during the pre-metamorphic (early larval) period or during metamorphosis, developed adult pigment patterns and melanophore densities indistinguishable from controls (Fig. 7A,C-E; but see below). Treatment of wild-type fish with PD158780 yielded identical results (Fig. 8 and data not shown).

To test whether the embryonic requirement for ErbB signaling is unique to zebrafish, we examined two more species. We chose D. albolineatus because its more uniform pigment pattern (Fig. 7F) might depend on mechanisms different than zebrafish (Quigley et al., 2005Go; Mills et al., 2007Go). Danio albolineatus embryos developed defects in metamorphic melanophores similar to D. rerio when treated with AG1478 (Fig. 7G) or PD158780 (data not shown). We also examined D. nigrofasciatus (Fig. 7H), in which few metamorphic melanophores develop and, instead, most embryonic/early larval melanophores persist and reorganize to form adult stripes (Quigley et al., 2004Go). If AG1478 effects are limited to metamorphic melanophores, then the D. nigrofasciatus pigment pattern should be refractory to perturbation. Consistent with this prediction, D. nigrofasciatus embryos treated with AG1478 developed adult pigment pattern defects (Fig. 7I) less severe than those of zebrafish or D. albolineatus.


Figure 6
View larger version (118K):
[in this window]
[in a new window]

  		Fig. 6. Autonomous and non-autonomous roles for erbb3b in pigment pattern metamorphosis. (A) Wild-type -> picasso chimeras frequently developed wild-type melanophores in stripes at high density anteriorly (arrows, left) but at lower density in the mid-trunk (small arrows, right; 75% of chimeras developed donor melanophores; chimeras with donor cells and total reared: n=24, 64, respectively). A wild-type midbody lateral line is misrouted as well. (B) Melanophores at high density anteriorly that are either donor-derived (EGFP+) or host-derived (EGFP-). (C) Melanophores in the mid-trunk are more spread, which is typical at low density. In reciprocal picasso -> wild-type chimeras, we did not observe donor metamorphic melanophores (n=7, 50). (D) Wild-type -> nacre chimeras developed patches of donor-derived metamorphic melanophores that populated stripes (arrow) and scales (84% of chimeras developed metamorphic melanophores; n=75, 155). Persisting embryonic/early larval melanophores (arrowheads) are identifiable by location, large size and browner color (Quigley et al., 2004Go). (E) picasso -> nacre chimeras developed melanophores (arrowheads), but did not develop metamorphic melanophores [79% of chimeras developed embryonic/early larval melanophores or fin melanophores (not shown); n=58, 195]. Donor cells in all chimera combinations contributed at similar frequencies to other derivatives, including muscle, epidermis, eye and neurons of the lateral line. Scale bars: in A, 500 µm; in B, 200 µm for B,C; in D, 1 mm for D,E.

 
In mammalian systems, AG1478 is highly selective for EGFR-dependent signals and is less effective against other ErbB receptors (Levitzki and Gazit, 1995Go), whereas PD158780 is highly effective against all ErbB family members (Fry et al., 1997Go; Frohnert et al., 2003Go; Stonecypher et al., 2005Go). Specificities in zebrafish are not known. Although the similarity of adult pigment patterns between drug-treated fish and the picasso mutant is consistent with the suppression of erbb3b-dependent signals, we would expect these inhibitors to affect signaling through other ErbB receptors as well, particularly as protein tyrosine kinase domains are highly conserved between zebrafish and human orthologues (e.g. domain-specific identities, similarities: Erbb2, 84%, 92%; Egfr, 87%, 95%; Erbb3, 75%, 87%). We therefore repeated these experiments on picasso mutants: if signals independent of erbb3b are inhibited, then the severity of the picasso phenotype should be enhanced. When we treated sibling picassowp.r2e2 and picassowp.r2e2/+ embryos with AG1478 for the first 4 days of development, homozygotes unexpectedly developed edema and died by 7 dpf. Thus, a single copy of erbb3b protects against AG1478-dependent lethality, implying that erbb3b has functions that are independent of kinase activity (that, itself, presumably originates with erbb3b:erbb2 or erbb3b:egfr heterodimers). Consistent with this idea are several studies that have revealed kinase-independent activities of receptor tyrosine kinases, including Erbb3 (Offterdinger et al., 2002Go; Rawls and Johnson, 2003Go; Massie and Mills, 2006Go; Hsu and Hung, 2007Go).

Given the preceding results, we treated embryos for shorter periods: wild-type embryos treated for only 2 dpf developed pigment patterns similar to wild-type embryos treated for 4 dpf (Fig. 9A,B); moreover, both picassowp.r2e2 and picassowp.r2e2/+ embryos treated for 2 dpf survived and developed pigment patterns indistinguishable from untreated picassowp.r2e2 controls (Fig. 9C,D; log-transformed melanophore densities: F1,25=2.46, P=0.13). We observed identical outcomes with PD158780 (data not shown). By comparison with the picassowp.r2e2 null phenotype, these data suggest that inhibitors affect adult pigment patterns largely or exclusively by suppressing erbb3b-dependent signals.

These data indicate that ErbB signals are required in embryos for adult pigment pattern formation. To further test this conclusion, we sought an independent means of blocking erbb3b activity. We reasoned that the limited perdurance of morpholino oligonucleotides (3-5 days) should allow us to knock-down erbb3b in the embryo, while permitting later activity at metamorphosis (Nasevicius and Ekker, 2000Go; Mellgren and Johnson, 2004Go). We therefore injected embryos with a morpholino oligonucleotide against erbb3b (Lyons et al., 2005Go) and raised them into adults. Morpholino-injected fish showed defects qualitatively similar to picasso mutants (Fig. 7K).

Overall then, two independent lines of evidence show that erbb3b is required early for much later adult pigment pattern development. Specifically, the erbb3b mutant adult pigment pattern phenotype can be phenocopied in wild-type fish by: (1) embryonic knockdown of erbb3b via morpholino injection; and (2) treating embryos with either of two pharmacological inhibitors that, in this context, are specific to erbb3b-dependent signals.

Adult pigment pattern requirement for ErbB activity during neural crest migration
The critical period for ErbB signals includes neural crest migration. To further test this coincidence, we treated embryos with ErbB inhibitors for shorter intervals. Preliminary analyses with wild-type yielded extensive variability in defect severity, perhaps owing to stochastic differences in pattern regulation (Parichy and Turner, 2003bGo; Yamaguchi et al., 2007Go). We therefore used a sensitized background, kitb5, to delineate the critical period more precisely. kit mutants lose embryonic/early larval melanophores, subsequently develop metamorphic melanophores already in stripes, and also have defects in pattern regeneration (Johnson et al., 1995Go; Parichy et al., 1999Go; Rawls and Johnson, 2000Go; Yang and Johnson, 2006Go).

We treated kit mutant embryos beginning between 8 hpf and 70 hpf for periods of 2-26 hours. Such analyses across multiple independent experiments revealed peak sensitivities for adult pigment pattern formation between ~14 and 22 hpf, with affected individuals developing stripe defects reminiscent of picasso mutants (AG1478: Fig. 10A-C,E,F; PD158780: data not shown). As adult pigment patterns were comparatively refractory to treatments after ~22 hpf, we asked whether longer treatments at later stages would enhance adult pattern defects. Treating embryos between 26 and 48 hpf did not alter later phenotypes (Fig. 10F), consistent with an earlier critical period. Finally, because erbb3b, erbb2 and egfr are expressed as early as 8-11 hpf [(Goishi et al., 2003Go; Thisse and Thisse, 2004Go; Lyons et al., 2005Go); data not shown], we tested whether ErbB signals have reiterated activities by treating embryos twice. When early treatments (8-11 hpf) were combined with later treatments (beginning at 22 hpf and later), we observed more severe melanophore deficiencies in the adult. Remarkably, treatments at least 8 hours apart often resulted in spatially separated melanophore-deficient patches (e.g. Fig. 10D). The increased severity of these defects suggests early and late functions even in the embryo: defects arising from early ErbB kinase inhibition can presumably be regulated so long as ErbB function is allowed later.


Figure 7
View larger version (103K):
[in this window]
[in a new window]

  		Fig. 7. Embryonic requirement for ErbB signaling in pigment pattern metamorphosis. (A) Control wild-type zebrafish treated from embryonic through juvenile stages with DMSO alone. (B) Wild-type treated with AG1478 during embryonic stages (70% epiboly - 4 dpf) showed adult pigment patterns resembling severely affected picasso mutants (arrow). (C,D) Individuals treated with AG1478 during the pre-metamorphic, early larval period (5-14 dpf, C) or throughout metamorphosis (15-28 dpf, D) exhibited pigment patterns indistinguishable from controls. (E) Metamorphic melanophore densities in the mid-trunk (mean±95% confidence intervals) showing similarities between wild-type (untreated), control (con, DMSO-treated) and fish treated with AG1478 during pre-metamorphosis (pre) and metamorphosis (met), as well as similar defects between picasso mutants (pcs) and fish treated with AG1478 as embryos (emb). Letters above bars indicate means that are not significantly different (P>0.05). Numbers within bars are samples sizes. (F,G) D. albolineatus normally develop a more uniform melanophore pattern of metamorphic melanophores (arrowheads in F) compared with D. rerio, and exhibited a severe melanophore deficiency when embryos were treated with AG1478 (G). (H,I) In D. nigrofasciatus, adult stripes largely comprise persisting embryonic/early larval melanophores with occasional gaps (arrow in H), and embryonic treatment with AG1478 had relatively subtle effects (arrows in I). (J,K) Embryonic morpholino knockdown of erbb3b resulted in adult melanophore deficiencies (K) compared with controls (J), providing independent evidence for an early erbb3b-dependence of adult pigment pattern formation. Scale bar: in I, 0.5 mm for A-D,F-I,J,K.

 


Figure 8
View larger version (109K):
[in this window]
[in a new window]

  		Fig. 8. Treatment of embryos with ErbB inhibitor PD158780 results in adult pigment pattern defect similar to erbb3b null alleles. (A) Treated with DMSO alone. (B) Treated with PD158780 for 2 dpf. Arrow, region deficient for metamorphic melanophores.

 
The major critical period for ErbB signals (~14-22 hpf) corresponds approximately to the time when neural crest cells are migrating at the axial levels affected in the picasso mutant (Raible et al., 1992Go; Vaglia and Hall, 2000Go). Therefore, we explored the role of erbb3b in the early patterning of neural crest-derived cells. In comparison with wild-type siblings, picasso mutants at 26 hpf had similar numbers of cells expressing the pan-neural crest marker crestin, but these cells did not localize at sites of ganglion formation in the medial migratory pathway and were instead found further ventrally (Fig. 11A). We observed a similar defect for cells expressing mitfa (Fig. 11B). By contrast, we did not find clear defects in the distributions of dct+ melanoblasts (Fig. 11C) or cells in the lateral migratory pathway, consistent with the normal patterning of picasso mutant embryonic/early larval melanophores. Finally, given the defects in ventromedial migrating cells, and defects in the peripheral nervous system of mammalian ErbB3 and ErbB2 mutants (Britsch et al., 1998Go; Britsch, 2007Go), we examined ganglion development. We observed gross reductions in the numbers of dorsal root and sympathetic ganglia in picasso mutant larvae at 12 dpf (Fig. 11D). These data reveal an erbb3b-dependence of neural crest morphogenesis that correlates with the early erbb3b-dependence of adult pigment pattern formation.

Sensitized genetic backgrounds reveal requirements for ErbB signals during metamorphosis
The preceding experiments demonstrated a critical period for ErbB signaling in embryos. During later development, metamorphic melanophores express both erbb3b and erbb2 (Fig. 4C), but inhibitor treatments during metamorphosis had no effect on the adult pigment pattern (Fig. 7C-E). This suggests redundancies with other pathways, regulation in cell behaviors, poor penetration into tissues or higher thresholds for inhibition. Given these possibilities, we sought to further test roles for ErbB signals during metamorphosis. As higher doses were lethal, we re-tested the inhibitors on sensitized mutant backgrounds: kit, csf1r j4e1 and kit/+ csf1r/+. We chose these because they reveal distinct populations of metamorphic melanophores (Johnson et al., 1995Go; Parichy et al., 1999Go; Parichy et al., 2000bGo): kit mutants lack early metamorphic melanophores, but retain late metamorphic melanophores; csf1r mutants retain early metamorphic melanophores, but are missing late metamorphic melanophores. Comparing further deficits should therefore indicate whether one or the other population has a greater requirement for ErbB signaling. Finally, we also examined D. albolineatus because of the differences in melanophore development in this species compared with zebrafish.


Figure 9
View larger version (69K):
[in this window]
[in a new window]

  		Fig. 9. ErbB inhibitor treatment for 48 hpf does not enhance the picasso null phenotype. (A) Wild-type control treated with DMSO. (B) Wild-type treated with AG1478 exhibits a severe pigment pattern defect. (C) picasso mutant control treated with DMSO. (D) picasso mutant treated with AG1478 has a pigment pattern defect indistinguishable from that of the control. Scale bar: in D, 0.5 mm for A-D.

 


Figure 10
View larger version (36K):
[in this window]
[in a new window]

  		Fig. 10. kit mutant reveals critical period for ErbB activity during neural crest migration. Embryos were reared to juvenile stages after treatment with AG1478 as embryos. (A) Normal kit mutant pigment pattern after AG1478 treatment between 26 and 30 hpf (stripe break score=0; for details see Materials and methods). kit mutant adults exhibit about half as many stripe melanophores as wild-type fish and completely lack melanophores over the dorsum and on scales (Johnson et al., 1995Go). (B,C) Treatment with AG1478 between 14 and 18 hpf results in pattern defects that are moderate (B, stripe break score=3) to severe (C, stripe break score=4). (D) Distinct melanophore-free patches (arrows) in kit mutant treated between 8 and 11 hpf then again between 26 and 30 hpf. (E,F) Quantitation of stripe break defects in kit mutants treated with AG1478 in two separate experiments. Shown are median stripe break scores (red bars) and interquartile ranges (50% of scores, black vertical bars). Numbers above each treatment stage are sample sizes of adult fish analyzed. con, DMSO-treated controls. (E) Initial experiment reveals peak sensitivity between 16 and 22 hpf, with lesser defects extending between 8 and 36 hpf (test of differences in median locations across all treatments, Wilcoxon test {chi}2 approximation=38.6, d.f.=11, P<0.0001). (F) Second experiment confirms peak sensitivity between ~14 and 22 hpf ({chi}2=115.6, d.f.=14, P<0.0001). More severe defects are generated with repeated treatments (right).

 
In each background, we observed moderate to severe reductions in metamorphic melanophore numbers upon treatment with AG1478 or PD158780 during metamorphosis (Fig. 12; 19-58% fewer melanophores than corresponding controls), changes that were considerably more severe than observed for wild-type larvae (Fig. 7D,E; 3% fewer melanophores than controls). Furthermore, kit mutant and csf1r mutant zebrafish exhibited similar reductions in residual melanophore numbers, suggesting that ErbB signals are required by precursors to both early and late metamorphic melanophores. Consistent with the specificity of these effects, the picassowp.r2e2 mutant pigment pattern defect was not enhanced under these conditions and kit mutants treated with AG1478 exhibited pigment patterns that fell within the range observed for fish doubly mutant for kit and picassowp.r2e2 (data not shown). These data support a model in which ErbB signals are essential in the embryo but also function redundantly with other pathways during metamorphosis.


Figure 11
View larger version (90K):
[in this window]
[in a new window]

  		Fig. 11. picasso mutant embryos have defects in neural crest morphogenesis. (A,A') crestin+ cells form segmentally arranged clusters prior to ganglion formation in wild-type embryos (e.g. arrow in A) but appear to migrate past their normal target sites in picasso mutant embryos (e.g. arrowhead in A'). (B,B') mitfa+ cells in wild-type exhibit some segmental patterning and a defect in picasso mutants similar to that of crestin+ cells. (C,C') dct+ melanoblast distributions do not differ consistently between wild-type and picasso mutant embryos. (D,D') Anti-Hu immunoreactivity shows dorsal root ganglia (e.g. arrow in D) and sympathetic ganglia (e.g. arrowhead in D) in wild-type larvae but their absence in picasso mutants. Scale bar: in A', 800 µm for A-C'; in D', 600 µm for D-D'.

 


Figure 12
View larger version (79K):
[in this window]
[in a new window]

  		Fig. 12. Cryptic ErbB requirements during metamorphosis revealed by sensitized genetic backgrounds. (A) kit mutants (reared with DMSO) develop fewer metamorphic melanophores than wild type. (B) kit mutants reared during metamorphosis with AG1478 have an additional metamorphic melanophore deficiency. (C) csf1r mutants have similar numbers of melanophores to wild type through the middle metamorphic stage shown (Parichy et al., 2000bGo). (D) csfr1r mutants reared in AG1478 during metamorphosis exhibit a sharp reduction in melanophore numbers, as well as increased larval mortality (not shown). (E) Melanophore densities (±1 s.e.) are moderately or significantly reduced in sensitized backgrounds when treated with AG1478 (AG) or PD158780 (PD) compared with DMSO-only controls (con). Shared letters above bars indicate treatments that are not significantly different from one another (P>0.05) within each genetic background. Treatment sample sizes are shown at the base of each bar. Scale bar: in A, 300 µm for A,B; in C, 300 µm for C,D.

 

   DISCUSSION
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
We have identified a crucial role for ErbB signaling in Danio adult pigment pattern development. While picasso mutants homozygous for erbb3b null alleles exhibit normal early larval pigment patterns, they are grossly deficient for metamorphic melanophores of the adult pigment pattern. Unexpectedly, metamorphic melanophore precursors require ErbB signals during neural crest development, ~2 weeks before they begin to differentiate, and also exhibit a cryptic requirement for ErbB signals during metamorphosis. Genetic mosaic analyses further suggest complex modes by which ErbB signals promote adult pigment pattern formation.

A glial requirement for ErbB signals is well documented (Riethmacher et al., 1997Go; Britsch et al., 1998Go; Lyons et al., 2005Go; Pogoda et al., 2006Go; Britsch, 2007Go), but roles in pigment cell development have remained obscure. Normal human melanocytes express EGFR, ERBB2, ERBB3 and ERBB4, and stimulation with ligand promotes migration in vitro (Gordon-Thomson et al., 2001Go; Stove et al., 2003Go; Gordon-Thomson et al., 2005Go; Mirmohammadsadegh et al., 2005Go). ErbB receptors also are expressed in melanoma cells, and are associated with melanoma progression in a teleost model (Wellbrock et al., 2002Go; Gomez et al., 2004Go) and with human melanoma proliferation in vitro (Stove et al., 2003Go; Gordon-Thomson et al., 2005Go; Funes et al., 2006Go). Our finding that the picasso mutant phenotype results from lesions in erbb3b provides the first evidence that ErbB signals are required to promote normal pigment cell and pigment pattern development in vivo [although Fitch et al. (Fitch et al., 2003Go) describe melanocytosis resulting from EGFR overexpression in skin].

This study indicates that adult pigment pattern formation requires ErbB signaling in the embryo. Our analyses used pharmacological inhibitors that several lines evidence suggest are specific to ErbB-dependent signals. First, we observed the same phenotypes with two inhibitors. Second, pigment pattern defects phenocopied erbb3b-null alleles. Third, inhibitors failed to enhance defects of these null alleles. Fourth, similar defects resulted from morpholino-knockdown of erbb3b. Our results thus point to a model in which ErbB signals - depending in part on erbb3b - play an essential embryonic role in promoting much later adult pigment pattern formation.

This early critical period contrasts with other genes. For example, csf1r and puma are required during pigment pattern metamorphosis (Parichy and Turner, 2003aGo; Parichy et al., 2003Go) and kit is required during pattern formation in the fin (Rawls and Johnson, 2001Go). The critical period for ErbB signals in zebrafish also may be earlier than for Ednrb of mouse (Shin et al., 1999Go). Nevertheless, our analyses can suggest only a range of times: both drugs act rapidly and are quickly reversible (Fry et al., 1997Go; Lenferink et al., 2001Go; Levitzki and Mishani, 2006Go), but we do not know how long it takes for concentration changes in solution to reach beneath the epidermis. The peak sensitivity observed for embryos treated between 14-22 hpf may therefore indicate somewhat later critical periods, presumably during neural crest migration.

We can envisage at least two complementary models in which embryonic ErbB signals contribute to later metamorphic melanophore development. In the first model, these signals act autonomously to establish precursors of metamorphic melanophores. This activity could be specific to metamorphic melanophores or could apply to a broader range of neural crest derivatives. For example, both pigment cells and glia share a common precursor (Dutton et al., 2001Go; Dupin and Le Douarin, 2003Go; Dupin et al., 2003Go), both can be generated by adult neural crest-derived stem cells (Sieber-Blum et al., 2004Go; Amoh et al., 2005Go; Wong et al., 2006Go), and both are affected by the erbb3b mutation and by ErbB inhibitor treatments. ErbB signals also may expand a precursor population. If so, then incomplete regulation could explain why the early larval pigment pattern is normal in picasso mutants: if precursors are allocated to fill a defined number of `embryonic/early larval niches' before filling `metamorphic niches', a depleted total number of cells could leave metamorphic niches vacant.

In a second model, ErbB signals promote adult pigment pattern formation non-autonomously to the metamorphic melanophore lineage. This could occur if ErbB-expressing cells provide trophic support to metamorphic melanophore precursors or contribute otherwise to a micro-environment where these precursors reside. Such interactions would be analogous to the non-autonomous mechanisms by which ErbB signals in glia promote neuronal survival and nerve integrity (Riethmacher et al., 1997Go; Chen et al., 2003Go; Sharghi-Namini et al., 2006Go). These observations also raise the possibility that peripheral nerves or ganglia serve as niches for metamorphic melanophore precursors. Consistent with this idea are the defects in ganglion development seen here and in the accompanying study (Honjo et al., 2008Go), and the presence of cells in peripheral nerves or ganglia of other organisms that are able to produce melanocytes and other cell neural crest derivatives (Nichols et al., 1977Go; Nichols and Weston, 1977Go; Ciment et al., 1986Go; Nataf and Le Douarin, 2000Go; Rizvi et al., 2002Go; Joseph et al., 2004Go).

Beyond the embryo, our data also indicate a role for ErbB signals during metamorphosis. At this stage, ErbB signals are likely to act autonomously to metamorphic melanophores, given their expression of erbb3b and erbb2, but also could have non-autonomous effects if interactions among melanophores promote the survival, proliferation or differentiation of these cells (Parichy et al., 2000bGo; Parichy and Turner, 2003bGo).

In conclusion, this study supports a model in which ErbB signals, which are mediated in part through erbb3b, are required in the embryo to establish latent precursors that will subsequently generate metamorphic melanophores. Later, during metamorphosis, ErbB signals contribute to melanophore development but are partly or entirely redundant with other pathways. We speculate that erbb3b promotes the development of latent precursors intrinsically, and also is required extrinsically to form a niche where these cells reside until recruited at metamorphosis.


   ACKNOWLEDGMENTS
 
Thanks to members of the Parichy laboratory for helpful discussions and for assistance with fish rearing, to Will Talbot's laboratory for complementation testing of picasso against erbb3b, to Melissa Harris for comments on the manuscript, to Dave Raible's laboratory and especially Hillary McGraw for discussions and advice, and to Judith Eisen and Yasuko Honjo for sharing data prior to publication. Supported by NIH R01 GM62182 and NSF IOB 0541733 to D.M.P.


   REFERENCES
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Amoh, Y., Li, L., Katsuoka, K., Penman, S. and Hoffman, R. M. (2005). Multipotent nestin-positive, keratin-negative hair-follicle bulge stem cells can form neurons. Proc. Natl. Acad. Sci. USA 102,5530 -5534.[Abstract/Free Full Text]
Breuleux, M. (2007). Role of heregulin in human cancer. Cell. Mol. Life Sci. 64,2358 -2377.[CrossRef][Medline]
Britsch, S. (2007). The neuregulin-I/ErbB signaling system in development and disease. Adv. Anat. Embryol. Cell Biol. 190,1 -65.[CrossRef][Medline]
Britsch, S., Li, L., Kirchhoff, S., Theuring, F., Brinkmann, V., Birchmeier, C. and Riethmacher, D. (1998). The ErbB2 and ErbB3 receptors and their ligand, neuregulin-1, are essential for development of the sympathetic nervous system. Genes Dev. 12,1825 -1836.[Abstract/Free Full Text]
Brosamle, C. and Halpern, M. E. (2002). Characterization of myelination in the developing zebrafish. Glia 39,47 -57.[CrossRef][Medline]
Brown, D. D. (1997). The role of thyroid hormone in zebrafish and axolotl development. Proc. Natl. Acad. Sci. USA 94,13011 -13016.[Abstract/Free Full Text]
Brown, D. D. and Cai, L. (2007). Amphibian metamorphosis. Dev. Biol. 306, 20-33.[CrossRef][Medline]
Chen, S., Rio, C., Ji, R. R., Dikkes, P., Coggeshall, R. E., Woolf, C. J. and Corfas, G. (2003). Disruption of ErbB receptor signaling in adult non-myelinating Schwann cells causes progressive sensory loss. Nat. Neurosci. 6,1186 -1193.[CrossRef][Medline]
Ciment, G., Glimelius, B., Nelson, D. M. and Weston, J. A. (1986). Reversal of a developmental restriction in neural crest-derived cells of avian embryos by a phorbol ester drug. Dev. Biol. 118,392 -398.[CrossRef][Medline]
Citri, A. and Yarden, Y. (2006). EGF-ERBB signalling: towards the systems level. Nat. Rev. Mol. Cell Biol. 7,505 -516.[CrossRef][Medline]
Clark, C. R., Taylor, J. D. and Tchen, T. T. (1987). Purification of Black Moor goldfish melanophores and responses to epinephrine. In Vitro Cell Dev. Biol. 23,417 -421.[CrossRef][Medline]
Cubbage, C. C. and Mabee, P. M. (1996). Development of the cranium and paired fins in the zebrafish Danio rerio (ostariophysi, Cyprinidae). J. Morphol. 229,121 -160.[CrossRef]
Dupin, E. and Le Douarin, N. M. (2003). Development of melanocyte precursors from the vertebrate neural crest. Oncogene 22,3016 -3023.[CrossRef][Medline]
Dupin, E., Real, C., Glavieux-Pardanaud, C., Vaigot, P. and Le Douarin, N. M. (2003). Reversal of developmental restrictions in neural crest lineages: transition from Schwann cells to glial-melanocytic precursors in vitro. Proc. Natl. Acad. Sci. USA 100,5229 -5233.[Abstract/Free Full Text]
Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney, T. J., Rauch, J., Geisler, R., Haffter, P. and Kelsh, R. N. (2001). Zebrafish colourless encodes sox10 and specifies non-ectomesenchymal neural crest fates. Development 128,4113 -4125.[Abstract/Free Full Text]
Elizondo, M. R., Arduini, B. L., Paulsen, J., MacDonald, E. L., Sabel, J. L., Henion, P. D., Cornell, R. A. and Parichy, D. M. (2005). Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr. Biol. 15,667 -671.[CrossRef][Medline]
Engeszer, R. E., Alberici da Barbiano, L., Ryan, M. J. and Parichy, D. M. (2007). Timing and plasticity of shoaling behaviour in the zebrafish, Danio rerio. Anim. Behav. doi:10.1016/j.anbehav.2007.01.032 .[Medline]
Fitch, K. R., McGowan, K. A., van Raamsdonk, C. D., Fuchs, H., Lee, D., Puech, A., Hérault, Y., Threadgill, D., Hrabé de Angelis, M. and Barsh, G. S. (2003). Genetics of dark skin in mice. Genes Dev. 17,214 -228.[Abstract/Free Full Text]
Frohnert, P. W., Stonecypher, M. S. and Carroll, S. L. (2003). Constitutive activation of the neuregulin-1/ErbB receptor signaling pathway is essential for the proliferation of a neoplastic Schwann cell line. Glia 43,104 -118.[CrossRef][Medline]
Frolov, A., Schuller, K., Tzeng, C. W., Cannon, E. E., Ku, B. C., Howard, J. H., Vickers, S. M., Heslin, M. J., Buchsbaum, D. J. and Arnoletti, J. P. (2007). ErbB3 expression and dimerization with EGFR influence pancreatic cancer cell sensitivity to erlotinib. Cancer Biol. Ther. 6,548 -554.[Medline]
Fry, D. W., Nelson, J. M., Slintak, V., Keller, P. R., Rewcastle, G. W., Denny, W. A., Zhou, H. and Bridges, A. J. (1997). Biochemical and antiproliferative properties of 4-[ar(alk)ylamino]pyridopyrimidines, a new chemical class of potent and specific epidermal growth factor receptor tyrosine kinase inhibitor. Biochem. Pharmacol. 54,877 -887.[CrossRef][Medline]
Funes, M., Miller, J. K., Lai, C., Carraway, K. L., 3rd and Sweeney, C. (2006). The mucin Muc4 potentiates neuregulin signaling by increasing the cell-surface populations of ErbB2 and ErbB3. J. Biol. Chem. 281,19310 -19319.[Abstract/Free Full Text]
Gilmour, D. T., Maischein, H. M. and Nusslein-Volhard, C. (2002). Migration and function of a glial subtype in the vertebrate peripheral nervous system. Neuron 34,577 -588.[CrossRef][Medline]
Goishi, K., Lee, P., Davidson, A. J., Nishi, E., Zon, L. I. and Klagsbrun, M. (2003). Inhibition of zebrafish epidermal growth factor receptor activity results in cardiovascular defects. Mech. Dev. 120,811 -822.[CrossRef][Medline]
Gomez, A., Volff, J. N., Hornung, U., Schartl, M. and Wellbrock, C. (2004). Identification of a second egfr gene in Xiphophorus uncovers an expansion of the epidermal growth factor receptor family in fish. Mol. Biol. Evol. 21,266 -275.[Abstract/Free Full Text]
Gordon-Thomson, C., Mason, R. S. and Moore, G. P. (2001). Regulation of epidermal growth factor receptor expression in human melanocytes. Exp. Dermatol. 10,321 -328.[CrossRef][Medline]
Gordon-Thomson, C., Jones, J., Mason, R. S. and Moore, G. P. (2005). ErbB receptors mediate both migratory and proliferative activities in human melanocytes and melanoma cells. Melanoma Res. 15,21 -28.[CrossRef][Medline]
Graus-Porta, D., Beerli, R. R., Daly, J. M. and Hynes, N. E. (1997). ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. EMBO J. 16,1647 -1655.[CrossRef][Medline]
Guy, P. M., Platko, J. V., Cantley, L. C., Cerione, R. A. and Carraway, K. L., 3rd (1994). Insect cell-expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc. Natl. Acad. Sci. USA 91,8132 -8136.[Abstract/Free Full Text]
Henion, P. D., Raible, D. W., Beattie, C. E., Stoesser, K. L., Weston, J. A. and Eisen, J. S. (1996). Screen for mutations affecting development of Zebrafish neural crest. Dev. Genet. 18,11 -17.[CrossRef][Medline]
Honjo, Y., Kniss, J. and Eisen, J. S. (2008). Neuregulin-mediated ErbB3 signaling is required for formation of zebrafish dorsal root ganglion neurons. Development 135,2615 -2625.[Abstract/Free Full Text]
Hsu, S. C. and Hung, M. C. (2007). Characterization of a novel tripartite nuclear localization sequence in the EGFR family. J. Biol. Chem. 282,10432 -10440.[Abstract/Free Full Text]
Iwashita, M., Watanabe, M., Ishii, M., Chen, T., Johnson, S. L., Kurachi, Y., Okada, N. and Kondo, S. (2006). Pigment pattern in jaguar/obelix zebrafish is caused by a Kir7.1 mutation: Implications for the regulation of melanosome movement. Plos Genet. 2,1861 -1870.
Johnson, S. L., Africa, D., Walker, C. and Weston, J. A. (1995). Genetic control of adult pigment stripe development in zebrafish. Dev. Biol. 167, 27-33.[CrossRef][Medline]
Jones, J. T., Akita, R. W. and Sliwkowski, M. X. (1999). Binding specificities and affinities of egf domains for ErbB receptors. FEBS Lett. 447,227 -231.[CrossRef][Medline]
Joseph, N. M., Mukouyama, Y. S., Mosher, J. T., Jaegle, M., Crone, S. A., Dormand, E. L., Lee, K. F., Meijer, D., Anderson, D. J. and Morrison, S. J. (2004). Neural crest stem cells undergo multilineage differentiation in developing peripheral nerves to generate endoneurial fibroblasts in addition to Schwann cells. Development 131,5599 -5612.[Abstract/Free Full Text]
Kelsh, R. N. (2004). Genetics and evolution of pigment patterns in fish. Pigment Cell Res. 17,326 -336.[CrossRef][Medline]
Kelsh, R. N., Schmid, B. and Eisen, J. S. (2000). Genetic analysis of melanophore development in zebrafish embryos. Dev. Biol. 225,277 -293.[CrossRef][Medline]
Lamason, R. L., Mohideen, M. A., Mest, J. R., Wong, A. C., Norton, H. L., Aros, M. C., Jurynec, M. J., Mao, X., Humphreville, V. R., Humbert, J. E. et al. (2005). SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and humans. Science 310,1782 -1786.[Abstract/Free Full Text]
Lenferink, A. E., Busse, D., Flanagan, W. M., Yakes, F. M. and Arteaga, C. L. (2001). ErbB2/neu kinase modulates cellular p27(Kip1) and cyclin D1 through multiple signaling pathways. Cancer Res. 61,6583 -6591.[Abstract/Free Full Text]
Levitzki, A. and Gazit, A. (1995). Tyrosine kinase inhibition: an approach to drug development. Science 267,1782 -1788.[Abstract/Free Full Text]
Levitzki, A. and Mishani, E. (2006). Tyrphostins and other tyrosine kinase inhibitors. Annu. Rev. Biochem. 75,93 -109.[CrossRef][Medline]
Lister, J. A., Robertson, C. P., Lepage, T., Johnson, S. L. and Raible, D. W. (1999). nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate. Development 126,3757 -3767.[Abstract]
Luo, R., An, M., Arduini, B. L. and Henion, P. D. (2001). Specific pan-neural crest expression of zebrafish Crestin throughout embryonic development. Dev. Dyn. 220,169 -174.[CrossRef][Medline]
Lyons, D. A., Pogoda, H. M., Voas, M. G., Woods, I. G., Diamond, B., Nix, R., Arana, N., Jacobs, J. and Talbot, W. S. (2005). erbb3 and erbb2 are essential for schwann cell migration and myelination in zebrafish. Curr. Biol. 15,513 -524.[CrossRef][Medline]
Marusich, M. F., Furneaux, H. M., Henion, P. D. and Weston, J. A. (1994). Hu neuronal proteins are expressed in proliferating neurogenic cells. J. Neurobiol. 25,143 -155.[CrossRef][Medline]
Massie, C. and Mills, I. G. (2006). The developing role of receptors and adaptors. Nat. Rev. Cancer 6,403 -409.[CrossRef][Medline]
Mellgren, E. M. and Johnson, S. L. (2004). A requirement for kit in embryonic zebrafish melanocyte differentiation is revealed by melanoblast delay. Dev. Genes Evol. 214,493 -502.[Medline]
Mills, M. G., Nuckels, R. J. and Parichy, D. M. (2007). Deconstructing evolution of adult phenotypes: genetic analyses of kit reveal homology and evolutionary novelty during adult pigment pattern development of Danio fishes. Development 134,1081 -1090.[Abstract/Free Full Text]
Mirmohammadsadegh, A., Hassan, M., Gustrau, A., Doroudi, R., Schmittner, N., Nambiar, S., Tannapfel, A., Ruzicka, T. and Hengge, U. R. (2005). Constitutive expression of epidermal growth factor receptors on normal human melanocytes. J. Invest. Dermatol. 125,392 -394.[Medline]
Moran, N. A. (1994). Adaptation and constraint in the complex life cycles of animals. Annu. Rev. Ecol. Syst. 25,573 -600.[CrossRef]
Nasevicius, A. and Ekker, S. C. (2000). Effective targeted gene `knockdown' in zebrafish. Nat. Genet. 26,216 -220.[CrossRef][Medline]
Nataf, V. and Le Douarin, N. M. (2000). Induction of melanogenesis by tetradecanoylphorbol-13 acetate and endothelin 3 in embryonic avian peripheral nerve cultures. Pigment Cell Res. 13,172 -178.[CrossRef][Medline]
Nichols, D. H. and Weston, J. A. (1977). Melanogenesis in cultures of peripheral nervous tissue. I. The origin and prospective fate of cells giving rise to melanocytes. Dev. Biol. 60,217 -225.[CrossRef][Medline]
Nichols, D. H., Kaplan, R. A. and Weston, J. A. (1977). Melanogenesis in cultures of peripheral nervous tissue. II. Environmental factors determining the fate of pigment-forming cells. Dev. Biol. 60,226 -237.[CrossRef][Medline]
Oda, K., Matsuoka, Y., Funahashi, A. and Kitano, H. (2005). A comprehensive pathway map of epidermal growth factor receptor signaling. Mol. Syst. Biol. 1, 2005.0010.
Offterdinger, M., Schofer, C., Weipoltshammer, K. and Grunt, T. W. (2002). c-erbB-3: a nuclear protein in mammary epithelial cells. J. Cell Biol. 157,929 -939.[Abstract/Free Full Text]
Parichy, D. M. (1998). Experimental analysis of character coupling across a complex life cycle: pigment pattern metamorphosis in the tiger salamander, Ambystoma tigrinum tigrinum. J. Morphol. 237,53 -67.[CrossRef][Medline]
Parichy, D. M. (2006). Evolution of danio pigment pattern development. Heredity 97,200 -210.[CrossRef][Medline]
Parichy, D. M. and Turner, J. M. (2003a). Temporal and cellular requirements for Fms signaling during zebrafish adult pigment pattern development. Development 130,817 -833.[Abstract/Free Full Text]
Parichy, D. M. and Turner, J. M. (2003b). Zebrafish puma mutant decouples pigment pattern and somatic metamorphosis. Dev. Biol. 256,242 -257.[CrossRef][Medline]
Parichy, D. M., Rawls, J. F., Pratt, S. J., Whitfield, T. T. and Johnson, S. L. (1999). Zebrafish sparse corresponds to an orthologue of c-kit and is required for the morphogenesis of a subpopulation of melanocytes, but is not essential for hematopoiesis or primordial germ cell development. Development 126,3425 -3436.[Abstract]
Parichy, D. M., Mellgren, E. M., Rawls, J. F., Lopes, S. S., Kelsh, R. N. and Johnson, S. L. (2000a). Mutational analysis of endothelin receptor b1 (rose) during neural crest and pigment pattern development in the zebrafish Danio rerio. Dev. Biol. 227,294 -306.[CrossRef][Medline]
Parichy, D. M., Ransom, D. G., Paw, B., Zon, L. I. and Johnson, S. L. (2000b). An orthologue of the kit-related gene fms is required for development of neural crest-derived xanthophores and a subpopulation of adult melanocytes in the zebrafish, Danio rerio. Development 127,3031 -3044.[Abstract]
Parichy, D. M., Turner, J. M. and Parker, N. B. (2003). Essential role for puma in development of postembryonic neural crest-derived cell lineages in zebrafish. Dev. Biol. 256,221 -241.[CrossRef][Medline]
Pogoda, H. M., Sternheim, N., Lyons, D. A., Diamond, B., Hawkins, T. A., Woods, I. G., Bhatt, D. H., Franzini-Armstrong, C., Dominguez, C., Arana, N. et al. (2006). A genetic screen identifies genes essential for development of myelinated axons in zebrafish. Dev. Biol. 298,118 -131.[CrossRef][Medline]
Poumay, Y. G. (2007). The dumb ErbB receptor helps healing. J. Invest. Dermatol. 127,995 -997.[CrossRef][Medline]
Quigley, I. K., Turner, J. M., Nuckels, R. J., Manuel, J. L., Budi, E. H., Macdonald, E. L. and Parichy, D. M. (2004). Pigment pattern evolution by differential deployment of neural crest and post-embryonic melanophore lineages in Danio fishes. Development 131,6053 -6069.[Abstract/Free Full Text]
Quigley, I. K., Manuel, J. L., Roberts, R. A., Nuckels, R. J., Herrington, E. R., Macdonald, E. L. and Parichy, D. M. (2005). Evolutionary diversification of pigment pattern in Danio fishes: differential fms dependence and stripe loss in D. albolineatus. Development 132,89 -104.[Abstract/Free Full Text]
Raible, D. W., Wood, A., Hodsdon, W., Henion, P. D., Weston, J. A. and Eisen, J. S. (1992). Segregation and early dispersal of neural crest cells in the embryonic zebrafish. Dev. Dyn. 195,29 -42.[Medline]
Rawls, J. F. and Johnson, S. L. (2000). Zebrafish kit mutation reveals primary and secondary regulation of melanocyte development during fin stripe regeneration. Development 127,3715 -3724.[Abstract]
Rawls, J. F. and Johnson, S. L. (2001). Requirements for the kit receptor tyrosine kinase during regeneration of zebrafish fin melanocytes. Development 128,1943 -1949.[Abstract/Free Full Text]
Rawls, J. F. and Johnson, S. L. (2003). Temporal and molecular separation of the kit receptor tyrosine kinase's roles in zebrafish melanocyte migration and survival. Dev. Biol. 262,152 -161.[CrossRef][Medline]
Rewcastle, G. W., Murray, D. K., Elliott, W. L., Fry, D. W., Howard, C. T., Nelson, J. M., Roberts, B. J., Vincent, P. W., Showalter, H. D., Winters, R. T. et al. (1998). Tyrosine kinase inhibitors. 14. Structure-activity relationships for methylamino-substituted derivatives of 4-[(3-bromophenyl)amino]-6-(methylamino)-pyrido[3,4-d]pyrimidine (PD 158780), a potent and specific inhibitor of the tyrosine kinase activity of receptors for the EGF family of growth factors. J. Med. Chem. 41,742 -751.[CrossRef][Medline]
Riethmacher, D., Sonnenberg-Riethmacher, E., Brinkmann, V., Yamaai, T., Lewin, G. R. and Birchmeier, C. (1997). Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature 389,725 -730.[CrossRef][Medline]
Rizvi, T. A., Huang, Y., Sidani, A., Atit, R., Largaespada, D. A., Boissy, R. E. and Ratner, N. (2002). A novel cytokine pathway suppresses glial cell melanogenesis after injury to adult nerve. J. Neurosci. 22,9831 -9840.[Abstract/Free Full Text]
Sergina, N. V. and Moasser, M. M. (2007). The HER family and cancer: emerging molecular mechanisms and therapeutic targets. Trends Mol. Med. 13,527 -534.[Medline]
Sharghi-Namini, S., Turmaine, M., Meier, C., Sahni, V., Umehara, F., Jessen, K. R. and Mirsky, R. (2006). The structural and functional integrity of peripheral nerves depends on the glial-derived signal desert hedgehog. J. Neurosci. 26,6364 -6376.[Abstract/Free Full Text]
Shin, M. K., Levorse, J. M., Ingram, R. S. and Tilghman, S. M. (1999). The temporal requirement for endothelin receptor-B signalling during neural crest development. Nature 402,496 -501.[CrossRef][Medline]
Sieber-Blum, M., Grim, M., Hu, Y. F. and Szeder, V. (2004). Pluripotent neural crest stem cells in the adult hair follicle. Dev. Dyn. 231,258 -269.[CrossRef][Medline]
Soltoff, S. P., Carraway, K. L., 3rd, Prigent, S. A., Gullick, W. G. and Cantley, L. C. (1994). ErbB3 is involved in activation of phosphatidylinositol 3-kinase by epidermal growth factor. Mol. Cell. Biol. 14,3550 -3558.[Abstract/Free Full Text]
Stein, R. A. and Staros, J. V. (2006). Insights into the evolution of the ErbB receptor family and their ligands from sequence analysis. BMC Evol. Biol. 6, 79.[CrossRef][Medline]
Stonecypher, M. S., Byer, S. J., Grizzle, W. E. and Carroll, S. L. (2005). Activation of the neuregulin-1/ErbB signaling pathway promotes the proliferation of neoplastic Schwann cells in human malignant peripheral nerve sheath tumors. Oncogene 24,5589 -5605.[CrossRef][Medline]
Stove, C., Stove, V., Derycke, L., Van Marck, V., Mareel, M. and Bracke, M. (2003). The heregulin/human epidermal growth factor receptor as a new growth factor system in melanoma with multiple ways of deregulation. J. Invest. Dermatol. 121,802 -812.[CrossRef][Medline]
Thisse, B. and Thisse, C. (2004). Fast release clones: a high throughput expression analysis. ZFIN Direct Data Submission, http://zfin.org.
Tingaud-Sequeira, A., Forgue, J., Andre, M. and Babin, P. J. (2006). Epidermal transient down-regulation of retinol-binding protein 4 and mirror expression of apolipoprotein Eb and estrogen receptor 2a during zebrafish fin and scale development. Dev. Dyn. 235,3071 -3079.[CrossRef][Medline]
Vaglia, J. L. and Hall, B. K. (2000). Patterns of migration and regulation of trunk neural crest cells in zebrafish (Danio rerio). Int. J. Dev. Biol. 44,867 -881.[Medline]
Watanabe, M., Iwashita, M., Ishii, M., Kurachi, Y., Kawakami, A., Kondo, S. and Okada, N. (2006). Spot pattern of leopard Danio is caused by mutation in the zebrafish connexin41.8 gene. EMBO Rep. 7,893 -897.[CrossRef][Medline]
Webb, J. F. (1999). Larvae in Fish Development and Evolution (ed. B. K. Hall and M. H. Wake), pp.109 -158. New York: Academic Press.
Wellbrock, C., Gomez, A. and Schartl, M. (2002). Melanoma development and pigment cell transformation in xiphophorus. Microsc. Res. Tech. 58,456 -463.[CrossRef][Medline]
Westerfield, M. (2000). The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio) 4th edn. Eugene, OR: University of Oregon Press.
Wong, C. E., Paratore, C., Dours-Zimmermann, M. T., Rochat, A., Pietri, T., Suter, U., Zimmermann, D. R., Dufour, S., Thiery, J. P., Meijer, D. et al. (2006). Neural crest-derived cells with stem cell features can be traced back to multiple lineages in the adult skin. J. Cell Biol. 175,1005 -1015.[Abstract/Free Full Text]
Yamaguchi, M., Yoshimoto, E. and Kondo, S. (2007). Pattern regulation in the stripe of zebrafish suggests an underlying dynamic and autonomous mechanism. Proc. Natl. Acad. Sci. USA 104,4790 -4793.[Abstract/Free Full Text]
Yang, C. T. and Johnson, S. L. (2006). Small molecule-induced ablation and subsequent regeneration of larval zebrafish melanocytes. Development 133,3563 -3573.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
 DevelopmentHome page
B. L. Arduini, K. M. Bosse, and P. D. Henion
Genetic ablation of neural crest cell diversification
Development, June 15, 2009; 136(12): 1987 - 1994.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
Y. Honjo, J. Kniss, and J. S. Eisen
Neuregulin-mediated ErbB3 signaling is required for formation of zebrafish dorsal root ganglion neurons
Development, August 1, 2008; 135(15): 2615 - 2625.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.019299v1
135/15/2603    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Budi, E. H.
Right arrow Articles by Parichy, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Budi, E. H.
Right arrow Articles by Parichy, D. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?