spacer gif spacer gif spacer gif spacer gif spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 24 July 2008
doi: 10.1242/dev.024133

Development 135, 2855-2864 (2008)
Published by The Company of Biologists 2008
This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.024133v1
135/17/2855    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moore, S. W.
Right arrow Articles by Kennedy, T. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moore, S. W.
Right arrow Articles by Kennedy, T. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Rho inhibition recruits DCC to the neuronal plasma membrane and enhances axon chemoattraction to netrin 1

Simon W. Moore, James P. Correia, Karen Lai Wing Sun, Madeline Pool, Alyson E. Fournier and Timothy E. Kennedy*

Centre for Neuronal Survival, Montreal Neurological Institute, Program in NeuroEngineering, Department of Neurology and Neurosurgery, McGill University, Montreal, Quebec H3A 2B4, Canada.

* Author for correspondence (e-mail: timothy.kennedy{at}mcgill.ca)

Accepted 28 June 2008


   SUMMARY
TOP
 SUMMARY
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Molecular cues, such as netrin 1, guide axons by influencing growth cone motility. Rho GTPases are a family of intracellular proteins that regulate the cytoskeleton, substrate adhesion and vesicle trafficking. Activation of the RhoA subfamily of Rho GTPases is essential for chemorepellent axon guidance; however, their role during axonal chemoattraction is unclear. Here, we show that netrin 1, through its receptor DCC, inhibits RhoA in embryonic spinal commissural neurons. To determine whether netrin 1-mediated chemoattraction requires Rho function, we inhibited Rho signaling and assayed axon outgrowth and turning towards netrin 1. Additionally, we examined two important mechanisms that influence the guidance of axons to netrin 1: substrate adhesion and transport of the netrin receptor DCC to the plasma membrane. We found that inhibiting Rho signaling increased plasma membrane DCC and adhesion to substrate-bound netrin 1, and also enhanced netrin 1-mediated axon outgrowth and chemoattractive axon turning. Conversely, overexpression of RhoA or constitutively active RhoA inhibited axonal responses to netrin 1. These findings provide evidence that Rho signaling reduces axonal chemoattraction to netrin 1 by limiting the amount of plasma membrane DCC at the growth cone, and suggest that netrin 1-mediated inhibition of RhoA activates a positive-feedback mechanism that facilitates chemoattraction to netrin 1. Notably, these findings also have relevance for CNS regeneration research. Inhibiting RhoA promotes axon regeneration by disrupting inhibitory responses to myelin and the glial scar. By contrast, we demonstrate that axon chemoattraction to netrin 1 is not only maintained but enhanced, suggesting that this might facilitate directing regenerating axons to appropriate targets.

Key words: Axon guidance, DCC, ROCK, PRK, C3, Y27632, Regeneration, Growth cone, Rho GTPases, Rat


   INTRODUCTION
TOP
 SUMMARY
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During development, axons are directed to their targets along defined pathways by extracellular cues (reviewed by Huber et al., 2003Go; Moore et al., 2007Go). Netrins are a family of secreted axon guidance proteins with homology to laminins (Serafini et al., 1994Go; Yurchenco and Wadsworth, 2004Go). In the developing spinal cord, netrin 1 is secreted by the floor plate and guides the axons of spinal commissural neurons (SCNs) to the ventral midline (Kennedy et al., 1994Go; Kennedy et al., 2006Go). Axon chemoattraction to netrin 1 requires the transmembrane receptor DCC (Keino-Masu et al., 1996Go), association of N-WASP, Pak1 and Fak with the intracellular domain of DCC (Li et al., 2004Go; Liu et al., 2004Go; Ren et al., 2004Go; Shekarabi et al., 2005Go), elevation of cytosolic Ca2+ levels (Hong et al., 2000Go), activation of phospholipase C (Ming et al., 1999Go), and activation of the Rho GTPases Rac and Cdc42 (Shekarabi et al., 2005Go; Shekarabi and Kennedy, 2002Go).

Growth cone turning is thought to involve the asymmetric formation of adhesive contacts that stabilize protrusions, leading to membrane extension on one side, coordinated with retraction of the trailing edge (reviewed by Dickson, 2002Go; Huber et al., 2003Go). Rho GTPases are a family of intracellular proteins that cycle between an inactive GDP-bound state and an active GTP-bound state (reviewed by Etienne-Manneville and Hall, 2002Go). The Rac and Cdc42 subfamilies are implicated in directing cytoskeletal rearrangements within growth cones in response to chemoattractant guidance cues (reviewed by Govek et al., 2005Go), including netrin 1 (Shekarabi et al., 2005Go; Shekarabi and Kennedy, 2002Go; Yuan et al., 2003Go). A third subfamily, RhoA, has three mammalian members (RhoA, RhoB and RhoC), and is implicated in generating repellent responses and growth cone collapse (Driessens et al., 2001Go; Hu et al., 2001Go; Jain et al., 2004Go; Wahl et al., 2000Go). Rho GTPases also regulate the formation of adhesive structures in growth cones called point contacts (Renaudin et al., 1999Go; Woo and Gomez, 2006Go). Rac activity promotes the formation of point contacts, while stabilization of point contacts requires inhibiting Rac and activating RhoA (Woo and Gomez, 2006Go).

Although the Rho subfamily of Rho GTPases have been implicated in promoting cell migration (Worthylake et al., 2001Go; Worthylake and Burridge, 2003Go), little attention has been paid to their potential role in axon chemoattraction. Here, we report that netrin 1 inhibits RhoA in embryonic rat SCNs. Furthermore, we find that Rho signaling antagonizes axonal outgrowth and turning to netrin 1. We show that Rho inhibition recruits the netrin 1 receptor DCC to the plasma membrane and enhances adhesion to netrin 1. These findings provide evidence of a positive-feedback mechanism whereby netrin 1, through DCC, inhibits RhoA, thereby recruiting additional DCC to the plasma membrane. These findings support the conclusion that netrin 1 inhibition of RhoA promotes axonal chemoattraction by increasing the amount of DCC presented by a growth cone, and by altering intracellular mechanisms that regulate cytoskeletal organization and adhesion.


   MATERIALS AND METHODS
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
The following antibodies and reagents were used: mouse IgM anti-Tag1 (4D7) for embryonic spinal cord immunohistochemistry (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA); rabbit anti-Tag1 (TG3) for western blot analysis (provided by Dr Thomas Jessell, Columbia University, New York, NY); rabbit anti-integrin β1 (AB1952, Chemicon, Temecula, CA); mouse IgG anti-RhoA (26C4) and goat anti-DCC (A-20, Santa Cruz Biotechnology, Santa Cruz, CA); mouse IgG anti-DCC (AF5) and Y27632 (Calbiochem, LaJolla, CA); DCC-fc, a protein chimera composed of the extracellular domain of mouse DCC and the Fc portion of human IgG1 (R & D Systems, Minneapolis, MN); mouse IgG anti-ROCKII (BD Biosciences, Mississauga, Canada); rabbit anti-PRK2 (Cell Signaling, Danvers, MA); DNase, poly-D-lysine (PDL, 70-150 kDa) and Hoechst 33258 (Sigma-Aldrich, Mississauga, Canada); and Neurobasal, FBS, B-27 supplement, GlutaMAX-1, penicillin-streptomycin, Ca2+/Mg2+-free HBSS, Alexa 546-coupled phalloidin and Jasplakinolide were purchased from Invitrogen Canada (Invitrogen Canada, Burlington, ON). Recombinant netrin 1 protein was purified from a HEK 293-EBNA cell line secreting netrin 1, as described (Serafini et al., 1994Go; Shirasaki et al., 1996Go). C3-07, a fusion peptide of C3-transferase and proline-rich sequences (Winton et al., 2002Go), was provided by Lisa McKerracher (Bioaxone, Montreal, QC).

Herpes simplex virus gene delivery
Red fluorescent protein (RFP; Campbell et al., 2002Go), Myc tagged human RhoA (wt-RhoA, cDNA Resource Center #RHO0A0MN00) and myc-tagged constitutively active RhoA (ca-RhoA; Khosravi-Far et al., 1995Go) were cloned into pHSVPrPUC plasmids (Geller et al., 1990Go). These plasmids were transfected into 2-2 Vero cells that were then superinfected with 5dl 1.2 herpes simplex virus (HSV) helper virus 1 day later. Recombinant virus was amplified through three passages and stored at -80°C, as described (Neve et al., 1997Go). Equal infection rates of dissociated SCNs were determined by comparing the percentage of cells with endogenous RFP fluorescence or myc immunofluorescence after 12 hours.

Explant cultures
Staged pregnant Sprague-Dawley rats were obtained from Charles River Canada (St Constant, QC). Embryonic day 11 (E11) rat spinal cord (vaginal plug=E0) and E13 dorsal spinal cord explants were dissected as described (Moore and Kennedy, 2008Go). For axon turning assays, aggregates of netrin-expressing HEK 293-EBNA cells were prepared and immobilized alongside microdissected segments of E11 spinal cords, as illustrated in Fig. 5A (Moore and Kennedy, 2008Go). Explants for turning assays were cultured for 40 hours and E13 dorsal spinal cord explants for 14 hours in Neurobasal/FBS (Neurobasal supplemented with 10% FBS, 2 mM GlutaMAX-1, 100 unit/ml penicillin and 100 µg/ml streptomycin). A Magnafire CCD camera (Optronics, Goleta, CA) and an Axiovert 100 microscope (Carl Zeiss Canada, Toronto, ON) were used to capture digital images of Tag1-positive SCN axons. For quantification of turning assays, images were printed and the deflection distances determined by an observer blind to the experimental condition. For HSV-infected explants, E13 dorsal spinal cords were dissociated in Ca2+/Mg2+-free Hanks', incubated for 30 minutes at 37°C/5% CO2 with HSV constructs in Neurobasal/FBS and then 50,000 cells were cultured overnight in 10 µl hanging drops. Explants of re-aggregated SCNs were embedded and cultured for 14 hours in Neurobasal/FBS. Outgrowth was measured using Northern Eclipse image analysis software (Empix Imaging, Mississauga, Canada).

RhoA activation and cell surface biotinylation assays
RhoA activation and biotinylation assays were performed on SCNs obtained by microdissection and dissociation of the dorsal halves of E13 rat spinal cords, as described (Moore and Kennedy, 2008Go). Neurons were plated in six-well tissue culture dishes previously coated for 2 hours at room temperature with 2 ml of 10 µg/ml PDL. For the first 12 hours, the media consisted of Neurobasal/FBS. The medium was then changed to Neurobasal/B-27 (Neurobasal supplemented with 2% B-27, 2 mM GlutaMAX-1, 100 units/ml penicillin and 100 µg/ml streptomycin).

For G-LISA assays, two million dissociated SCNs were plated as described above. Following 40 hours in culture, the relative amounts of GTP-bound RhoA in each condition was measured as per the manufacturer's instructions (BK124, Cytoskelton, Denver, CO). The purification of GST-RBD and RhoA pulldown assays were performed as described (Ren and Schwartz, 2000Go), except that the lysis buffer for SCNs was 50 mM Tris (pH 7.3), 1% NP-40, 200 mM NaCl, 10 mM DTT, 2 µg/ml aprotinin, 5 µg/ml leupeptin and 1 mM PMSF. Ten million cells were plated per condition for RhoA-GTP pulldown assays. Western blots were visualized using chemiluminescence (PerkinElmer BioSignal, Montreal, QC) and films scanned (ScanJet 5300C, Hewlett-Packard, Mississauga, ON). Band intensities were measured using Photoshop 7.0 (Adobe, San Jose, CA).

Biotinylation of extracellular protein was carried out as described previously (Bouchard et al., 2004Go). After 40 hours in culture two million SCNs were pretreated for 1 hour with either 10 µg/ml C3-07 or 10 µM Y27632, and then, in some cases, stimulated for 5 minutes with 50 ng/ml netrin 1. Cells were washed with Ca/Mg PBS (0.1 mM CaCl2, 1 mM MgCl2 in PBS) and labeled for 30 minutes at 4°C with 2.5 mg of EZ-Link Sulfo-NHS-biotin (Pierce, Rockford, IL) dissolved in 2.5 ml of Ca/Mg PBS. The reaction was quenched with 10 mM Glycine in PBS and the cells lysed in RIPA buffer [10 mM phosphate (pH 7.5), 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% deoxycholate, 2 µg/ml aprotinin, 5 µg/ml leupeptin, 1 mM EDTA and 1 mM PMSF]. Labeled proteins were bound to steptavidin-agarose beads (Pierce) for 2 hours at 4°C, then washed several times and analyzed by western blot.

Immunostaining
Round cover glasses (12 mm, no 0 Assistent, Carolina Biological, Windsor, ON) were coated with 400 µl of 10 µg/ml PDL for 2 hours at room temperature for all conditions except those examining growth cone area. For these experiments, 1 µg/ml PDL was applied for 5 minutes followed by either a 3-hour incubation at room temperature with HBSS±2 µg/ml netrin 1 or, for a circular substrate of netrin 1, a 2 µl drop of 100 µg/ml netrin 1. Dissociated SCNs were plated and cultured for 24 hours in Neurobasal/FBS then treated for 1 hour with 10 µg/ml C3-07, 10 µM Y-27632, RFP-HSV, wt-RhoA-HSV or ca-RhoA-HSV, and then stimulated for 5 minutes with 50 ng/ml netrin 1. The cells were then fixed for 30 seconds at 37°C in 4% PFA, 0.1% glutaraldehyde, 250 mM sucrose in PBS (pH 7.5). For plasma membrane DCC labeling, cells were blocked for 1 hour in 3% BSA in PBS, then incubated with 250 ng/ml mouse anti-DCC (AF5, raised against the extracellular domain of DCC) in 1% BSA in PBS overnight at 4°C. Cells were permeabilized for 5 minutes at room temperature in 0.15% triton X-100 PBS and then blocked for 1 hour at room temperature with 0.1% triton X-100, 3% BSA. Primary and secondary antibodies were diluted in PBS with 0.1% triton X-100 and 1% BSA and incubated for 1 hr at room temperature. The following dilutions were used: 1 µg/ml mouse anti-RhoA, 400 ng/ml goat anti-DCC, 1 µg/ml donkey anti-mouse Alexa 546, 1 µg/ml donkey anti-goat Alexa 488, 0.8 U/ml Alexa 546 coupled phalloidin and 500 ng/ml Hoechst 33258. Coverslips were mounted with SlowFade (Invitrogen). DCC immunofluorescence intensity was quantified in growth cones as described (Bouchard et al., 2004Go). Heat maps were generated using the `Fire' LUT in Image J (NIH).

Adhesion assays
Adhesion assays were performed as described (Shekarabi et al., 2005Go). Briefly, 20 µl of 0.1% nitrocellulose (Hybond ECL; Amersham Biosciences, Piscataway, NJ) dissolved in methanol (Fisher Scientific, Houston, TX) was dried on the bottom of NUNC four-well plates (VWR International, Mississauga, ON). Substrates were incubated with HBSS±2 µg/ml netrin 1 for 2 hours at room temperature, blocked for 1 hour at room temperature in 1% BSA (Fisher Scientific) in HBSS and then 1% heparin (Sigma) in HBSS. As indicated, some substrates were incubated with 25 µg/ml anti-netrin PN3 (Manitt et al., 2001Go) or 5 µg/ml DCC-fc for 1 hour. SCNs, 2.5x105 per well, were cultured for 2 hours in Neurobasal/B-27 medium in the presence of 10 µg/ml C3-07, 10 µM Y27632 and/or 100 nM Jasplakinolide. Unbound cells were removed by washing with three changes of PBS and the remaining cells fixed with 500 µl 4% PFA in PBS. Nuclei were labeled with 500 ng/ml Hoechst 33258 in PBS for 30 minutes and counted using Northern Eclipse software (Empix Imaging, Toronto, ON).

RT-PCR analysis
Total RNA was extracted from 10 million E14 rat SCNs cultured for 2 days in vitro (DIV) on a PDL-coated (12 ml of 10 µg/ml PDL for 2 hours at room temperature) 10cm dish using TRIzol (Invitrogen Life Technologies, Burlington, Ontario). RT-PCR was performed with 0.5 µg of total RNA per reaction using the QIAGEN OneStep RT-PCR Kit (Qiagen, Mississauga, Ontario). The following primer pairs were annealed at 60°C: RhoA 5'AAAGTCGGGGTGCCTCA3' and 3'GAGGGCGTTAGAGCAGTGTC5; RhoB 5'ATGTGCTTCTCGGTAGACAG3' and 3'AGAAAAGGACGCTCAGGAAC5'; RhoC 5'GCCTACAGGTCCGGAAGAAT3' and 3'GCACCAACCTAGTTCCCAGA5'; ROCKI 5'GTAATCGGCAGAGGTGCATT3' and 3'TCCAGACTTATCCAGCAGCA5'; ROCKII 5'CTAACAGTCCGTGGGTGGTT3' and 3'AGACCACCAATCACATTCTCG5'; PRK1 5'TGTGTGAGAAGCGGATTTTG3' and 3'ACGGCTCGAGTGTAGGATGT5'; PRK2 5'TTTGCATGTTTCCAAACCAA3' and 3'GACTCTCCGACGAGCATTTC5'.


Figure 1
View larger version (41K):
[in this window]
[in a new window]

  		Fig. 1. Dorsal spinal cord neurons express RhoA, ROCK and PRK family members. (A) RT-PCR amplification indicates that RhoA, RhoB and RhoC, as well as ROCKI, ROCKII, PRK1 and PRK2 are expressed by SCNs. (B) Western blot analysis of SCN lysate using RhoA, ROCKII and PRK2 antibodies. Immunofluorescent localization of RhoA (C,D), ROCKII (G,H) and PRK2 (K,L). In E,F,I,J,M,N. DCC is labeled green and nuclei blue; RhoA (E,F), ROCKII (I,J) and PRK2 (M,N) are labeled in red. Scale bar: 20 µm for C,E,G,I,K,M; 10 µm for D,F,H,J,L,N.

 

   RESULTS
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
RhoA, ROCK and PRK family members are expressed in embryonic SCNs
RhoA is activated in response to repellent axon guidance cues (Hu et al., 2001Go; Wahl et al., 2000Go); however, there have been no reports describing how RhoA might be regulated during axonal chemoattraction. Here, we examine how RhoA signaling contributes to the response of embryonic rat SCNs to netrin 1. As described below, we used two pharmacological reagents: C3-07 and Y27632, to investigate the functional role of RhoA signaling in the response to netrin 1. C3-07 is a membrane permeable analog of C3-exozymes (Winton et al., 2002Go), a family of bacterial enzymes that inactivate all RhoA family members (RhoA, RhoB and RhoC) through ADP ribosylation (reviewed by Aktories et al., 2004Go). Y27632 is a cell permeable ATP analog that selectively inhibits ROCK and PRK family kinases (Davies et al., 2000Go; Uehata et al., 1997Go), both of which are downstream effectors of RhoA signaling (reviewed in Karnoub et al., 2004Go). RT-PCR analysis indicated that SCNs express all RhoA, ROCK and PRK family members (Fig. 1A), and immunoreactivity for RhoA, ROCKII and PRK2 protein were detected in whole cell homogenates of 2 DIV SCNs by western blot analyses (Fig. 1B). The distribution of these proteins was then examined in the growth cones of embryonic SCNs in dispersed cell culture. Compared with the distribution of RhoA, which was detected throughout the growth cones of SCNs (Fig. 1C-F), ROCKII was distributed along the periphery (Fig. 1G-J) and PRK2 in the central region (Fig. 1K-N). Interestingly, a similar distribution of these proteins has been reported in migrating cells, with ROCKII enriched at the leading and trailing edges and PRK2 localized more centrally in the soma (reviewed by Wheeler and Ridley, 2004Go). These findings indicate that all the known targets of C3-07 (RhoA, RhoB and RhoC) and Y27632 (ROCKI, ROCKII, PRK1, PRK2) are expressed by SCNs.

Netrin 1 inactivates RhoA in SCNs
RhoA activity was then examined in SCNs at several time points following application of netrin 1. A significant reduction in total GTP-bound RhoA was detected within 15 minutes of adding 200 ng/ml netrin 1, using both an ELISA-based (G-LISA) assay and a Rhotekin pulldown assay (Ren and Schwartz, 2000Go). Specifically, we observed a 13% reduction using the G-LISA assay (Fig. 2A) and a 27% reduction using Rhotekin pulldown (Fig. 2B). Inhibition of RhoA by netrin 1 after 15 minutes was blocked by application of a DCC receptor body (2 µg/ml DCC-fc) or by function blocking antibodies against DCC (5 µg/ml DCC-fb, Fig. 2A). We conclude that netrin 1 inhibits RhoA in SCNs through a DCC-dependent mechanism.

RhoA inhibits DCC-dependent outgrowth to netrin 1
We then examined the effect of inhibiting RhoA signaling on netrin 1-dependent SCN axon outgrowth. In the absence of netrin 1, few SCN axons emerge from an explant of E13 rat dorsal spinal neuroepithelium when cultured for 14 hours (Fig. 3A). Outgrowth was not significantly increased by C3-07 (0.007 mm to 0.053 mm, n=5, P=0.624) (Fig. 3D), whereas Y27632 produced a small increase in mean total axon outgrowth per explant (0.007 mm to 0.149 mm, n=5, P<0.001) (Fig. 3G). Although this is a significant increase, the extent of axon outgrowth is minor when compared with that evoked by netrin 1 (0.007 mm to 0.823 mm, n=5, P<0.001). In control conditions, without drugs inhibiting RhoA signaling, plotting the amount of axon outgrowth versus the concentration of netrin 1 generates a bell-shaped curve that reaches a maximum at ~200 ng/ml netrin 1 (Moore and Kennedy, 2006Go; Serafini et al., 1994Go). The consequences of RhoA inhibition on SCN axon outgrowth were tested at three different netrin 1 concentrations: submaximal at 50 ng/ml, optimal at 200 ng/ml and super-saturating at 600 ng/ml. At each concentration, C3-07 and Y27632 dramatically increased axon outgrowth response to netrin 1 (Fig. 3B,E,H,J). These results provide evidence that, across a wide spectrum of netrin 1 concentrations, RhoA signaling remains active in SCNs and acts to restrain axon extension. Application of DCC function-blocking antibodies, DCC-fb (Fig. 3C), significantly reduced outgrowth in the presence of C3-07 (Fig. 3F) or Y27632 (Fig. 3I) at all concentrations of netrin 1 tested (Fig. 3K), indicating that DCC is required for the increased outgrowth to netrin 1 induced by inhibiting RhoA signaling.


Figure 2
View larger version (18K):
[in this window]
[in a new window]

  		Fig. 2. Netrin 1 inhibits RhoA in SCNs. G-LISA (A) and GST-RBD pulldown (B) assays were used to evaluate the relative amounts of RhoA-GTP in SCNs. GST-RBD pulldown assays measured a 27% (P=0.040) average reduction across three separate experiments. G-LISA assays measured an average reduction of 13% after 15 minutes of 200 ng/ml netrin 1 (n=23, P=0.002). This was blocked with either 5 µg/ml of DCC function blocking antibodies (DCC-fb) or 2 µg/ml of the extracellular domain of DCC (DCC-fc). Tukey post-hoc tests of means. Error bars indicate s.e.m.

 


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		Fig. 3. Inhibiting RhoA signaling increases DCC-dependent SCN axon outgrowth evoked by netrin 1. E13 rat dorsal spinal cord explants were cultured for 14 hours with various amounts of netrin 1 in the presence of 10 µg/ml C3-07 or 10 µM Y27632. (A-I) SCN axons were labeled using the 4D7 monoclonal antibody against Tag1. (J) C3-07 increased total outgrowth per explant by 155% (n=5, P=0.006) at 50 ng/ml netrin 1, 66% (n=4, P=0.041) at 200 ng/ml netrin 1 and 126% (n=4, P=0.003) at 600 ng/ml netrin 1. Y27632 increased outgrowth by 404% (n=5, P<0.001) at 50 ng/ml netrin 1, 137% (n=5, P<0.001) at 200 ng/ml netrin 1 and 236% (n=5, P=0.000) at 600 ng/ml netrin 1 (J). (K) DCC-fb antibody (5 µg/ml) significantly reduced axon outgrowth in the presence of C3-07 or Y27632 at each netrin 1 concentration (n=5, P<0.01). Specifically, total outgrowth with C3-07 was reduced by 74% (n=5, P=0.001) at 50 ng/ml netrin 1, by 70% (n=5, P<0.001) at 200 ng/ml netrin 1 and 79% (n=5, P<0.001) at 600 ng/ml. Total outgrowth with Y27632 was reduced by 57% (n=5, P<0.001) at 50 ng/ml netrin 1, 55% (n=5, P<0.001) at 200 ng/ml netrin 1 and 93% (n=5, P<0.001) at 600 ng/ml netrin 1. *P<0.05, **P<0.01. Tukey post-hoc tests of means. Error bars indicate s.e.m. Scale bar: 100 µm.

 
To further investigate the possibility that RhoA does indeed inhibit outgrowth to netrin 1, we generated and purified recombinant HSV viral vectors encoding myc tagged human RhoA (wt-RhoA) and myc tagged constitutively active RhoA (63L, ca-RhoA). To infect SCNs, E13 dorsal spinal cord explants were microdissected and dissociated. Cells in suspension were then infected with wt-RhoA, ca-RhoA or control virus encoding RFP, and reaggregated overnight in hanging drop cultures. The effect of manipulating RhoA expression on axon outgrowth was examined by microdissecting explants from these aggregates and challenging them with netrin 1 in collagen gel cultures. Overexpression of wild-type RhoA led to a 53% reduction in axon outgrowth evoked by netrin 1 (n=21, P<0.001, Fig. 4B,J), while expression of ca-RhoA resulted in a 79% reduction (n=23, P<0.001), when compared with infection with a control virus containing RFP. Adding C3-07 or Y27632 increased outgrowth in wt-RhoA- and ca-RhoA-infected explants, consistent with RhoA signaling inhibiting axon extension in response to netrin 1 (Fig. 4D-J).

RhoA inhibition promotes axon turning to netrin 1
Inhibiting RhoA signaling with either Y27632 or C3 exoenzyme hinders monocyte migration during transendothelial migration by disrupting cytoskeletal reorganization and interfering with adhesive mechanisms (Worthylake et al., 2001Go; Worthylake and Burridge, 2003Go). As such, the increase in netrin 1 induced SCN axon outgrowth caused by inhibition of RhoA signaling could reflect a severe deregulation of the mechanisms that normally direct axon extension. We hypothesized that such a disruption would interfere with the ability of SCN axons to turn in response to a gradient of netrin 1. To determine whether inhibiting RhoA signaling might disrupt the capacity of an axon to turn, we used an explanted embryonic spinal cord turning assay. In this assay, an aggregate of netrin 1-expressing cells is cultured immediately adjacent to the cut edge of a segment of intact E11 spinal cord and the two are immobilized in a three-dimensional collagen gel (Fig. 5A). Typically, this source of netrin 1 attracts extending SCN axons over a distance of ~250 µm (Kennedy et al., 1994Go). In contrast to our expectations, neither C3-07 nor Y27632 hindered the ability of SCN axons to turn towards the source of ectopic netrin 1. In fact, the inhibitors increased the average distance over which these axons turned (Fig. 5B,C,E,G). The increased axon turning was sensitive to the DCC function blocking monoclonal antibody (Fig. 5B,D,F,H), indicating that the enhanced chemoattraction requires DCC.

RhoA inhibition increases the amount of plasma membrane DCC in SCNs
Recruitment of DCC to the neuronal plasma membrane from an intracellular vesicular pool increases SCN axon outgrowth and chemoattractive turning in response to netrin 1 (Bouchard et al., 2004Go; Moore and Kennedy, 2006Go). In these previous studies, activation of protein kinase A (PKA) increased plasma membrane DCC. Interestingly, PKA activation has been reported to inhibit RhoA (Lang et al., 1996Go), raising the possibility that inhibition of RhoA signaling may contribute to the recruitment of DCC to the plasma membrane, thereby enhancing netrin 1-dependent axon outgrowth and turning. We therefore determined whether manipulating RhoA signaling might influence plasma membrane levels of DCC. First, using biotinylation to selectively label cell surface proteins, we detected a 1.5- and a 1.8-fold increase in plasma membrane DCC 1 hour after the application of C3-07 and Y27632, respectively (Fig. 6A). Consistent with previous findings, application of netrin 1 alone increased plasma membrane DCC (Bouchard et al., 2004Go); however, application of either inhibitor together with netrin 1 did not synergize to further increase the amount of plasma membrane DCC. Plasma membrane levels of the GPI-linked membrane protein Tag-1 were unaltered by RhoA inhibition, indicating that inhibiting RhoA signaling did not evoke a non-specific change in the trafficking of all membrane proteins.


Figure 4
View larger version (37K):
[in this window]
[in a new window]

  		Fig. 4. Increased RhoA activity reduces SCN axon outgrowth evoked by netrin 1. (A-I) SCN explants expressing RFP, wt-RhoA or ca-RhoA were cultured for 14 hours in the presence of 200 ng/ml netrin 1. (B) Wt-RhoA reduced total outgrowth by 53% (n=21, P<0.001) and (C) ca-RhoA reduced it by 79% (n=23, P<0.001) compared with RFP infected explants (A). C3-07 increased RFP infected explant outgrowth by 32% (n=23, P<0.001) (D), wt-RhoA by 72% (n=20, P<0.001) (E) and ca-RhoA by 122% (n=20, P<0.001) (F). Y27632 increased RFP infected explant outgrowth by 53% (n=19, P<0.001) (G), wt-RhoA by 155% (n=20, P<0.001) (H) and ca-RhoA by 288% (n=22, P<0.001) (I). (J)**P<0.001 compared with control RFP explants. ##P<0.001 compared with wild type or CA explants. Tukey post-hoc tests of means. Error bars indicate s.e.m. Scale bar: 100 µm.

 


Figure 5
View larger version (95K):
[in this window]
[in a new window]

  		Fig. 5. Inhibiting RhoA signaling promotes SCN axon turning to netrin 1. (A,B) Aggregates of netrin 1-expressing HEK 293-EBNA cells were cultured alongside explants of E11 rat spinal cord and deflection distances measured as shown (A), and graphed (B) as the percent distance relative to the absence of drugs. (C-H) Explants were cultured for 40 hours in the absence of RhoA inhibitors (C,D), or in the presence of 10 µg/ml C3-07 (E,F) or 10 µM Y-27632 (G,H). SCN axons were fluorescently labeled for Tag1 (4D7). Both C3-07 (E, n=30, P=0.005) and Y27632 (G, n=30, P=0.007) resulted in a 16% increase in the turning distance. DCC function blocking antibodies (5 µg/ml) reduced turning in the absence of drug (D, n=24, P=0.001), as well as turning in the presence of 10 µg/ml C3-07 (F, n=21, P<0.001) or 10 µM Y27632 (H, n=24, P<0.001). Tukey post-hoc tests of means. Error bars indicate s.e.m. **P<0.001 compared with control explants without Y27632, C3-07 or DCC-fb. Scale bar: 20 µm.

 
Using immunocytochemistry, we then extended the above findings to determine whether changes in RhoA signaling would influence the amount of plasma membrane DCC presented by SCN growth cones. Specifically, following fixation to selectively label plasma membrane DCC, non-permeabilized cells were labeled using a mouse monoclonal antibody against an epitope in the extracellular domain of DCC (AF5, Calbiochem). The cells were then permeabilized and total DCC was labeled with a goat polyclonal antibody (A-20, Santa Cruz) raised against an epitope in the intracellular domain of DCC. The ratio of plasma membrane DCC labeling to that of total DCC within the growth cone was compared across conditions. Consistent with findings from the biotinylation assay, application of RhoA inhibitors significantly increased the amount of plasma membrane DCC detected (Fig. 6B-H) and the amount of plasma membrane DCC was unaffected by co-application with netrin 1.


Figure 6
View larger version (54K):
[in this window]
[in a new window]

  		Fig. 6. Inhibiting RhoA signaling increases the amount of plasma membrane DCC in SCNs. Plasma membrane levels of the netrin 1 receptor DCC in SCN in vitro were evaluated using biotinylation (A) or immunofluorescence (B-H). Cell-surface levels were measured following 1-hour incubations with either 10 µg/ml C3-07 (C3) or 10 µM Y27632 (Y) and 5 minutes following application of 50 ng/ml netrin 1 (Net), as indicated. In the biotinylation assay (A), C3-07 caused a 50% (n=8, P=0.002) and Y27632 a 78% (n=8, P<0.001) increase in the amount of DCC in the absence of netrin 1. Netrin produced a 37% (n=8, P=0.021) increase, whereas the combination of both netrin and C3-07 or Y27632 generated a 59% (n=8, P<0.001) or 64% (n=8, P<0.001) increase, respectively. No significant change in the amount of cell-surface Tag1 was detected. (B) The ratio plasma membrane DCC immunofluorescence to total cellular DCC immunofluorescence within the growth cone increased in the presence of C3-07 by 9.9% (n=85, P=0.006), Y27632 by 8.7% (n=87, P=0.022), netrin 1 by 6.3% (n=124, P=0.048), netrin 1/C3-07 by 11.0% (n=80, P=0.002) and netrin 1/Y-27632 by 10.7% (n=90, P=0.001). Grayscale images of the plasma membrane (PM) and total DCC immunofluorescence in C-H were converted to heatmaps using the `Fire' lookup table of Image J (NIH, Bethesda, MD). *P<0.05, **P<0.01. Tukey post-hoc tests of means. Error bars indicate s.e.m. Scale bar: 10 µm.

 
RhoA reduces growth cone expansion and adhesion to substrate bound netrin 1
Netrin 1 is a secreted protein, but the vast majority of netrin 1 protein is tightly bound to membranes or extracellular matrix in vivo, and not freely soluble (Manitt et al., 2001Go; Manitt and Kennedy, 2002Go; Serafini et al., 1994Go). We have previously reported that DCC mediates the adhesion of SCNs to substrate-bound netrin 1 protein (Shekarabi et al., 2005Go). Based on the well-described role of RhoA in regulating the maturation of adhesive complexes (reviewed by Arthur et al., 2002Go) and the increase in plasma membrane DCC induced by RhoA inhibition (Fig. 6), we tested the hypothesis that inhibiting RhoA signaling might influence SCN adhesion to netrin 1. Cells derived from dissociated E13 spinal cord were plated on a netrin 1 substrate and we observed that RhoA inhibition increased the number of adherent cells (Fig. 7A) by a mean value of 79% with C3-07 (Fig. 7C) and by 152% with Y-27632 (Fig. 7D). The increased adhesion to netrin 1 induced by inhibiting RhoA was blocked either by pre-incubation with netrin function blocking antibodies (anti-netrin) or by competition with a DCC receptor-body (DCC-fc, Fig. 7A). To determine whether the increased adhesion requires reorganization of filamentous actin, we applied the cell permeable reagent jasplakinolide, which stabilizes actin filaments (Scott et al., 1988Go; Visegrady et al., 2005Go), and found that pretreatment with jasplakinolide reduced adhesion to netrin 1 and blocked the effects of inhibiting RhoA signaling (Fig. 7A).

The assay described above addresses the adhesion of the entire cell to the substrate. To examine guidance choices made by axonal growth cones, we challenged extending SCN axons with a discontinuous substrate of PDL adjacent to a substrate of PDL plus an additional layer of netrin 1, and examined SCN growth cones crossing onto the netrin 1 substrate. Consistent with our previous findings examining axons on uniform substrates of either PDL alone compared with PDL plus netrin 1 (Shekarabi et al., 2005Go), we found that the axonal growth cones of SCN axons dramatically expanded once they had crossed onto netrin 1 (Fig. 7E-H). We hypothesize that the growth cone expansion observed reflects a combination of increased actin polymerization triggered by the activation of intracellular signaling events downstream of DCC and DCC-mediated adhesion to substrate bound netrin 1.

To quantify the effect of inhibiting RhoA signaling on growth cone surface area, SCNs were plated on uniform substrates of either PDL alone or PDL plus netrin 1. On substrates of PDL alone, treatment with C3-07 or Y27632 induced growth cone expansion by mean values 67% and 79%, respectively (Fig. 7O,I-K). Consistent with Shekarabi et al. (Shekarabi et al., 2005Go), culturing SCNs on a substrate of netrin 1 increased growth cone surface area by a mean of 94%, essentially causing them to double in size. However, adding RhoA or ROCK inhibitors to SCNs cultured on a netrin 1 substrate further increased growth cone area by mean values of 155% and 107%, respectively (Fig. 7L-O). These increases in growth cone area were blocked by application of the DCC-fc receptor-body. By contrast, ectopic expression of wt-RhoA or ca-RhoA in SCNs demonstrated that increased RhoA activity reduces growth cone area on a netrin 1 substrate (Fig. 7P-S). Together, these findings indicate that RhoA signaling inhibits netrin 1-induced growth cone expansion and disrupts adhesive interactions between netrin 1 and its receptor DCC in SCN growth cones.


Figure 7
View larger version (45K):
[in this window]
[in a new window]

  		Fig. 7. Inhibiting RhoA signaling promotes adhesion and growth cone expansion in response to netrin 1. (A) SCN adherence to netrin 1 is increased by 79% (n=12, P<0.001) in the presence of C3-07 (C3) or by 152% (n=12, P<0.001) with Y-27632 (Y). This adhesion was reduced (n=12, P<0.001) upon pre-incubation with either: netrin function blocking antibodies (anti-netrin) or by competition with the extracellular domain of DCC (DCC-fc receptor-body). Stabilization of filamentous actin with jasplakinolide (Jasp.) disrupted adhesion to netrin 1 and abolished the increased adhesion evoked by C3-07 or Y-27632. (B-D) Representative images of cells binding to netrin 1 substrates in the absence (B) or in the presence of C3-07 (C) or Y-27632 (D). (E-H) The expansion of SCN growth cones as they encounter a boundary of immobilized netrin 1 is consistent with netrin 1 functioning as an adhesive cue. (I-N) SCNs labeled with phalloidin (green), β-tubulin (red) and Hoechst (blue). The growth cones of SCNs grown on glass coverslips coated with PDL (I-K) are smaller than those grown on this same substrate with an additional coating of netrin 1 (L-N). (O) In the absence of netrin 1, the average growth cone increased by 67% (n=21, P=0.008) when treated with C3-07 and by 79% (n=20, P<0.001) when treated with Y27632. On a substrate of netrin 1, average growth cone area increased by 94% in the absence of inhibitors. A netrin 1 substrate also increased the average area of growth cones in the presence of C3-07 by 76% (n=22, P=0.006) and Y27632 by 70% (n=21, P=0.033). SCN were infected with herpes simplex viral vectors encoding with RFP (P), wt-RhoA (Q) or ca-RhoA (R). Neurons were visualized with Hoechst (blue), phalloidin (green) and with antibodies against myc (red) or endogenous RFP fluorescence (red). Growth cones area (S) was reduced by 61% when RhoA was overexpressed (n=37, P<0.001) or by 90% upon expression of ca-RhoA (n=20, P<0.001). (T) Working model illustrating the hypothesis that RhoA inhibition by netrin 1 enhances chemoattraction by facilitating DCC function, in part by recruiting additional DCC to the plasma membrane and by promoting DCC signaling mechanisms, such as increasing adhesion to immobilized netrin 1, that lead to membrane extension. Tukey post-hoc tests of means. Error bars indicate s.e.m. Scale bars: 200 µm in B-D; 20 µm in E-H; 10 µm in I-R. (A,O,S) *P<0.05; **P<0.01. (O) For the fifth and eighth bars, **P<0.01 relative to the second bar. For the third, sixth and ninth bars, *P<0.05 and **P<0.01 relative to the second, fifth and eighth bars, respectively (i.e. compared with the absence of DCC-fc).

 

   DISCUSSION
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Here, we provide evidence that inhibition of RhoA by netrin 1 promotes embryonic SCN axon chemoattraction. Our findings indicate that netrin 1 inhibits RhoA in SCNs through a DCC-dependent mechanism, and, reciprocally, that RhoA signaling inhibits the sensitivity of SCN axons to netrin 1. We demonstrate that RhoA signaling limits the amount of neuronal plasma membrane DCC and DCC-dependent adhesion to immobilized netrin 1. We hypothesize that netrin 1 inhibition of RhoA signaling enhances the chemoattractant response by facilitating DCC function, in part by recruiting additional DCC to the plasma membrane and by promoting DCC signaling mechanisms that lead to membrane extension (Fig. 7T).

RhoA inhibition during axon chemoattraction
Although RhoA activation has been detected in response to repellent axon guidance cues (Hu et al., 2001Go; Wahl et al., 2000Go), the possible involvement of RhoA family members during chemoattraction has been largely ignored. Here, we demonstrate that in addition to activating Cdc42 and Rac1 (Shekarabi et al., 2005Go; Shekarabi and Kennedy, 2002Go), netrin 1 also inhibits RhoA. It is, however, unlikely that regulation of RhoA signaling is unique to netrin 1-mediated chemoattraction. Several previous findings support a role for RhoA inhibition in axonal signal transduction during chemoattraction, although these studies did not address this directly. First, transient elevation of intracellular Ca2+ in cerebellar granule cells is both required for chemoattractant responses to BDNF (Li et al., 2005Go) and has been reported to inhibit RhoA (Jin et al., 2005Go), suggesting that RhoA inhibition may contribute to BDNF-mediated chemoattraction. Second, expression of a constitutively active mutant of RhoA is a potent inhibitor of neurite outgrowth (Fig. 4) (Ruchhoeft et al., 1999Go), suggesting that asymmetric inhibition of RhoA signaling across a growth cone might evoke directed movement. Last, the axons of growing X. laevis spinal neurons migrate toward a pipette releasing Y27632 (Yuan et al., 2003Go), indicating that RhoA inhibition is sufficient to attract axons. As such, our current findings, in combination with these earlier studies, provide evidence that local inhibition of RhoA may be a general mechanism that contributes to axonal chemoattractant responses.

RhoA regulates DCC plasma membrane presentation
DCC is distributed both on the plasma membrane and sequestered in an intracellular vesicular pool in embryonic rat SCNs (Bouchard et al., 2004Go). We show that inhibiting RhoA increases the amount of plasma membrane DCC. This could reflect described roles for RhoA signaling in endocytosis (reviewed by Qualmann and Mellor, 2003Go) and exocytosis (reviewed in Gasman et al., 2003Go). RhoA signaling is implicated in the transient reorganization of cortical actin, which is postulated to act as a barrier to vesicle traffic to and from the plasma membrane (Aunis and Bader, 1988Go; Gasman et al., 1997Go; Gasman et al., 2003Go; Sullivan et al., 1999Go; Vitale et al., 1995Go). Inhibiting RhoA with C3-exoenzyme in chromaffin cells led to the dissolution of cortical actin and enhanced exocytosis (Gasman et al., 1997Go). Additionally, RhoA signaling may influence DCC endocytosis through clathrin dependent or clathrin-independent mechanisms. RhoA signaling plays a well characterized role in clathrin-independent internalization of the transmembrane interleukin 2 receptor (Lamaze et al., 2001Go) and clathrin-independent type II phagocytosis by immune cells (Caron and Hall, 1998Go; Chimini and Chavrier, 2000Go). In polarized MDCK cells, expression of dominant-active RhoA stimulated (whereas dominant negative RhoA reduced) clathrin-mediated immunoglobulin receptor endocytosis (Leung et al., 1999Go). We are currently investigating the specific mechanisms underlying DCC trafficking in SCNs.

The result of inhibiting RhoA signaling on cell-surface DCC differs in several ways from our earlier findings demonstrating a role for PKA regulating plasma membrane presentation of DCC (Bouchard et al., 2004Go). In agreement with our current findings, Bouchard et al. (Bouchard et al., 2004Go) found that application of netrin 1 alone produced a modest increase in plasma membrane DCC. By contrast, activating PKA generated a larger increase in plasma membrane DCC, but this only occurred in the presence of netrin 1. We hypothesized that this was due to PKA activity enhancing the recruitment of DCC to the plasma membrane and netrin 1 stabilizing DCC at the cell surface. According to this model, in the absence of netrin 1, plasma membrane DCC is efficiently internalized. Addition of netrin 1 alone, without PKA activation, is predicted to bind DCC that would otherwise constitutively cycle on and off the cell surface and thereby stabilize DCC at the plasma membrane. Our current findings indicate that inhibition of RhoA signaling generates an increase in cell surface DCC independently of added netrin 1. Furthermore, the increase was not significantly different from the increase in cell surface DCC produced by netrin 1 alone. These findings suggest that although PKA can directly inhibit RhoA (Ellerbroek et al., 2003Go; Forget et al., 2002Go; Lang et al., 1996Go; Qiao et al., 2003Go), the PKA induced recruitment of DCC to the plasma membrane described by Bouchard et al (Bouchard et al., 2004Go) must engage additional mechanisms beyond inhibition of RhoA signaling.

Adhesion, RhoGTPase signaling and netrin 1/DCC interactions
Early studies indicated that axon extension requires adhesion to a substrate (Harrison, 1914Go) and subsequent studies have identified essential roles for mechanical coupling between the substrate and the growth cones cytoskeleton (Schmidt et al., 1995Go; Suter and Forscher, 2000Go). Importantly, however, the adhesivity of a substrate is not a reliable predictor of the guidance choices made by an extending axon (Burden-Gulley et al., 1995Go; Isbister and O'Connor, 1999Go; Lemmon et al., 1992Go). These findings indicate that, although adhesion to a substrate is required for motility, mechanisms in addition to adhesion, such as the engagement of specific intracellular signaling pathways, are required for appropriate axon guidance. For example, we have demonstrated that DCC-expressing cells adhere to a netrin 1 substrate; however, depending on the context, netrin 1 can function as a chemoattractant or conversely a chemorepellent, and DCC can contribute to responses in both directions (reviewed by Huber et al., 2003Go; Moore et al., 2007Go).

In migrating cells, two broad categories of adhesion sites can be distinguished: `focal complexes', which support protrusion and traction of the leading edge of a cell; and larger `focal adhesions', which provide longer term anchorage (reviewed by Kaverina et al., 2002Go; Ridley et al., 2003Go). RhoA GTPases are important coordinators of these adhesive structures; Rac and Cdc42 signal the assembly of focal complexes, whereas RhoA promotes the maturation of focal complexes into focal adhesions. An antagonistic relationship exists between Rac/Cdc42 and RhoA pathways. For example fibroblast migration to fibronectin inhibits RhoA while activating Rac and Cdc42 (del Pozo et al., 2000Go; Price et al., 1998Go; Ren et al., 1999Go). This pattern of activation is consistent with netrin 1 activating Rac and Cdc42 (Shekarabi et al., 2005Go; Shekarabi and Kennedy, 2002Go), and our finding that netrin 1 inhibits RhoA. Notably, in migrating cells, inhibition of RhoA promotes the initiation of focal complexes by Rac (Rottner et al., 1999Go; Sander et al., 1999Go). Thus, in SCNs, inhibition of RhoA by netrin 1 may facilitate activation of Rac and Cdc42 and therefore promote chemoattractive turning by enhancing the formation of focal complex-like transient adhesions and the extension of the leading edge of the growth cone.

RhoA inhibition promotes chemoattraction to netrin 1
In contrast to our findings that RhoA inhibition promotes chemoattraction to netrin 1, a recent study concluded that inhibiting RhoA signaling disrupted the guidance of neurites from an explant of embryonic cerebellum toward a source of netrin 1 (Causeret et al., 2004Go). These findings may be reconciled with ours by considering the essential role of RhoA activation in growth cone repulsion. Causeret and colleagues assayed neurite outgrowth from precerebellar explants into a collagen gel, a three-dimensional matrix that does not promote neurite extension by these cells. In the assay used, a local source of netrin 1 overcomes the inhibitory collagen, generating neurite outgrowth biased toward the netrin 1 source. By contrast, inhibiting RhoA generated a radial distribution of outgrowth from the explant, consistent with the collagen no longer functioning as a non-permissive matrix for neurite extension. We interpret this finding not as a loss of the capacity to respond to a chemoattractant, but as the loss of the response to collagen as an inhibitor of neurite extension.

RhoA inhibition, axon regeneration and axon guidance
Inhibition of RhoA and signaling mechanisms downstream of RhoA have been used to promote axon regeneration following spinal cord injury (Dergham et al., 2002Go; Fournier et al., 2003Go). In these studies, inhibiting RhoA signaling significantly enhanced axon extension in spite of growth inhibitors associated with myelin and the glial scar. Although crossing an injury site involves the axon ignoring cues that would normally be effective inhibitors of axon regeneration, for successful regeneration to occur, axons must regain the ability respond appropriately to cues that will guide them to their targets and promote synapse formation. When initiating this study, we anticipated that inhibiting RhoA signaling would probably disrupt the ability of axons to response to guidance cues, such as a chemoattractant like netrin 1. Contrary to these expectations, we determined that chemoattraction to netrin 1 was not only intact, but enhanced when RhoA signaling was inhibited. Importantly, this provides evidence that although inhibiting RhoA signaling leads to a loss of sensitivity to certain growth inhibitory cues, axonal growth cones retain the capacity to respond to at least some growth-promoting cues and suggests that this might be manipulated to direct regenerating axons to appropriate targets.


   ACKNOWLEDGMENTS
 
We thank Jean-Francois Cloutier for comments on the manuscript, Craig Mandato for helpful discussions and Isabel Rambaldi for technical assistance. S.W.M. was supported by Lloyd Carr-Harris and Canadian Institutes of Health Research Studentships. M.P. holds a fellowship from the Multiple Sclerosis Society of Canada. A.E.F. holds a Canada Research Chair. T.E.K. holds a Chercheur Nationaux Award from the Fonds de la Recherche en Santé du Québec. The project was support by the Canadian Institutes of Health Research.


   REFERENCES
TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Aktories, K., Wilde, C. and Vogelsgesang, M. (2004). Rho-modifying C3-like ADP-ribosyltransferases. Rev. Physiol. Biochem. Pharmacol. 152, 1-22.[CrossRef][Medline]

Arthur, W. T., Noren, N. K. and Burridge, K. (2002). Regulation of Rho family GTPases by cell-cell and cell-matrix adhesion. Biol. Res. 35,239 -246.[Medline]

Aunis, D. and Bader, M. F. (1988). The cytoskeleton as a barrier to exocytosis in secretory cells. J. Exp. Biol. 139,253 -266.[Abstract/Free Full Text]

Bouchard, J. F., Moore, S. W., Tritsch, N. X., Roux, P. P., Shekarabi, M., Barker, P. A. and Kennedy, T. E. (2004). Protein kinase A activation promotes plasma membrane insertion of DCC from an intracellular pool: A novel mechanism regulating commissural axon extension. J. Neurosci. 24,3040 -3050.[Abstract/Free Full Text]

Burden-Gulley, S. M., Payne, H. R. and Lemmon, V. (1995). Growth cones are actively influenced by substrate-bound adhesion molecules. J. Neurosci. 15,4370 -4381.[Abstract]

Campbell, R. E., Tour, O., Palmer, A. E., Steinbach, P. A., Baird, G. S., Zacharias, D. A. and Tsien, R. Y. (2002). A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA 99,7877 -7882.[Abstract/Free Full Text]

Caron, E. and Hall, A. (1998). Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science 282,1717 -1721.[Abstract/Free Full Text]

Causeret, F., Hidalgo-Sanchez, M., Fort, P., Backer, S., Popoff, M. R., Gauthier-Rouviere, C. and Bloch-Gallego, E. (2004). Distinct roles of Rac1/Cdc42 and Rho/Rock for axon outgrowth and nucleokinesis of precerebellar neurons toward netrin 1. Development 131,2841 -2852.[Abstract/Free Full Text]

Chimini, G. and Chavrier, P. (2000). Function of Rho family proteins in actin dynamics during phagocytosis and engulfment. Nat. Cell Biol. 2,E191 -E196.[CrossRef][Medline]

Davies, S. P., Reddy, H., Caivano, M. and Cohen, P. (2000). Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem. J. 351,95 -105.[CrossRef][Medline]

del Pozo, M. A., Price, L. S., Alderson, N. B., Ren, X. D. and Schwartz, M. A. (2000). Adhesion to the extracellular matrix regulates the coupling of the small GTPase Rac to its effector PAK. EMBO J. 19,2008 -2014.[CrossRef][Medline]

Dergham, P., Ellezam, B., Essagian, C., Avedissian, H., Lubell, W. D. and McKerracher, L. (2002). Rho signaling pathway targeted to promote spinal cord repair. J. Neurosci. 22,6570 -6577.[Abstract/Free Full Text]

Dickson, B. J. (2002). Molecular mechanisms of axon guidance. Science 298,1959 -1964.[Abstract/Free Full Text]

Driessens, M. H., Hu, H., Nobes, C. D., Self, A., Jordens, I., Goodman, C. S. and Hall, A. (2001). Plexin-B semaphorin receptors interact directly with active Rac and regulate the actin cytoskeleton by activating Rho. Curr. Biol. 11,339 -344.[CrossRef][Medline]

Ellerbroek, S. M., Wennerberg, K. and Burridge, K. (2003). Serine phosphorylation negatively regulates RhoA in vivo. J. Biol. Chem. 278,19023 -19031.[Abstract/Free Full Text]

Etienne-Manneville, S. and Hall, A. (2002). Rho GTPases in cell biology. Nature 420,629 -635.[CrossRef][Medline]

Forget, M. A., Desrosiers, R. R., Gingras, D. and Beliveau, R. (2002). Phosphorylation states of Cdc42 and RhoA regulate their interactions with Rho GDP dissociation inhibitor and their extraction from biological membranes. Biochem. J. 361,243 -254.[CrossRef][Medline]

Fournier, A. E., Takizawa, B. T. and Strittmatter, S. M. (2003). Rho kinase inhibition enhances axonal regeneration in the injured CNS. J. Neurosci. 23,1416 -1423.[Abstract/Free Full Text]

Gasman, S., Chasserot-Golaz, S., Popoff, M. R., Aunis, D. and Bader, M. F. (1997). Trimeric G proteins control exocytosis in chromaffin cells. Go regulates the peripheral actin network and catecholamine secretion by a mechanism involving the small GTP-binding protein Rho. J. Biol. Chem. 272,20564 -20571.[Abstract/Free Full Text]

Gasman, S., Chasserot-Golaz, S., Bader, M. F. and Vitale, N. (2003). Regulation of exocytosis in adrenal chromaffin cells: focus on ARF and Rho GTPases. Cell Signal. 15,893 -899.[CrossRef][Medline]

Geller, A. I., Keyomarsi, K., Bryan, J. and Pardee, A. B. (1990). An efficient deletion mutant packaging system for defective herpes simplex virus vectors: potential applications to human gene therapy and neuronal physiology. Proc. Natl. Acad. Sci. USA 87,8950 -8954.[Abstract/Free Full Text]

Govek, E. E., Newey, S. E. and Van Aelst, L. (2005). The role of the Rho GTPases in neuronal development. Genes Dev. 19,1 -49.[Abstract/Free Full Text]

Harrison, C. J. (1914). The reaction of embryonic cells to solid structures. J. Exp. Zool. 17,521 -544.[CrossRef]

Hong, K., Nishiyama, M., Henley, J., Tessier-Lavigne, M. and Poo, M. (2000). Calcium signalling in the guidance of nerve growth by netrin-1. Nature 403, 93-98.[CrossRef][Medline]

Hu, H., Marton, T. F. and Goodman, C. S. (2001). Plexin B mediates axon guidance in Drosophila by simultaneously inhibiting active Rac and enhancing RhoA signaling. Neuron 32,39 -51.[CrossRef][Medline]

Huber, A. B., Kolodkin, A. L., Ginty, D. D. and Cloutier, J. F. (2003). Signaling at the growth cone: ligand-receptor complexes and the control of axon growth and guidance. Annu. Rev. Neurosci. 26,509 -563.[CrossRef][Medline]

Isbister, C. M. and O'Connor, T. P. (1999). Filopodial adhesion does not predict growth cone steering events in vivo. J. Neurosci. 19,2589 -2600.[Abstract/Free Full Text]

Jain, A., Brady-Kalnay, S. M. and Bellamkonda, R. V. (2004). Modulation of Rho GTPase activity alleviates chondroitin sulfate proteoglycan-dependent inhibition of neurite extension. J. Neurosci. Res. 77,299 -307.[CrossRef][Medline]

Jin, M., Guan, C. B., Jiang, Y. A., Chen, G., Zhao, C. T., Cui, K., Song, Y. Q., Wu, C. P., Poo, M. M. and Yuan, X. B. (2005). Ca2+-dependent regulation of rho GTPases triggers turning of nerve growth cones. J. Neurosci. 25,2338 -2347.[Abstract/Free Full Text]

Karnoub, A. E., Symons, M., Campbell, S. L. and Der, C. J. (2004). Molecular basis for Rho GTPase signaling specificity. Breast Cancer Res. Treat. 84, 61-71.[CrossRef][Medline]

Kaverina, I., Krylyshkina, O. and Small, J. V. (2002). Regulation of substrate adhesion dynamics during cell motility. Int. J. Biochem. Cell Biol. 34,746 -761.[CrossRef][Medline]

Keino-Masu, K., Masu, M., Hinck, L., Leonardo, E. D., Chan, S. S., Culotti, J. G. and Tessier-Lavigne, M. (1996). Deleted in Colorectal Cancer (DCC) encodes a netrin receptor. Cell 87,175 -185.[CrossRef][Medline]

Kennedy, T. E., Serafini, T., de la Torre, J. R. and Tessier-Lavigne, M. (1994). Netrins are diffusible chemotropic factors for commissural axons in the embryonic spinal cord. Cell 78,425 -435.[CrossRef][Medline]

Kennedy, T. E., Wang, H., Marshall, W. and Tessier-Lavigne, M. (2006). Axon guidance by diffusible chemoattractants: a gradient of netrin protein in the developing spinal cord. J. Neurosci. 26,8866 -8874.[Abstract/Free Full Text]

Khosravi-Far, R., Solski, P. A., Clark, G. J., Kinch, M. S. and Der, C. J. (1995). Activation of Rac1, RhoA, and mitogen-activated protein kinases is required for Ras transformation. Mol. Cell. Biol. 15,6443 -6453.[Abstract]

Lamaze, C., Dujeancourt, A., Baba, T., Lo, C. G., Benmerah, A. and Dautry-Varsat, A. (2001). Interleukin 2 receptors and detergent-resistant membrane domains define a clathrin-independent endocytic pathway. Mol. Cell 7,661 -671.[CrossRef][Medline]

Lang, P., Gesbert, F., Delespine-Carmagnat, M., Stancou, R., Pouchelet, M. and Bertoglio, J. (1996). Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects of cyclic AMP in cytotoxic lymphocytes. EMBO J. 15,510 -519.[Medline]

Lemmon, V., Burden, S. M., Payne, H. R., Elmslie, G. J. and Hlavin, M. L. (1992). Neurite growth on different substrates: permissive versus instructive influences and the role of adhesive strength. J. Neurosci. 12,818 -826.[Abstract]

Leung, S. M., Rojas, R., Maples, C., Flynn, C., Ruiz, W. G., Jou, T. S. and Apodaca, G. (1999). Modulation of endocytic traffic in polarized Madin-Darby canine kidney cells by the small GTPase RhoA. Mol. Biol. Cell 10,4369 -4384.[Abstract/Free Full Text]

Li, W., Lee, J., Vikis, H. G., Lee, S. H., Liu, G., Aurandt, J., Shen, T. L., Fearon, E. R., Guan, J. L., Han, M. et al. (2004). Activation of FAK and Src are receptor-proximal events required for netrin signaling. Nat. Neurosci. 7,1213 -1221.[CrossRef][Medline]

Li, Y., Jia, Y. C., Cui, K., Li, N., Zheng, Z. Y., Wang, Y. Z. and Yuan, X. B. (2005). Essential role of TRPC channels in the guidance of nerve growth cones by brain-derived neurotrophic factor. Nature 434,894 -898.[CrossRef][Medline]

Liu, G., Beggs, H., Jurgensen, C., Park, H. T., Tang, H., Gorski, J., Jones, K. R., Reichardt, L. F., Wu, J. and Rao, Y. (2004). Netrin requires focal adhesion kinase and Src family kinases for axon outgrowth and attraction. Nat. Neurosci. 7,1222 -1232.[CrossRef][Medline]

Manitt, C. and Kennedy, T. E. (2002). Where the rubber meets the road: netrin expression and function in developing and adult nervous systems. Prog. Brain Res. 137,425 -442.[Medline]

Manitt, C., Colicos, M. A., Thompson, K. M., Rousselle, E., Peterson, A. C. and Kennedy, T. E. (2001). Widespread expression of netrin-1 by neurons and oligodendrocytes in the adult mammalian spinal cord. J. Neurosci. 21,3911 -3922.[Abstract/Free Full Text]

Ming, G., Song, H., Berninger, B., Inagaki, N., Tessier-Lavigne, M. and Poo, M. (1999). Phospholipase C-gamma and phosphoinositide 3-kinase mediate cytoplasmic signaling in nerve growth cone guidance. Neuron 23,139 -148.[CrossRef][Medline]

Moore, S. W. and Kennedy, T. E. (2006). Protein kinase A regulates the sensitivity of spinal commissural axon turning to netrin-1 but does not switch between chemoattraction and chemorepulsion. J. Neurosci. 26,2419 -2423.[Abstract/Free Full Text]

Moore, S. W. and Kennedy, T. E. (2008). Dissection and culture of spinal commissural neurons. In Current Protocols in Neuroscience (ed. G. Taylor), pp.3.20.1 -3.20.17. Hoboken, NJ: John Wiley and Sons.

Moore, S. W., Tessier-Lavigne, M. and Kennedy, T. E. (2007). Netrins and their receptors. Adv. Exp. Med. Biol. 621,17 -31.[Medline]

Neve, R. L., Howe, J. R., Hong, S. and Kalb, R. G. (1997). Introduction of the glutamate receptor subunit 1 into motor neurons in vitro and in vivo using a recombinant herpes simplex virus. Neuroscience 79,435 -447.[CrossRef][Medline]

Price, L. S., Leng, J., Schwartz, M. A. and Bokoch, G. M. (1998). Activation of Rac and Cdc42 by integrins mediates cell spreading. Mol. Biol. Cell 9,1863 -1871.[Abstract/Free Full Text]

Qiao, J., Huang, F. and Lum, H. (2003). PKA inhibits RhoA activation: a protection mechanism against endothelial barrier dysfunction. Am. J. Physiol. Lung Cell Mol. Physiol. 284,L972 -L980.[Abstract/Free Full Text]

Qualmann, B. and Mellor, H. (2003). Regulation of endocytic traffic by Rho GTPases. Biochem. J. 371,233 -241.[CrossRef][Medline]

Ren, X. D. and Schwartz, M. A. (2000). Determination of GTP loading on Rho. Methods Enzymol. 325,264 -272.[Medline]

Ren, X. D., Kiosses, W. B. and Schwartz, M. A. (1999). Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton. EMBO J. 18,578 -585.[CrossRef][Medline]

Ren, X. R., Ming, G. L., Xie, Y., Hong, Y., Sun, D. M., Zhao, Z. Q., Feng, Z., Wang, Q., Shim, S., Chen, Z. F. et al. (2004). Focal adhesion kinase in netrin-1 signaling. Nat. Neurosci. 7,1204 -1212.[CrossRef][Medline]

Renaudin, A., Lehmann, M., Girault, J. and McKerracher, L. (1999). Organization of point contacts in neuronal growth cones. J. Neurosci. Res. 55,458 -471.[CrossRef][Medline]

Ridley, A. J., Schwartz, M. A., Burridge, K., Firtel, R. A., Ginsberg, M. H., Borisy, G., Parsons, J. T. and Horwitz, A. R. (2003). Cell migration: integrating signals from front to back. Science 302,1704 -1709.[Abstract/Free Full Text]

Rottner, K., Hall, A. and Small, J. V. (1999). Interplay between Rac and Rho in the control of substrate contact dynamics. Curr. Biol. 9,640 -648.[CrossRef][Medline]

Ruchhoeft, M. L., Ohnuma, S., McNeill, L., Holt, C. E. and Harris, W. A. (1999). The neuronal architecture of Xenopus retinal ganglion cells is sculpted by rho-family GTPases in vivo. J. Neurosci. 19,8454 -8463.[Abstract/Free Full Text]

Sander, E. E., ten Klooster, J. P., van Delft, S., van der Kammen, R. A. and Collard, J. G. (1999). Rac downregulates Rho activity: reciprocal balance between both GTPases determines cellular morphology and migratory behavior. J. Cell Biol. 147,1009 -1022.[Abstract/Free Full Text]

Schmidt, C. E., Dai, J., Lauffenburger, D. A., Sheetz, M. P. and Horwitz, A. F. (1995). Integrin-cytoskeletal interactions in neuronal growth cones. J. Neurosci. 15,3400 -3407.[Abstract]

Scott, V. R., Boehme, R. and Matthews, T. R. (1988). New class of antifungal agents: jasplakinolide, a cyclodepsipeptide from the marine sponge, Jaspis species. Antimicrob. Agents Chemother. 32,1154 -1157.[Abstract/Free Full Text]

Serafini, T., Kennedy, T. E., Galko, M. J., Mirzayan, C., Jessell, T. M. and Tessier-Lavigne, M. (1994). The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell 78,409 -424.[CrossRef][Medline]

Shekarabi, M. and Kennedy, T. E. (2002). The netrin-1 receptor DCC promotes filopodia formation and cell spreading by activating Cdc42 and Rac1. Mol. Cell. Neurosci. 19, 1-17.[CrossRef][Medline]

Shekarabi, M., Moore, S. W., Tritsch, N. X., Morris, S. J., Bouchard, J. F. and Kennedy, T. E. (2005). Deleted in colorectal cancer binding netrin-1 mediates cell substrate adhesion and recruits Cdc42, Rac1, Pak1, and N-WASP into an intracellular signaling complex that promotes growth cone expansion. J. Neurosci. 25,3132 -3141.[Abstract/Free Full Text]

Shirasaki, R., Mirzayan, C., Tessier-Lavigne, M. and Murakami, F. (1996). Guidance of circumferentially growing axons by netrin-dependent and -independent floor plate chemotropism in the vertebrate brain. Neuron 17,1079 -1088.[CrossRef][Medline]

Sullivan, R., Price, L. S. and Koffer, A. (1999). Rho controls cortical F-actin disassembly in addition to, but independently of, secretion in mast cells. J. Biol. Chem. 274,38140 -38146.[Abstract/Free Full Text]

Suter, D. M. and Forscher, P. (2000). Substrate-cytoskeletal coupling as a mechanism for the regulation of growth cone motility and guidance. J. Neurobiol. 44, 97-113.[CrossRef][Medline]

Uehata, M., Ishizaki, T., Satoh, H., Ono, T., Kawahara, T., Morishita, T., Tamakawa, H., Yamagami, K., Inui, J., Maekawa, M. et al. (1997). Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389,990 -994.[CrossRef][Medline]

Visegrady, B., Lorinczy, D., Hild, G., Somogyi, B. and Nyitrai, M. (2005). A simple model for the cooperative stabilisation of actin filaments by phalloidin and jasplakinolide. FEBS Lett. 579,6 -10.[CrossRef][Medline]

Vitale, M. L., Seward, E. P. and Trifaro, J. M. (1995). Chromaffin cell cortical actin network dynamics control the size of the release-ready vesicle pool and the initial rate of exocytosis. Neuron 14,353 -363.[CrossRef][Medline]

Wahl, S., Barth, H., Ciossek, T., Aktories, K. and Mueller, B. K. (2000). Ephrin-A5 induces collapse of growth cones by activating Rho and Rho kinase. J. Cell Biol. 149,263 -270.[Abstract/Free Full Text]

Wheeler, A. P. and Ridley, A. J. (2004). Why three Rho proteins? RhoA, RhoB, RhoC, and cell motility. Exp. Cell Res. 301,43 -49.[CrossRef][Medline]

Winton, M. J., Dubreuil, C. I., Lasko, D., Leclerc, N. and McKerracher, L. (2002). Characterization of new cell permeable C3-like proteins that inactivate Rho and stimulate neurite outgrowth on inhibitory substrates. J. Biol. Chem. 277,32820 -32829.[Abstract/Free Full Text]

Woo, S. and Gomez, T. M. (2006). Rac1 and RhoA promote neurite outgrowth through formation and stabilization of growth cone point contacts. J. Neurosci. 26,1418 -1428.[Abstract/Free Full Text]

Worthylake, R. A. and Burridge, K. (2003). RhoA and ROCK promote migration by limiting membrane protrusions. J. Biol. Chem. 278,13578 -13584.[Abstract/Free Full Text]

Worthylake, R. A., Lemoine, S., Watson, J. M. and Burridge, K. (2001). RhoA is required for monocyte tail retraction during transendothelial migration. J. Cell Biol. 154,147 -160.[Abstract/Free Full Text]

Yuan, X. B., Jin, M., Xu, X., Song, Y. Q., Wu, C. P., Poo, M. M. and Duan, S. (2003). Signalling and crosstalk of Rho GTPases in mediating axon guidance. Nat. Cell Biol. 5, 38-45.[CrossRef][Medline]

Yurchenco, P. D. and Wadsworth, W. G. (2004). Assembly and tissue functions of early embryonic laminins and netrins. Curr. Opin. Cell Biol. 16,572 -579.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
 DevelopmentHome page
F. J. Martini, M. Valiente, G. Lopez Bendito, G. Szabo, F. Moya, M. Valdeolmillos, and O. Marin
Biased selection of leading process branches mediates chemotaxis during tangential neuronal migration
Development, January 1, 2009; 136(1): 41 - 50.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. W. Moore, J. P. Correia, K. L. W. Sun, M. Pool, A. E. Fournier, and T. E. Kennedy
Rho inhibition recruits DCC to the neuronal plasma membrane and enhances axon chemoattraction to netrin 1
J. Cell Sci., September 1, 2008; 121(17): e1706 - e1706.
[Full Text]

This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.024133v1
135/17/2855    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moore, S. W.
Right arrow Articles by Kennedy, T. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moore, S. W.
Right arrow Articles by Kennedy, T. E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?