|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 July 2008
doi: 10.1242/dev.018341
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Equipe Ontogenèse et Cellules Souches du Tégument, Centre de
Recherche INSERM UJF - U823, Institut Albert Bonniot, Site Santé, La
Tronche, BP170, 38042 Grenoble Cedex 9, France.
2 Laboratoire de Techniques de l'Imagerie, de la Modélisation et de la
Cognition UMR CNRS 5525, Institut d'Informatique et de Mathématiques
Appliquées de Grenoble, Faculté de Médecine, 38706 La
Tronche, Cedex, France.
Author for correspondence (e-mail:
Danielle.Dhouailly{at}ujf-grenoble.fr)
Accepted 19 June 2008
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
4
integrin expression. Based on the observed cell proliferation, chemotaxis and
the timing of BMP2 and BMP7 expression, we propose a
mathematical model, a reaction-diffusion system, which not only simulates
feather patterning, but which also can account for the negative effects of
excess BMP2 or BMP7 on feather formation.
Key words: Dermis, Cutaneous appendage, Chemotaxis, Migration, Fibronectin, Mathematical model, Skin
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Dhouailly, 1984), and these
are distributed in an orderly fashion according to regional and specific
patterns. The major part of our current knowledge of the establishment of skin
patterns comes from studies of the chick embryo.
Chick skin can be divided into several domains: pterylae (feather field),
semi-apteria (region with a few feathers) and apteria (glabrous area)
(Mayerson and Fallon, 1985;
Sengel, 1976). The future
pterylae are characterized by the formation of a homogeneous, dense dermis
(Sengel, 1976). In the back,
this occurs from days 5 to 6.5 of incubation (stages HH25 to HH29)
(Hamburger and Hamilton,
1951), and at day 7 (HH30) the midline, where the first row of
feathers will appear, undergoes a further density increase. Before cell
migration occurs to form individual dermal condensations, cells proliferate up
to a threshold of 2.6 nuclei/1000 µm3
(Desbiens et al., 1991;
Jiang and Chuong, 1992;
Wessells, 1965). By contrast,
in semi-apteria the cell density remains under this threshold, reaching only
up to 2.0 nuclei/1000 µm3
(Olivera-Martinez et al.,
2001). We have shown previously
(Michon et al., 2007) that
when cell density exceeds the threshold, proliferation stops and there is a
redistribution of cells to form dermal condensations, where the cell density
reaches 5.52 nuclei/1000 µm3
(Wessells, N. K. 1965). These
dermal condensations arise under the epidermal placodes. These two structures
form the feather primordium, and the lateral propagation of this process
creates a hexagonal feather pattern.
Several signaling pathways (Chuong,
1998) have been implicated in the crosstalk between the epidermis
and the dense dermis that leads to feather morphogenesis. The exact sequence
of events, in the narrow time window available for primordium formation, is
not yet clear. The different signals have been classified as activators or
inhibitors (Jung et al.,
1998). The FGF pathway acts as an activator, and its epidermal
expression promotes dermal condensation formation via its chemoattractant
effect on fibroblasts (Song et al.,
1996; Song et al.,
2004; Viallet et al.,
1998). To date, BMPs have generally been considered to be
inhibitors of feather formation, and three members are expressed in the
primordium domain: BMP2, BMP4 and BMP7, where BMP2 and BMP4 belong to the same
subgroup (Miyazono et al.,
2005). BMP2 is initially expressed throughout the
epidermis, but is later restricted to placodes and appears in dermal
condensations (Noramly and Morgan,
1998). BMP4 transcripts are detected only in the forming
dermal condensations (Noramly and Morgan,
1998). BMP7 is expressed throughout the epidermis before
placode formation and is subsequently restricted to the primordium, in both
dermis and epidermis (Harris et al.,
2004). BMP2 expression occurs earlier than BMP4
(Houghton et al., 2005), and
later than BMP7 (Harris et al.,
2004). The transcriptional regulation of BMP2 and
BMP4 expression in embryonic skin is still unknown. BMP7 is
expressed in the epidermis under the control of an unknown dermal signal,
whereas its dermal expression is regulated by canonical Wnt signaling derived
from the placode (Harris et al.,
2004).
Studies designed to evaluate the function of BMPs in developing skin have
provided incongruous data. The BMP pathway has been demonstrated to function
as an inhibitor of feather (Jung et al.,
1998), as well as of hair
(Botchkarev, 2003) and tooth
(Pummila et al., 2007),
formation, under certain experimental conditions. BMP4-coated beads grafted
onto chick HH28 (E6) dorsal skin inhibits adjacent feather formation
(Jung et al., 1998), and
BMP4 overexpression in chick embryo dorsal skin leads to the
formation of glabrous areas (Noramly and
Morgan, 1998). However, the other pieces of evidence are
contradictory. The application of BMP7-coated beads inhibits feather formation
(Patel et al., 1999), although
its epidermal expression has been shown to be required
(Harris et al., 2004). An
ectopic feather-forming dermis can be obtained in two opposite ways: by the
inhibition of BMP signaling in the mid-ventral apterium
(Fliniaux et al., 2004), or by
grafting a BMP4-coated bead into the dorsal-scapular semi-apterium
(Scaal et al., 2002). These
contradictory results might be explained by spatial factors, as the molecular
mechanisms responsible for the establishment of the dermis in the back and the
ventral region are different (Fliniaux et
al., 2004; Olivera-Martinez et
al., 2002). Moreover, for the back region, whereas the use of low
concentration BMP4-coated beads (20 µg/ml)
(Scaal et al., 2002) leads to
activation of feather formation, RCAS-BMP4 infection
(Noramly and Morgan, 1998) or
the use of high concentration BMP4-coated beads (660 µg/ml)
(Jung et al., 1998) leads to
an inhibitory effect. Additionally, some results suggest an activator role for
BMP signaling. MSX1 and MSX2, two BMP target genes, are
expressed in the placode (Noveen et al.,
1995). DRM/gremlin (BMP signaling antagonist) transcripts
are restricted to the interfollicular domain
(Bardot et al., 2004), and
although follistatin (another BMP signaling antagonist) expression initially
occurs throughout the placode, it rapidly shifts to a peripheral ring
(Patel et al., 1999).
Altogether, the expression of BMP target genes and the absence, or the
transient expression, of BMP inhibitors in the follicular domain, as well as
the importance of the concentration of the BMP delivered experimentally,
indicate a complex role for the BMPs in feather morphogenesis.
In order to distinguish the different roles of BMP signaling in chick
embryonic skin, we examined three different aspects. First, we investigated
the expression of another set of downstream targets of BMP signaling, the ID
genes (Hollnagel et al.,
1999), thought to inhibit cell differentiation
(Kreider et al., 1992;
Miyazono and Miyazawa, 2002;
Ogata et al., 1993). In chick,
four ID genes have been identified (Kee
and Bronner-Fraser, 2001), but we describe their expression in
skin. Second, we studied in vitro dermal fibroblast behavior in response to
different BMPs. Both fibroblast migration
(Mauger et al., 1982) and
Fibronectin (Chuong, 1993;
Michon et al., 2007) have been
implicated in the transition from a dense dermis to individual dermal
condensations. Alternative splicing of the fibronectin gene has been
identified as a key regulator of Fibronectin/Integrin affinity in CHO cells
(Manabe et al., 1997).
Furthermore, by promoting adhesion on 5β1 Integrin, the
Fibronectin EIIIA domain was shown to induce the G1-S transition
(Manabe et al., 1999). We thus
studied the changes in fibronectin EIIIA domain expression during dermal
organization. Finally, we established, in silico, a mathematical model based
on an activation/inhibition-diffusion Turing system
(Turing, 1952), which takes
into account the parameters of cell density and migration.
We show that instead of acting as `inhibitors', different BMPs play
distinct crucial roles, ranging from the regulation of dermal condensation
formation to the continuation of feather morphogenesis. Furthermore, our
numerical simulation is not only in agreement with our biological experimental
results, but also provides an explanation for apparently contradictory results
(Jung et al., 1998;
Noramly and Morgan, 1998)
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). rhBMP2, rhBMP7 and rhFGF2 were purchased from R&D
Systems, Europe.
Organotypic skin in vitro culture
Seven-day chick embryo (stage HH29 or 30) dorsal skins were dissected as a
single piece, starting from the wing to the femoral level. They were cultured
as previously described (Michon et al.,
2007). For localized application, 150 to 200 µm diameter
Affi-gel Blue beads (Bio-Rad) were soaked in PBS or rhBMP7 (concentrations
specified in figure legends) and then placed onto the explants.
Dermal fibroblast in vitro culture
The dermis was separated from the epidermis by treatment with Trypsin
(1.25%) and Pancreatin (4%, Sigma-Aldrich), then was mechanically dissociated
into a single-cell suspension. Cells were used for RT-PCR, adherent cell
culture, cell migration assay or micromass formation. To evaluate cell
migration, 2.5x104 cells were used for each experimental
condition using the Innocyte cell migration assay (VWR International)
(Lauffenburger, 1996).
Migration was measured after 10 hours by Calcein-AM dye. Fetal Bovine Serum
was used as an attraction factor for cells as a positive control. Micromass
culture was performed as described previously
(Michon et al., 2007).
FACS analysis
HH29 and HH30 chick embryo dorsal skins were dissected into separate medial
and lateral parts. Obtained dermal cell suspensions were fixed in cold ethanol
(2x106 cells/ml). Cell aggregates were broken up mechanically
and cells were labeled in 0.1% NP40, 0.1 mg/ml RNAse A, 50 µg/ml Propidium
Iodide (Sigma). Cells were rinsed in PBS and FACS analysis was performed using
Cell Quest Pro software (Becton Dickinson).
Molecular biology
RNA was isolated with the High Pure RNA tissue kit (Roche). Reverse
transcription was performed with the SuperScript First-Strand synthesis system
(Invitrogen). PCR products were analyzed with Image J software (NIH). Primers
used were: cActin sense, AGACCTTCAACACCCCAGC; cActin antisense,
TGATTTTCATTGTGCTAGG; cEIIIA sense, ATGGTACAGCGTCTATGCTCA; cEIIIA antisense,
AGACTGGTAGGAGTTACCTGA; Fibronectin sense, CAGTGGCTACCGAGTGACCAC; Fibronectin
antisense, AGACTGGTAGGAGTTACCTGA. Primers for chick Actin were designed to
discriminate between genomic and complementary DNA (926 bp versus 619 bp).
In situ hybridization
The chick EIIIA probe was cloned into the pGEM-T Easy vector
(Promega, France) [based on its published sequence
(Norton and Hynes, 1987)]. The
cBMP2 and cBMP7 probes were a gift from Dr A.-H.
Monsoro-Burq (Centre Universitaire, Orsay, France). The chick follistatin
probe was a gift from Dr A. Graham (King's College London, UK). The cID1,
cID3, cID4 and c4 integrin probes were a gift from Dr M.
Bronner-Fraser (University of California, Irvine, CA, USA). Alkaline
phosphatase-labelled in situ hybridizations were carried out as previously
described (Wilkinson and Nieto,
1993).
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Feather rows were numbered according to the order of
appearance. The femoral tract has seventeen rows, fifteen proximal to the
first one. Distal to the first row, a discontinuous line of expression that
gives rise to the third row occurred. This third row forms the boundary
between the femoral and zeugopodial tracts, which are on each side of a
semi-apteria. The expression of BMP2 and BMP7 in
corresponding feather primordia of the left and right halves of the same
embryo were compared at HH30 (n=6/6 for each comparison). In the
second row of this tract, BMP2 was expressed in only two primordia
(Fig. 1A), whereas BMP7 was
expressed in five (Fig. 1B).
Follistatin (Fig. 1D), a BMP
inhibitor, was expressed after BMP2
(Fig. 1C). The ID1,
ID3 and ID4 transcripts were detected in HH30 dorsal skin in the
primordia (Fig. 1E-G).
ID4 expression appeared initially in the complete primordium (newly
formed rows), but subsequently the transcripts were detected only as a
peripheral ring (Fig. 1G). The
expression of ID1 and ID4 was concomitant to that of
BMP2 (see Fig. S1A-D in the supplementary material), and the
expression of ID3 was concomitant to that of BMP7 (see Fig.
S1E,F in the supplementary material). These data indicate that the BMP pathway
is actively involved in feather formation.
|
|
), to the basic media with or without FBS. Each experiment,
done in triplicate, was measured relative to the cell migration obtained with
the basic medium containing FBS (100%). Without FBS, cell migration decreased
to 50.1% (P<0.001). FGF2 activated cell motility, in both the
presence (+11.9%, P<0.01) and the absence (+10.7%,
P<0.01) of FBS. Interestingly, BMP7 had an even stronger effect
than did FGF2 in the presence (+22.2%, P<0.01) and the absence
(+20%, P<0.01) of FBS, whereas BMP2 had an inhibitory effect on
migration: -18.7% (P<0.01) with and -11.9% (P<0.01)
without FBS. Combining BMP2 and BMP7 in the same medium cancelled out the
effect of each factor on dermal cell migration. The difference between the
chemotactic effect of both BMPs and that of only BMP7 was striking: -24.1%
(P<0.02) with and -18.9% (P<0.01) without FBS. Our in
vitro assay was independent of extracellular matrix, but, in vivo, there might
be interactions between it and the BMPs.
BMP2 modifies the expression of fibronectin EIIIA domain and 4 integrin
Analysis with the probe specific for the fibronectin EIIIA domain showed a
lack of expression in fully formed dorsal skin dermal condensations at HH29+,
although Fibronectin expression is high in this area
(Chuong, 1993;
Michon et al., 2007).
Moreover, the expression of the EIIIA domain was high in areas in which the
dense dermis was still undergoing organization
(Fig. 3A). At HH30, there was a
lateral expansion of EIIIA domain expression and a slight decrease of its
expression in the interfollicular domain of the first rows formed
(Fig. 3B). To analyze in time
the loss of the EIIIA domain transcripts, we compared its expression with that
of BMP2 (n=9/9). Whereas BMP2 was expressed in five
primordia on the fourth row (Fig.
3C), the loss of EIIIA expression occurred only in two of the
primordia of the same row (Fig.
3D). Furthermore, strong expression was detected at the distal
boundary of the tract close to the third row that has started to form. The
expression of BMP2 thus preceded the alternative splicing of the
fibronectin EIIIA domain.
|
|
)
to follow cell aggregation for 3 days. Semi-quantitative RT-PCR (n=3)
was performed in order to monitor fibronectin and fibronectin EIIIA expression
(Fig. 4). There was a decrease
of fibronectin expression from t0 (100%) to t72 (64.1%;
Fig. 4A), but the proportion of
fibronectin containing the EIIIA exon had decreased more, from 59.4 to 24.3%,
during the same time (Fig. 4B).
The relative decrease of EIIIA domain expression was also induced in adherent
cell culture via the addition of BMP2. Semi-quantitative RT-PCR of primary
cultured dermal fibroblasts showed expression of the EIIIA domain after 20
hours of culture under control conditions, whereas the addition of BMP2 led to
a decrease of EIIIA domain expression after 20 hours of treatment, from 61.1%
to 34.4% (Fig. 4C). There was a
slight effect caused by BMP7 treatment, from 61.1% to 53.1%.
4 Integrin was expressed in the follicular domain (data not shown),
and it was shown previously in the dermal condensation
(Jaspers et al., 1995). The
addition of BMP2 induced the overexpression of 4 integrin as well, from
100% to 125.3% (Fig. 4D). The
addition of BMP7 led to a non-significant increase of 4 integrin
expression. As the Fibronectin EIIIA domain was shown not only to modulate the
Fibronectin/Integrin interaction, but also to be implicated in the control of
cell proliferation (Manabe et al.,
1999), we quantified the population of cycling cells in dorsal
skin before and after dermal condensation formation.
Cell proliferation in the chick embryo dorsal skin at HH29 and HH30
Cycling cells have been localized previously in the interfollicular dermis
and not in the formed dermal condensation
(Rouzankina et al., 2004;
Wessells, 1965). We studied
cell proliferation during dermal condensation formation in chick embryo dorsal
skin from HH29 to HH30. At these stages, dorsal skin can be divided into three
parts: the medial part, carrying the first dermal condensation at HH30, and
the two lateral parts (see Fig. S2A,B in the supplementary material). The
proportion of cycling dermal cells in each part was determined by flow
cytometry (see Fig. S2C in the supplementary material). At HH29, the
difference between the lateral and the medial parts was not significant. The
slight decrease of cycling cells in the medial part might reflect the start of
dermal condensation formation. At HH30, the central part of the dermis, where
dermal condensations are forming, had 90.9% of cells in G1, whereas in the
lateral part only 77.5% of cells were in G1. The proliferation of dermal cells
just before condensation formation is likely to lead to the establishment of
the required cell density.
Mathematical model for dermal condensation formation and patterning
Our results have allowed us to build a new mathematical model for feather
primordia formation that includes cell proliferation and cell migration,
regulated by BMP7 and BMP2 expression. The model for BMP dynamics was inspired
by the activator-inhibitor model proposed by Gierer and Meinhardt
(Gierer and Meinhardt, 1972).
Cell migration is expressed as a chemotactic term, as in previous studies
(Cruywagen et al., 1992;
Painter et al., 1999). BMP7 is
an activator of feather primordium formation through its effect on chemotaxis
and cell recruitment, whereas BMP2 counteracts the positive effect of BMP7 on
cell migration. Another important issue is that the model can be run from
initial conditions consistent with the in vivo situation in the chick embryo
dorsal skin at HH29.
The mathematical model describes the spatiotemporal dynamics of four
variables: n1 n2, u and
v in a two-dimensional space 
. The dermal cell population,
whose concentration is noted n
(n=n1+n2), was divided
into two subpopulations: n1 (cycling cells) and
n2 (migrant cells). u and v represent
the concentration and the cellular effect, respectively, of BMP7 and BMP2.
Cellular dynamics
The proliferation of n1 cells is modeled by a logistic
growth function, where kp is the proliferation constant
and N the maximal cell population. n1 cells
proliferated until they reached a threshold of cell density
n* at the time t*. After the
concentration overcame the threshold, n1 cells
progressively stopped proliferating and acquired the ability to migrate. This
transition is determined by a `differentiation' constant
kd (taken as being equal to kp in the
following). For n2 cells, the migration flux was modeled
by a diffusive part with constant Dn and a chemotaxis part
with a constant 
. The chemoattractant is u.
Equations for n1 and n2
are:
n1,0 and n2,0 are the initial conditions for n1 and n2. No flux boundary condition is used for n2.
BMP dynamics
u and v dynamics have been given by reaction-diffusion
equations. Du and Dv denote the
respective diffusion constants. Reaction terms were made of a linear
degradation part (with constants ku and
kv) and a production part. The production part for each
chemical was constructed so as to respect the qualitative regulation between
them. As they are synthesized by n2 cells, production
terms are also taken proportional to n2. We
have:
c1, c2, c3 and c4 are positive constants.
Production terms stated that BMP7 expression was reinforced by a
`spot' (dermal condensation) microenvironment. For v=0: (1) for small
values of u, the secretion rate 
of BMP7 was proportional to
the number of n2 secreting cells
(=c1n2/c3);
(2) for medium values of u, followed Hill kinetics, with
autocatalyse of cooperativity 2 by BMP7
(=c1c2n2
u2/(c3+u2)); and
(3) for high values of u, autocatalyse saturated and was
proportional to n2
(c1c2n2).
For v>0, BMP2 was a competitive inhibitor of BMP7, and both
BMP2 and BMP7 were expressed by the same cell population
(primordium domain). Initial conditions for u and v are
given by u0 and v0, which are
generally taken as being equal to 0. No flux boundary conditions are used for
u and v.
Resulting model
The simple dynamics for n1 cells allows the exact
computation of n1(x,y,t), where (x,y)
are the 2D-space coordinates. If n* is defined as a
fraction Q of the maximal cell density N,
n*=QN, we
have:
for t
t*(x,y), and then
n1(x,y,t)=n*
eNkd(t-t*) if Q is
small, and n1(x,y,t)=n*
eNkd(t-t*)/(1-Q+QeNkd(t-t*)),
if Q is large. t*(x,y) is given
by:
This allows directly expressing the production term of
n2 cells as a delayed production term and reducing the
model as follows:
and reducing the model as equations 2, 3, 4, in which n1 is replaced by its expression above in terms of n* and t*.
Numerical simulations
The calculations were made using the software COMSOL Multiphysics 3.2 and
the finite elements method using squared meshes. We took
=]-1.1[x]0.1[and the parameters given in Table S1 (see
supplementary material).
For the sequential spots appearance numerical experiment, the initial
situations for n1 and n2 are given by:
n1,0(x)=0.25+1.7exp(-5x2)+0.2exp(-200x2)
and n2,0(x)=0.05+
2exp(-200x2). All other initial values are set to 0. Pulse
experiments are realized using the same initial situation. Pulses are modeled
by additional production terms in the equation of BMP7 or BMP2. For the local
pulse of BMP7 experiment, equation 3 becomes equation
3':
|
|
|
To investigate the impact of cell density on the pattern, we ran the model from initial situations in which n2 cells are homogeneously distributed in the domain with a density q, affected by small random fluctuations. n1 cells are not represented. Patterns are observed at the same time t=1000.
Dermal condensation formation obtained with numerical resolution
The result of running the simulation was the formation of a pattern of
spots that closely resembles the in vivo feather pattern: a medial first row
followed by the lateral formation of new rows leading to a hexagonal pattern
(Fig. 5A-D; see also Movies 1
and 2 in the supplementary material). Based on previous observations of our
laboratory (Olivera-Martinez et al.,
2001), we included the cell densities in the dermis of apterium,
semi-apterium and pteryla before and during the primordium formation in the
model parameters. For the formation of a hexagonal pattern, the cell density
threshold (N=2.6) and its repartition between primordium
(n=5.5) and interfollicular (n=1.5) was in accordance with
the in vivo observations. For the feather tract formation, a cell density
threshold (q=1) was required (Fig.
6A). Under this threshold (q=0.2 to 0.12), the pattern formation
was irregular (Fig. 6B,C),
similar to what is observed in semi-apteria. The cell density limit was
obtained with q=0.11, where no spots were formed
(Fig. 6D), similar to what
occurs in apteria.
The increase of activator, like that of inhibitor, led to spot inhibition
Using our mathematical model, an increase of the local pulse concentration
of activator led to the increase of cell recruitment under the source
according to the chemoattractant effect, resulting in an area of lower cell
density around the source, which could not support the formation of spots. The
inhibition of spot formation followed the overactivation of cell recruitment,
but the pattern was maintained beyond this circle of depleted cell density
(Fig. 7A-C; see also Movies 3
and 4 in the supplementary material). This result has been also obtained in
vitro (Fig. 7D-F). The diameter
of the circle lacking the formation of dermal condensations was augmented by
the application of BMP7 beads loaded with increasing concentrations,
presumably because of the chemoattractant effect of BMP7. The highest
concentration of BMP7 used (600 µg/ml) dramatically affected feather
patterning.
|
). It also
mimicked the results obtained by a global pulse of overactivation in
RCAS-BMP2/BMP4 experiments (Noramly and
Morgan, 1998). |
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
),
indicates that positive effects of the BMP pathway are required for feather
morphogenesis. We propose antagonistic roles for BMP7 and BMP2, during feather
primordium formation. BMP7 appears to act as a chemoattractant factor for
dermal fibroblasts, this effect of BMP7 has also been described on human
mesenchymal stem cells (Lee et al.,
2006). BMP2, which is expressed later, appears to arrest the
migration, slowing down cell recruitment to the condensation. The later
expression of BMP4 in the dermal condensation
(Noramly and Morgan, 1998)
could also act in the arrest of cell migration because of its redundant
activity with BMP2. As previously suggested in the osteogenic differentiation
(Hazama et al., 1995), the
concomitant presence of BMP2, BMP4 and BMP7 modifies the
effect of each factor on cell migration. We propose the BMP pathway as
regulator of both the formation of the dermal condensation, and the expression
of ID and MSX genes, which allows the continuation of feather
morphogenesis.
The different effects of BMP7 versus BMP2 and BMP4 appear linked to the
activation of different receptors. BMP7 activity is mediated by its binding to
Activin type I (ACTRI) (Miyazono,
1999) and type II (ACTRII)
(Sebald and Mueller, 2003)
receptors. A direct link between Activin receptor (ACTR) activation and cell
migration has been proposed in keratinocytes
(Zhang et al., 2005). These
mechanisms involve Rho-GTPases, which are required for fibroblast migration
(Michon et al., 2007). By
contrast, BMP2/BMP4 activity is mediated by their binding to BMP type I and II
receptors (Botchkarev, 2003).
Infection with a RCAS dominant-negative type I BMP receptor in the prospective
chick hindlimb resulted in the growth of feathers on scales
(Zou and Niswander, 1996). We
suggest that the enhancement of the dermal condensation, which was not limited
by BMP2 signaling, was the key factor. BMP2 might negatively affect cell
migration in at least three manners. First, because BMP2 in our in vitro
experiments regulated the alternative splicing of the EIIIA domain of
Fibronectin, we suggest that it might have a similar role in vivo. Although
there is an increase of Fibronectin deposition in the dermal condensation
(Mauger et al., 1982;
Michon et al., 2007), the
fibronectin EIIIA domain is spliced out in this area. Indeed, the skin
expression pattern of EIIIA reflects the state of dermal organization: cell
migration (EIIIA expression), or the formation of dermal condensations (loss
of EIIIA expression). Second, BMP2 might regulate cell migration via
a direct effect on integrin expression. Here, we showed an upregulation of
4 integrin expression. Likewise, BMP2 modulates the expression of
β1 integrin in osteoblasts (Sotobori
et al., 2006), or of 2 and 7 integrin in satellite
cells (Ozeki et al., 2007).
This direct link between BMP2 and integrin expression could explain the rapid
effect on primary dermal cells that we observed in our cell migration assay.
Finally, the loss of EIIIA in dermal condensation correlates, as has been
previously shown in other organs (Manabe
et al., 1999; Manabe et al.,
1997), with the absence of cycling cells in dermal condensations
(Jiang and Chuong, 1992;
Wessells, 1965), and could
thus reflect an indirect role for the BMP2 pathway on cell cycle regulation.
Altogether, the expression of BMP2 in dermal condensations could
trigger both the arrest of dermal cell migration, through the modulation of
adhesion factors, and the arrest of cell proliferation.
Consistent with these processes, we propose a mathematical model that
includes cell proliferation and cell migration by chemotaxis, but that is
still far less intricate than is reality. It is a single layer model that does
not take into account the first epidermal BMP7 impulse or its role in
the stabilization of the formed structures, or a potential heterodimerization
between the BMPs. In our model, we have attributed a chemoattractant role to
BMP7 and an arrest role to BMP2. It closely mimics the sequential hexagonal
pattern formation observed in vivo, and clarifies the relation between cell
densities and spot formation, which was hinted at in previous in vitro
experiments (Jiang et al.,
1999). Moreover, we showed that the difference in cell density
that is required to switch from the formation of spots to a glabrous area is
small (9%). Our mathematical model can also explain previous biological
results, which concluded that BMP factors act as inhibitors. The use of a
point source of a high concentration of activator, which induces an
over-recruitment of cells, creates an area without the required cell density
for dermal condensation formation, and thus mimics the nude area around a
BMP7-coated bead, which was previously interpreted as an inhibitory effect
(Patel et al., 1999). Our
model explains this result as an over-activation of chemotaxis. Other
biological results that were reproduced by our model are RCAS-BMP2 skin
infection (Noramly and Morgan,
1998), the use of BMP2-coated beads
(Jung et al., 1998), and the
addition of BMP2 in the culture medium (our experiments). All of these methods
led to the homogeneous overactivation of BMP2 in areas that then stay
glabrous. Our simulation showed that a local or a homogeneously high
concentration of the factor that arrests cell migration led to the formation
of a glabrous area. Our model can also partially explain the effects of
FGF4-coated beads on chick skin, i.e. the appearance of the typical small
inhibition ring around the bead (chemotaxis), but not the feather bud fusions
(Jung et al., 1998;
Widelitz et al., 1996).
Finally, we propose a new view of BMPs and dermis organization, which is
consistent with previous results, although not with their interpretations. It
consists of three major steps: dermal cell migration, follicular domain
delimitation, and the establishment of follicular domain identity
(Fig. 8). Initially there is a
limited proliferation along the dorsal midline until a critical cell density
is obtained. Then, the molecular dialogue between the epidermis and the
dermis, which leads to primordium formation, initiates. Activation of
β-catenin in the epidermis (Noramly
et al., 1999) is necessary for placode formation and,
consequently, dermal organization. The first permissive dermal signaling is a
combination of factors: WNT, for β-catenin stabilization; and others that
initiate FGF2 and BMP7 expression in the epidermis
(Harris et al., 2004). The
loss of either FGF2, in the Scaleless mutant, or
BMP7 function in the epidermis leads to feather defects
(Song et al., 1996;
Song et al., 2004;
Viallet et al., 1998;
Harris et al., 2004).
Diffusible epidermal chemoattractant factors, such as BMP7 and FGF2
(Song et al., 2004), trigger
the migration of dermal cells to the placodal area. Then, the dermal
expression of BMP7, which is regulated by a placodal WNT signal
(Harris et al., 2004),
enhances this process. BMP2 expression, in the placode and then in
the dermal condensation (Noramly and
Morgan, 1998), could modify dermal integrin expression and
regulate the splicing of fibronectin EIIIA; both of these events lead to a
decrease of dermal cell migration capabilities, signifying the second phase of
follicular domain delimitation. Two other facts contribute to the limitation
of the feather primordium diameter. The induction by BMP7 of follistatin
expression (Patel et al.,
1999) leads to a lateral inhibition of BMP signaling, which is
reinforced by the expression of DRM/gremlin
(Bardot et al., 2004). Finally,
the induction of the Notch system, after BMP2 expression (F.M.,
unpublished), stabilizes (Chen et al.,
1997) the follicular domain identity by strengthening its
boundaries.
Our main conclusion is that different members of the BMP family play at
least two important roles in chick dermal condensation formation. First,
epidermal, and then dermal, BMP7 activates the migration of dermal fibroblasts
to the appendage domain via chemotaxis. Second, epidermal, and then dermal,
BMP2 stops the migration, probably by regulating the expression of integrin
and fibronectin EIIIA. This effect, later reinforced by the expression of
BMP4 in the dermis, may lead to the limitation of dermal condensation
size. Moreover, the activation of target genes, such as members of the ID and
MSX families, suggests a subtle cell transcriptome regulation in the
primordium, caused by the transcriptional inhibitor role of the ID factors
(Kreider et al., 1992;
Miyazono and Miyazawa, 2002)
and the transcriptional activator role of the MSX factors
(Lallemand et al., 2005;
Ramos and Robert, 2005) during
the continuation of feather morphogenesis.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/16/2797/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bardot, B., Lecoin, L., Fliniaux, I., Huillard, E., Marx, M. and Viallet, J. P. (2004). Drm/Gremlin, a BMP antagonist, defines the interbud region during feather development. Int. J. Dev. Biol. 48,149 -156.[CrossRef][Medline]
Botchkarev, V. A. (2003). Bone morphogenetic proteins and their antagonists in skin and hair follicle biology. J. Invest. Dermatol. 120, 36-47.[CrossRef][Medline]
Chen, C. W., Jung, H. S., Jiang, T. X. and Chuong, C. M. (1997). Asymmetric expression of Notch/Delta/Serrate is associated with the anterior-posterior axis of feather buds. Dev. Biol. 188,181 -187.[CrossRef][Medline]
Chuong, C. M. (1993). The making of a feather: homeoproteins, retinoids and adhesion molecules. BioEssays 15,513 -521.[CrossRef][Medline]
Chuong, C. M. (1998). Molecular Basis of Epithelial Appendage Morphogenesis. Austin, TX: Landes Bioscience.
Chuong, C. M., Widelitz, R. B., Ting-Berreth, S. and Jiang, T. X. (1996). Early events during avian skin appendage regeneration: dependence on epithelial-mesenchymal interaction and order of molecular reappearance. J. Invest. Dermatol. 107,639 -646.[CrossRef][Medline]
Cruywagen, G. C., Maini, P. K. and Murray, J. D.
(1992). Sequential pattern formation in a model for skin
morphogenesis. IMA J. Math. Appl. Med. Biol.
9, 227-248.
Desbiens, X., Queva, C., Jaffredo, T., Stehelin, D. and Vandenbunder, B. (1991). The relationship between cell proliferation and the transcription of the nuclear oncogenes c-myc, c-myb and c-ets-1 during feather morphogenesis in the chick embryo. Development 111,699 -713.[Abstract]
Dhouailly, D. (1977). Dermo-epidermal interactions during morphogenesis of cutaneous appendages in amniotes. In Frontier Matrix Biology, vol. 4 (ed. L. Robert), pp. 85-91. Paris: Creteil.
Dhouailly, D. (1984). Specification of feather and scale patterns. In Pattern formation (ed. G. Malacinski and S. Bryant), pp. 581-601. London: Macmillan.
Fliniaux, I., Viallet, J. P. and Dhouailly, D.
(2004). Signaling dynamics of feather tract formation from the
chick somatopleure. Development
131,3955
-3966.
Gierer, A. and Meinhardt, H. (1972). A theory of biological pattern formation. Kybernetik 12, 30-39.[CrossRef][Medline]
Hamburger, V. and Hamilton, H. L. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88,49 -92.[CrossRef]
Harris, M. P., Linkhart, B. L. and Fallon, J. F. (2004). Bmp7 mediates early signaling events during induction of chick epidermal organs. Dev. Dyn. 231, 22-32.[CrossRef][Medline]
Hazama, M., Aono, A., Ueno, N. and Fujisawa, Y. (1995). Efficient expression of a heterodimer of bone morphogenetic protein subunits using a baculovirus expression system. Biochem. Biophys. Res. Commun. 209,859 -866.[CrossRef][Medline]
Hollnagel, A., Oehlmann, V., Heymer, J., Ruther, U. and
Nordheim, A. (1999). Id genes are direct targets of bone
morphogenetic protein induction in embryonic stem cells. J. Biol.
Chem. 274,19838
-19845.
Houghton, L., Lindon, C. and Morgan, B. A.
(2005). The ectodysplasin pathway in feather tract development.
Development 132,863
-872.
Jaspers, M., Wu, R. R., Van der Schueren, B. and Cassiman, J. J. (1995). Localization of alpha 4m integrin at sites of mesenchyme condensation during embryonic mouse development. Differentiation 59,79 -86.[CrossRef][Medline]
Jiang, T. X. and Chuong, C. M. (1992). Mechanism of skin morphogenesis. I. Analyses with antibodies to adhesion molecules tenascin, N-CAM, and integrin. Dev. Biol. 150, 82-98.[CrossRef][Medline]
Jiang, T. X., Jung, H. S., Widelitz, R. B. and Chuong, C. M. (1999). Self-organization of periodic patterns by dissociated feather mesenchymal cells and the regulation of size, number and spacing of primordia. Development 126,4997 -5009.[Abstract]
Jiang, T. X., Widelitz, R. B., Shen, W. M., Will, P., Wu, D. Y., Lin, C. M., Jung, H. S. and Chuong, C. M. (2004). Integument pattern formation involves genetic and epigenetic controls: feather arrays simulated by digital hormone models. Int. J. Dev. Biol. 48,117 -135.[CrossRef][Medline]
Jung, H. S., Francis-West, P. H., Widelitz, R. B., Jiang, T. X., Ting-Berreth, S., Tickle, C., Wolpert, L. and Chuong, C. M. (1998). Local inhibitory action of BMPs and their relationships with activators in feather formation: implications for periodic patterning. Dev. Biol. 196,11 -23.[CrossRef][Medline]
Kee, Y. and Bronner-Fraser, M. (2001). Id4 expression and its relationship to other Id genes during avian embryonic development. Mech. Dev. 109,341 -345.[CrossRef][Medline]
Kreider, B. L., Benezra, R., Rovera, G. and Kadesch, T.
(1992). Inhibition of myeloid differentiation by the
helix-loop-helix protein Id. Science
255,1700
-1702.
Lallemand, Y., Nicola, M. A., Ramos, C., Bach, A., Cloment, C.
S. and Robert, B. (2005). Analysis of Msx1; Msx2 double
mutants reveals multiple roles for Msx genes in limb development.
Development 132,3003
-3014.
Lauffenburger, D. A. (1996). Cell motility. Making connections count. Nature 383,390 -391.[CrossRef][Medline]
Lee, D. H., Park, B. J., Lee, M. S., Lee, J. W., Kim, J. K., Yang, H. C. and Park, J. C. (2006). Chemotactic migration of human mesenchymal stem cells and MC3T3-E1 osteoblast-like cells induced by COS-7 cell line expressing rhBMP-7. Tissue Eng. 12,1577 -1586.[CrossRef][Medline]
Manabe, R., Ohe, N., Maeda, T., Fukuda, T. and Sekiguchi, K.
(1997). Modulation of cell-adhesive activity of fibronectin by
the alternatively spliced EDA segment. J. Cell Biol.
139,295
-307.
Manabe, R., Oh-e, N. and Sekiguchi, K. (1999).
Alternatively spliced EDA segment regulates fibronectin-dependent cell cycle
progression and mitogenic signal transduction. J. Biol.
Chem. 274,5919
-5924.
Mauger, A., Demarchez, M., Herbage, D., Grimaud, J. A., Druguet, M., Hartmann, D. and Sengel, P. (1982). Immunofluorescent localization of collagen types I and III, and of fibronectin during feather morphogenesis in the chick embryo. Dev. Biol. 94, 93-105.[CrossRef][Medline]
Mayerson, P. L. and Fallon, J. F. (1985). The spatial pattern and temporal sequence in which feather germs arise in the white Leghorn chick embryo. Dev. Biol. 109,259 -267.[CrossRef][Medline]
Michon, F., Charveron, M. and Dhouailly, D. (2007). Dermal condensation formation in the chick embryo: requirement for integrin engagement and subsequent stabilization by a possible notch/integrin interaction. Dev. Dyn. 236,755 -768.[CrossRef][Medline]
Miyazono, K. (1999). Signal transduction by bone morphogenetic protein receptors: functional roles of Smad proteins. Bone 25,91 -93.[CrossRef][Medline]
Miyazono, K. and Miyazawa, K. (2002). Id: a target of BMP signaling. Sci. STKE 2002, PE40.[Medline]
Miyazono, K., Maeda, S. and Imamura, T. (2005). BMP receptor signaling: transcriptional targets, regulation of signals, and signaling cross-talk. Cytokine Growth Factor Rev. 16,251 -263.[CrossRef][Medline]
Noramly, S. and Morgan, B. A. (1998). BMPs mediate lateral inhibition at successive stages in feather tract development. Development 125,3775 -3787.[Abstract]
Noramly, S., Freeman, A. and Morgan, B. A. (1999). beta-catenin signaling can initiate feather bud development. Development 126,3509 -3521.[Abstract]
Norton, P. A. and Hynes, R. O. (1987).
Alternative splicing of chicken fibronectin in embryos and in normal and
transformed cells. Mol. Cell. Biol.
7,4297
-4307.
Noveen, A., Jiang, T. X., Ting-Berreth, S. A. and Chuong, C. M. (1995). Homeobox genes Msx-1 and Msx-2 are associated with induction and growth of skin appendages. J. Invest. Dermatol. 104,711 -719.[CrossRef][Medline]
Ogata, T., Wozney, J. M., Benezra, R. and Noda, M.
(1993). Bone morphogenetic protein 2 transiently enhances
expression of a gene, Id (inhibitor of differentiation), encoding a
helix-loop-helix molecule in osteoblast-like cells. Proc. Natl.
Acad. Sci. USA 90,9219
-9222.
Olivera-Martinez, I., Thelu, J., Teillet, M. A. and Dhouailly, D. (2001). Dorsal dermis development depends on a signal from the dorsal neural tube, which can be substituted by Wnt-1. Mech. Dev. 100,233 -244.[CrossRef][Medline]
Olivera-Martinez, I., Missier, S., Fraboulet, S., Thelu, J. and Dhouailly, D. (2002). Differential regulation of the chick dorsal thoracic dermal progenitors from the medial dermomyotome. Development 129,4763 -4772.[Medline]
Ozeki, N., Jethanandani, P., Nakamura, H., Ziober, B. L. and Kramer, R. H. (2007). Modulation of satellite cell adhesion and motility following BMP2-induced differentiation to osteoblast lineage. Biochem. Biophys. Res. Commun. 353, 54-59.[CrossRef][Medline]
Painter, K. J., Maini, P. K. and Othmer, H. G.
(1999). Stripe formation in juvenile Pomacanthus explained by a
generalized Turing mechanism with chemotaxis. Proc. Natl. Acad.
Sci. USA 96,5549
-5554.
Patel, K., Makarenkova, H. and Jung, H. S. (1999). The role of long range, local and direct signalling molecules during chick feather bud development involving the BMPs, follistatin and the Eph receptor tyrosine kinase Eph-A4. Mech. Dev. 86,51 -62.[CrossRef][Medline]
Pummila, M., Fliniaux, I., Jaatinen, R., James, M. J.,
Laurikkala, J., Schneider, P., Thesleff, I. and Mikkola, M. L.
(2007). Ectodysplasin has a dual role in ectodermal
organogenesis: inhibition of Bmp activity and induction of Shh expression.
Development 134,117
-125.
Ramos, C. and Robert, B. (2005). msh/Msx gene family in neural development. Trends Genet. 21,624 -632.[CrossRef][Medline]
Rouzankina, I., Abate-Shen, C. and Niswander, L. (2004). Dlx genes integrate positive and negative signals during feather bud development. Dev. Biol. 265,219 -233.[CrossRef][Medline]
Scaal, M., Prols, F., Fuchtbauer, E. M., Patel, K., Hornik, C., Kohler, T., Christ, B. and Brand-Saberi, B. (2002). BMPs induce dermal markers and ectopic feather tracts. Mech. Dev. 110,51 -60.[CrossRef][Medline]
Sebald, W. and Mueller, T. D. (2003). The interaction of BMP-7 and ActRII implicates a new mode of receptor assembly. Trends Biochem. Sci. 28,518 -521.[CrossRef][Medline]
Sengel, P. (1976). Morphogenesis of Skin. Cambridge: Cambridge University Press.
Song, H., Wang, Y. and Goetinck, P. F. (1996).
Fibroblast growth factor 2 can replace ectodermal signaling for feather
development. Proc. Natl. Acad. Sci. USA
93,10246
-10249.
Song, H. K., Lee, S. H. and Goetinck, P. F. (2004). FGF-2 signaling is sufficient to induce dermal condensations during feather development. Dev. Dyn. 231,741 -749.[CrossRef][Medline]
Sotobori, T., Ueda, T., Myoui, A., Yoshioka, K., Nakasaki, M., Yoshikawa, H. and Itoh, K. (2006). Bone morphogenetic protein-2 promotes the haptotactic migration of murine osteoblastic and osteosarcoma cells by enhancing incorporation of integrin beta1 into lipid rafts. Exp. Cell Res. 312,3927 -3938.[CrossRef][Medline]
Tao, H., Yoshimoto, Y., Yoshioka, H., Nohno, T., Noji, S. and Ohuchi, H. (2002). FGF10 is a mesenchymally derived stimulator for epidermal development in the chick embryonic skin. Mech. Dev. 116,39 -49.[CrossRef][Medline]
Turing, A. M. (1952). The chemical basis of
morphogenesis. Phil. Trans. R. Soc. Lond. B Biol. Sci.
237, 37-72.
Viallet, J. P., Prin, F., Olivera-Martinez, I., Hirsinger, E., Pourquié, O. and Dhouailly, D. (1998). Chick Delta-1 gene expression and the formation of the feather primordia. Mech. Dev. 72,159 -168.[CrossRef][Medline]
Wessells, N. K. (1965). Morphology and proliferation during early feather development. Dev. Biol. 12,131 -153.[CrossRef][Medline]
Widelitz, R. B., Jiang, T. X., Noveen, A., Chen, C. W. and Chuong, C. M. (1996). FGF induces new feather buds from developing avian skin. J. Invest. Dermatol. 107,797 -803.[CrossRef][Medline]
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Meth. Enzymol. 225,361 -373.[Medline]
Zhang, L., Deng, M., Parthasarathy, R., Wang, L., Mongan, M.,
Molkentin, J. D., Zheng, Y. and Xia, Y. (2005). MEKK1
transduces activin signals in keratinocytes to induce actin stress fiber
formation and migration. Mol. Cell. Biol.
25, 60-65.
Zou, H. and Niswander, L. (1996). Requirement for BMP signaling in interdigital apoptosis and scale formation. Science 272,738 -741.[Abstract]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
