|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 24 July 2008
doi: 10.1242/dev.022194
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Department of Developmental and Regenerative Biology, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York, NY 10029, USA.
Author for correspondence (e-mail:
marek.mlodzik{at}mssm.edu)
Accepted 15 June 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Cell signaling, Feedback modulation, Transcriptional repression
| INTRODUCTION |
|---|
|
|
|---|
The Notch (N) signaling pathway, which is involved in a vast number of
processes in Drosophila and vertebrates, is a notable example
(reviewed by Artavanis-Tsakonas et al.,
1999
; Doroquez and Rebay,
2006
; Lai, 2004
).
Strikingly, a relatively simple conserved core pathway controls the entire
range of N responses. The N protein is a transmembrane receptor that is
modified through glycosylation and cleavage (S1) in the Golgi
(Logeat et al., 1998
;
Moloney et al., 2000
;
Okajima and Irvine, 2002
). Two
transmembrane ligands are known in Drosophila: Delta (Dl) and Serrate
(Ser) (reviewed by Fleming et al.,
1997
). Upon binding, ligands induce two additional proteolytic
events of N, the S2 and S3 cleavages, leading to the release of the
intracellular domain (Nintra), the active form of N
(Pan and Rubin, 1997
)
(reviewed by Selkoe and Kopan,
2003
). Nintra translocates to the nucleus and interacts
with a protein complex that includes the transcription factors Suppressor of
Hairless [Su(H)] and Mastermind (Mam) to regulate target gene expression
(Bray, 2006
;
Kopan, 2002
).
The Drosophila retina is one tissue in which reiterative N
activity is evident. Ommatidial cell determination and differentiation
initiates in third instar larvae in a very ordered manner. An indentation, the
morphogenetic furrow (MF), sweeps across eye discs from posterior to anterior,
leaving behind it the ommatidial founder cells, photoreceptor 8 precursors
(R8), at evenly spaced intervals (Wolff
and Ready, 1993
). N function in the MF is required for the
expression of the proneural factor atonal (ato, `proneural
enhancement') (Jarman et al.,
1994
; Li and Baker,
2001
). Proneural enhancement is followed by lateral inhibition
defining the spacing of single ato-expressing R8 precursors
(Li and Baker, 2001
;
Sun et al., 1998
). R8 secretes
the EGFR ligand Spitz (Spi), which signals to surrounding progenitors to be
recruited. Newly specified photoreceptors also secrete Spi to further recruit
the cells that will form the mature ommatidium. This process is counteracted
by N-mediated lateral inhibition. Overactivation of EGFR signaling leads to an
increased number of ommatidial cells, whereas overactivation of N signaling
has the opposite effect (Cagan and Ready,
1989
; Freeman,
1996
; Lai and Rubin,
2001
). The process of lateral inhibition by N involves
transcriptional activation of various target genes, including members of the
Enhancer of split complex [E(spl)-C] that act as transcriptional repressors of
proneural genes (Jimenez and Ish-Horowicz,
1997
; Lecourtois and
Schweisguth, 1995
).
In addition to its role during ommatidial assembly, N has other roles in
cell fate specification posterior to the MF: it is involved in the
specification of photoreceptor R4 versus R3 and R7 versus R1/R6 fates
(Cooper and Bray, 1999
;
Cooper and Bray, 2000
;
del Alamo and Mlodzik, 2006
;
Fanto and Mlodzik, 1999
;
Tomlinson and Struhl, 2000), and the determination of cone cell fate
(Fu and Noll, 1997
). In
addition, N signaling is required to control cell cycle progression during the
second mitotic wave (SMW) (Baonza and
Freeman, 2005
), the regulation of apoptotic cell death and the
specification of pigment cells during pupal development
(Miller and Cagan, 1998
;
Rusconi et al., 2000
).
Although the regulation of the core N pathway is largely understood, much
remains to be known about tissue- and time-specific modulation of N responses.
We address the role of the rotund (rn; m - FlyBase)
gene in the context of N signaling. rn produces two different
transcripts, rn and roughened eye (roe), which
encode two isoforms that are members of the Krüppel family of Zn-finger
transcription factors. Rn and Roe have identical C-terminal regions but
differing N-terminal sequences caused by the use of alternative promoters.
They display non-overlapping expression patterns and are not functionally
interchangeable (St Pierre et al.,
2002
). Although rn is expressed and required during wing,
haltere, antenna, leg and proboscis development
(del Alamo et al., 2002
;
St Pierre et al., 2002
),
roe is specifically expressed in the eye imaginal disc. No detailed
functional studies have been performed but previous reports have shown that
eyes mutant for roe show disrupted ommatidial patterning caused by
reduced photoreceptor numbers (St Pierre
et al., 2002
).
Here, we analyze the function of roe during eye development and demonstrate that N signaling modulates its own target gene activation during retinal patterning through regulation of roe expression. In the absence of roe function, expression of N targets is elevated, causing a phenotype similar to a N gain-of-function scenario. Our results indicate that roe is required for the specification of single R8 cells and subsequent recruitment of ommatidial cells. We demonstrate that roe is expressed, under the control of N signaling, at high levels in the MF and at lower levels in progenitor cells posterior to it. Importantly, our data show that Roe can bind E(spl)-C regulatory DNA sequences both in vitro and in vivo, and, thus, Roe acts as a transcriptional repressor of N target genes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunofluorescence and histology
Larvae and pupae (
48 hours APF) were dissected and stained as
described (Fanto et al.,
2000
). Primary antibodies used were: mouse
-Elav, rat
-Elav, mouse
-Wg, mouse
-Dl, mouse
-Nintra, mouse
-Pros (DSHB,
http://www.uiowa.edu/~dshbwww),
rabbit
-βGal (Promega), mouse
-βGal (Promega), rabbit
-Bib (Doherty et al.,
1997
), rabbit
-Ato
(Jarman et al., 1994
) and
mouse
-Boss (Van Vactor et al.,
1991
). Secondary antibodies were from Jackson Laboratories. Adult
eyes were embedded in Durcupan resin and tangential sections taken at the
equatorial region. At least three independent eyes were analyzed per
genotype.
Antibody production
The Roe ORF was subcloned into pQE (Qiagen) and pGEX (Amersham) for
His-tagged and GST-tagged protein production, respectively. Immunization of
rabbits and preparation of sera was performed by Covance. Antibody quality and
specificity was evaluated by staining imaginal disc containing
rn16 clones (not shown). Details are available upon
request.
In situ hybridization
Two different digoxigenin probes were used (DIG RNA labeling kit, Roche).
One was from the roe full-length cDNA while the other was synthesized
from a
500 bp PCR fragment of this cDNA (details available upon
request).
In brief, imaginal discs were fixed in 4% paraformaldehyde at 4°C, and
hybridized in standard 50% formamide hybridization buffer (55°C). Probe
was detected with 1:2000 Alkaline Phosphatase-coupled sheep
-DIG
antibody followed by development with NBT/BCIP (Roche).
Electrophoretic mobility shift assay (EMSA)
EMSA was performed as described (Ausubel
et al., 1995
). Oligonucleotides were 32P-radiolabeled
using Polynucleotide Kinase (NEB). The 0.3 kb probe was amplified from the 0.5
kb m
enhancer using radiolabeled primers.
The non-competitive oligonucletide is a 40 bp fragment from the
E(spl)m8 regulatory region that contains one Su(H) Paired Site
(Nellesen et al., 1999
) with
the following sequence:
ATTGTGTGAGAAACTTACTTTCAGCTCGGTTCCCACGCCAC [Su(H) binding sites
in bold].
GST::Su(H) and GST::roe were produced using pGEX vectors (see above). All binding reactions contained 10-12% glycerol, 100 ng poly dIdC and 4.5 µg BSA and were incubated for 15 minutes at 30°C before loading on a prerun gel. Gels were run at 4°C.
Chromatin immunoprecipitation (ChIP) in vivo
In vivo ChIP was performed basically as described
(Delaney et al., 2006
). Each
experiment, including Input, IP and Mock-IP fractions, was performed using eye
imaginal discs (brain included) from 200 third instar larvae of the
appropriate genotypes. The input fraction was not immunoprecipitated, the IP
fraction was immunoprecipitated using
-Roe antibody (1:1875) and
`mock-IP' was immunoprecipitated with preimmune Normal Goat Serum (1:1875).
Final DNA eluate was resuspended in 20 µl for all fractions. The input
fraction (1 µl) and 5 µl each of the IP and mock-IP fractions were used
for PCR in 50 µl. The input PCR (5 µl) and 20 µl each of the IP and
mock-IP were loaded on gel.
| RESULTS |
|---|
|
|
|---|
We next analyzed eye clones mutant for the roe null allele,
rn16 (see Materials and methods). These displayed
phenotypes identical to those observed in adult escaper eyes
(Fig. 1C). In order to identify
the requirement of roe in specific photoreceptors, we analyzed
phenotypically wild-type mosaic ommatidia. In white (w)
clones (only affecting pigment production but not retinal development), the
ratio between ommatidia that are w for one specific outer
photoreceptor and total mosaic ommatidia is 0.5 for each photoreceptor type,
because mosaic ommatidia include either a w (mutant) or a wild-type
photoreceptor with the same probability (not shown). By contrast, if
roe is required for the recruitment or specification of a
photoreceptor type, the number of phenotypically normal ommatidia mutant for
that photoreceptor will be significantly lower than the number of ommatidia
wild type for that photoreceptor, leading to a decreased ratio. We did observe
a reduced ratio for R1 (r=0.32) and R6 (r=0.34;
Fig. 1F), which in both cases
was statistically significant (
2 test, P<0.001).
We also analyzed the number of R7s when compared with the number of outer
photoreceptors per ommatidia (see Fig. S1 in the supplementary material). We
detected only ommatidia with multiple R7 cells when the number of outer R1-6
photoreceptors was reduced. R1, R6 and R7 are initially equivalent following
their recruitment into the precluster, and Dl signaling from the R1/R6
precursors to N in R7 specifies the latter as the sole R7. Ectopic activation
of N in R1 and R6 causes these cells to adopt the R7 fate
(Cooper and Bray, 2000
). The
reduction in the number of R1-R6 cells in mutant ommatidia, and the presence
of multiple R7s only in the context of decreased outer R cells, suggest that
the multiple R7 phenotype is due to a transformation of R1 and R6 into R7.
This is further supported by the fact that Roe expression is enriched in R1
and R6 precursors prior to recruitment (see below).
|
-Ato
staining); (2) reduced number of recruited photoreceptors per ommatidium
(Fig. 1D); and (3) multiple R7
cells, as detected in adult sections and by the molecular R7 marker Prospero
(Fig. 1B,C,E,E'; and not
shown).
In addition, we analyzed the cell number and organization of cone and
pigment cells in pupal eyes.
-Arm staining (see Materials and methods),
which delineates cell membranes, revealed under-recruitment of cone cells
(Fig. 1G,H). This was confirmed
by imaginal disc staining with the cone cell marker Cut (not shown). This
analysis also revealed a reduction of secondary and tertiary pigment cells and
defects in interommatidial bristle specification
(Fig. 1G,H).
Taken together, our results indicate that roe is required for proper ommatidial cell recruitment at several stages of eye development. Strikingly, the roe phenotype resembles that of a mild overactivation of N signaling during eye patterning.
N target gene expression is elevated in roe clones
Based on this phenotype, we explored the possibility that roe is
acting as a negative regulator of N activity. We thus analyzed the expression
of N target genes in roe16 clones.
Ato expression (
-Ato) is first detected as a continuous stripe in
the MF and subsequently resolves into single cells (R8)
(Jarman et al., 1994
;
Sun et al., 1998
). In
roe mutant clones, we observed occasional loss of Ato staining in
single cells, indicative of the failure to specify R8 photoreceptors (arrows
in Fig. 2A,A'; compare
with arrowheads in same panels). There was no significant change in Ato
expression during proneural enhancement within the MF
(Fig. 2A,A'). To confirm
a role of roe in the regulation of ato expression during
lateral inhibition, we analyzed the expression of the lacZ-reporter
ato5'F9.3-Z (ato-lacZ in
Fig. 2B,B'). This
reporter is repressed by N signaling through lateral inhibition at this stage
(Sun et al., 1998
). In
roe clones, ato5'F9.3-Z expression was
completely lost, indicating that N activity on this reporter was increased in
the roe mutant background (Fig.
2B,B').
We next analyzed the expression of lacZ reporter lines that are
positively regulated by N signaling during eye patterning
(Cooper et al., 2000
).
E(spl)mβ1.5-Z (mβ-lacZ in
Fig. 2C,C') shows a
general expression posterior to the furrow and its expression was increased
inside roe- clones
(Fig. 2C,C').
E(spl)m
1.1-Z (m
-lacZ in
Fig. 2D,D') is expressed
in a more restricted manner posterior to the MF. In roe-
clones, this expression was also upregulated
(Fig. 2D,D').
In contrast to these N targets, we did not observe changes in expression of the core N signaling component Dl or N itself (Fig. 2E-F), suggesting that roe might act downstream of N. Taken together, these data suggest that Roe attenuates N signaling.
Roe represses N target gene expression
The loss-of-function data suggested that roe antagonizes N
signaling activity (see above). We thus wanted to confirm this hypothesis with
gain-of-function studies. First, clonal overexpression of roe in
developing ommatidia produced a phenotype similar to that of N
loss-of-function clones: the recruitment of supernumerary photoreceptors to
the cluster (Fig. 3A,A').
This is in agreement with our loss-of-function data (reduced number of
R-cells) and consistent with Roe being a negative regulator of N signaling.
Expression of N signaling target genes was difficult to analyze owing to the
recruitment of extra photoreceptors, which show reduced levels of N activity
per se. To circumvent this problem, we used the well-defined N function in
R3/R4 specification. Following the recruitment of the R3/R4 precursor pair,
elevated Fz/PCP signaling in R3 leads to higher expression levels of
Dl and neuralized in R3. This causes a directional
activation of N in R4, which then specifies R4 fate. N activity can be
monitored by the expression of the reporter line
E(spl)m
0.5-Z
(Cooper and Bray, 1999
;
del Alamo and Mlodzik, 2006
;
Fanto and Mlodzik, 1999
). We
overexpressed Roe using a sevenless (sev)-derived driver
line, sepGAL4, which is active at high levels in the R3/R4
precursor pair (Fanto et al.,
2000
), and observed a large number of R3/R3 symmetrical ommatidia
(35.4±6.7%, Fig. 3B,C),
characteristic of a failure of N activation in R4 precursors. Consequently,
imaginal disc staining of the N target reporter
E(spl)m
0.5-Z showed reduced or absent expression in
R4 (not shown). To further analyze this effect, we induced clones of cells
expressing two copies of sepGAL4, UAS-Roe and confirmed
the reduction in expression of E(spl)m
0.5-Z
(Fig. 3D,D').
|
ECD, see
Materials and methods), causes the opposite phenotype, leading to R4/R4
symmetrical clusters (32.6±4.3%,
Fig. 3C and not shown).
Notably, this phenotype was suppressed by simultaneous co-expression of Roe
and N
ECD (Fig.
3C and not shown), resulting in 16.9±9.1% R3/R3 symmetrical
clusters and 8±3.5% R4/R4-type clusters
(Fig. 3C). The loss-of-R-cell
phenotype of sep-N
ECD was increased,
although this phenotype is not likely to be produced by defective cell
recruitment as sepGAL4 is expressed at high levels only in
photoreceptors after recruitment.
To confirm the ability of Roe to negatively modulate N signaling, we turned
to a heterologous system, the leg imaginal disc, where roe is not
expressed endogenously (not shown) (St
Pierre et al., 2002
). In leg imaginal discs, the big
brain (bib) gene is expressed in concentric rings, which
constitute the presumptive leg joint cells, in response to N signaling
(Fig. 4E)
(de Celis et al., 1998
).
Activation of N within the dpp expression stripe
(dppGAL4, UAS-N
ECD) ectopically
activates Bib expression (Fig.
4B,B'). By contrast, ectopic expression of Roe in the same
domain, led to a repression of endogenous Bib expression
(Fig. 4C,C'). In all
cases, expression of wingless (wg) in a ventral-anterior
wedge, independent of N signaling, was not affected (blue in
Fig. 4C; not shown), indicating
that the effect was specific. Similarly, the N-signaling reporter/target
E(spl)mβ1.5-Z (mβ-lacZ in
Fig. 4D-E) is expressed in
concentric rings coincident with those of bib
(Fig. 4D,D'). Expression
of Roe within the dpp-domain (dppGAL4, green in
Fig. 4E) represses
E(spl)mβ1.5-Z (Fig.
4E,E'). By contrast, as with bib, expression of
activated N under dppGAL4 control causes ectopic
upregulation of E(spl)mβ1.5-Z (not shown).
In summary, these data indicate that: (1) roe overexpression causes similar phenotypes to N loss of function; and (2) that roe is a general inhibitor of N signaling target gene expression only limited by its expression pattern.
roe expression is controlled by N signaling
Previous studies have suggested that roe is expressed at high
levels in the MF (St Pierre et al.,
2002
). Using two different RNA probes (see Materials and methods)
we were able to detect roe expression not only in the MF but also
posterior to it (Fig. 5A; not
shown). In order to define roe expression in detail, we developed a
polyclonal antibody (see Materials and methods). In agreement with our in situ
hybridization experiments, antibody staining revealed that Roe is expressed at
high levels in the MF, and at lower levels in interommatidial progenitor cells
posterior to the furrow (Fig.
5B,B', note largely non-overlapping staining between Elav-
and Roe-positive cells). In accordance with its predicted Zn-finger
transcription factor nature (St Pierre et
al., 2002
), Roe was detected only in the nuclei
(Fig. 5B,B').
Furthermore, elevated Roe expression was observed in the R1/R6 precursor pair
(identified by their position with respect to the whole cluster) at the onset
of Elav expression (Fig. 5C).
The identity of R1 and R6 was further confirmed by co-staining with a
sevenless reporter line (sevGAL4, UAS GFP), which
is expressed in R1, R6 and R7 prior to recruitment
(Fig. 5D,D'). These
observations support our previous observation of a specific requirement in the
R1/R6 pair (Fig. 1F; see
above).
|
ECD; see Materials and methods) caused
ectopic upregulation of Roe close to the MF and elevated expression posterior
to it (Fig. 5F,F';
overexpression of Dl caused the same effects, not shown). Expression analysis
at the MF is complex, because N can induce ectopic MFs and photoreceptor
differentiation (with subsequent reduction of roe expression levels)
through activation of dpp expression during the reincarnation process
of MF movement (Fig.
5F,F'; data not shown)
(Kumar and Moses, 2001
In contrast to N, loss-of-function of EGFR signaling generated through
clonal expression of UAS-DERDN or UAS-aos
(Freeman, 1994
;
Freeman, 1996
), or
loss-of-function of the Hh and Dpp signaling pathways did not affect
roe expression (not shown).
Taken together, our results indicate that Roe is localized to the nucleus of cells at the MF and in progenitor cells and that its expression is (at least partially) under N-signaling control. Our data suggest that Roe is part of a negative-feedback loop modulating N signaling outcome during ommatidial patterning.
|
500 bp m
0.5 enhancer sequence
(Cooper et al., 2000
0.5 sequence was responsive to Roe overexpression in
vivo (e.g. Fig. 3D).
We used GST::Su(H) as a positive control and we detected Su(H) binding to
the probe (Fig. 6B, lanes 1-2).
We were also able to detect a shift with GST::Roe
(Fig. 6B, lanes 5-6).
Interestingly, the simultaneous presence of both proteins lead to the same
shifts that were observed with each individual protein
(Fig. 6B, lane 3), indicating
that Su(H) and Roe bind DNA independently of each other. GST-pull down
experiments failed to detect any interaction between Su(H) and Roe (not
shown), further confirming this conclusion. The binding was successfully
out-competed by an excess of cold probe in both cases
(Fig. 6B, lanes 4 and 7),
indicating a specific interaction. In an attempt to further define Roe binding
sites in this probe, we performed EMSA with nine overlapping 60 bp
oligonucleotides covering the whole 300 bp fragment (P1-P9 in
Fig. 6A; see Fig. S2 in the
supplementary material). We detected binding of GST::Roe to all
oligonucleotides. The GST::Roe binding was specific, as it was out-competed by
an excess of the respective cold oligonucleotides but not by an equal excess
of an unrelated oligonucleotide (see Fig. S2 in the supplementary material;
see also Materials and methods). These data suggest that multiple specific
Roe-binding sites exist in E(spl)m
regulatory sequences.
In order to prove that Roe binds to regulatory DNA sequences in vivo during
normal eye development, we performed chromatin immunoprecipitation assays
(ChIPs, see Materials and methods) from in vivo samples. In this assay, we
were able to recover the 300 bp fragment from DNA immunoprecipitated using the
anti-Roe antibody on eye imaginal disc homogenates
(Fig. 6C). By contrast, when
preimmune serum was used (mock-ChIP), no specific bands were
immunoprecipitated (Fig. 6C,
right lane). As a specificity control, we performed ChIP with anti-Roe with
sequences from the unrelated antimicrobial gene attacinA
(Delaney et al., 2006
) and did
not detect binding, confirming that the Roe interaction with
E(spl)m
regulatory DNA is specific
(Fig. 6C, lower panel). To
further define the specificity of the interaction, we performed ChIP with
imaginal discs from roe null (rn16) larvae and
did not detect an interaction, either with the E(spl)m
regulatory DNA sequences or with the AttA promoter
(Fig. 6D, upper and lower
panels, respectively), again indicating that the ChIP interaction is specific
for Roe.
In summary, our results indicate that Roe binds to E(spl)m
regulatory DNA sequences both in vitro and in vivo independently of Su(H),
providing a molecular mechanism for Roe action in repressing N-signaling
target genes.
| DISCUSSION |
|---|
|
|
|---|
|
roughened eye: a tissue-specific modulator of N signaling
Loss-of-function phenotypes of roe phenocopy mild N
gain-of-function defects during ommatidial patterning: failure to specify R8
cells, under-recruitment of R-cells and specification of multiple R7 cells at
the expense of R1/R6. In accordance, we identify several N targets that are
upregulated in roe loss-of-function clones, including
E(spl)-C reporter lines. Pupal eye analyses reveal that in addition
to photoreceptors other ommatidial cells are affected, including cone cells,
secondary and tertiary pigment cells, and interommatidial bristles. Dl and Spi
are expressed in R cells activating N and Egfr pathways, respectively, in
surrounding progenitor cells, where they cooperate with the transcription
factor Lozenge to specify the cone cell fate
(Daga et al., 1996
;
Flores et al., 2000
).
roe loss-of-function can induce higher levels of N target genes that
lead to a reduction in the number of R cells. As R cells produce the signals
that specify cone cells, it is likely that fewer R cells produce, in turn,
fewer cone cells.
Reciprocal to the loss-of-function defects, Roe overexpression (Fig. 3) leads to repression of N target genes resulting in the recruitment of extra photoreceptors. Similarly, we demonstrate that Roe is able to repress the N-signaling dependent R4 fate. Importantly, the repression effect of Roe can be antagonized by simultaneous co-expression of an activated form of N, suggesting that a fine balance between the activity of N-signaling and Roe is employed in many of these cell fate decisions. Taken together, these results indicate that roe is a negative modulator of N target gene expression. However, the effects of Roe are only partial when compared with N. For example, full activation of N leads to complete abolishment of photoreceptor recruitment (see Fig. 5F, for example), whereas roe-null (rn16) clones show a reduced number of photoreceptors per ommatidium (Fig. 1D,E). These data suggest that Roe functions as a negative-feedback modulator rather than as a core component of the N pathway.
Importantly, loss- and gain-of-function experiments with N and
Dl show that roe expression is under the control of N
signaling, defining a new self-regulatory feedback loop. Sequence analysis
demonstrates that four high-affinity Su(H)-binding sites exist in the introns
of the rn/roe gene and one of them lies within 1 kb of the
roe transcriptional start site
(Berman et al., 2004
). We thus
propose a model where N self-modulates its activity at the level of target
gene expression by activating roe expression, which, in turn,
represses expression of N target genes during ommatidial patterning.
The transcriptional repressor Roe functions in parallel to Su(H) action
Our results demonstrate that Roe can bind directly to DNA both in vitro and
in vivo. This binding is independent of Su(H), as no difference in DNA-binding
ability of either of these transcription factors was detected in the presence
of the other. However, the DNA-binding specificity of Roe remains unclear.
EMSA analysis shows that multiple binding sites exist in
E(spl)m
regulatory sequences. Sequence comparison among the
different fragments used (Fig. S2 in the supplementary material) did not
identify a consensus binding site. This suggests that Roe displays low binding
specificity to DNA in vitro. Thus, higher specificity as evident in vivo must
be achieved through interactions of Roe with other DNA-binding transcription
factors and/or transcriptional co-factors.
|
How does Roe fit into this scenario? First, activation of N-signaling
upregulates Roe expression. Roe in turn binds to the regulatory sequences of
specific target genes in the vicinity of the Su(H) complex and antagonizes its
activity. Through this mechanism, N signaling cannot only turn an off-state
into an on-state [via Su(H)], but can also regulate the activity levels of
this switch (via Roe). In this model, a target gene is activated less in the
presence of Roe than it is in its absence, although it is generally on
(Fig. 6E). Roe could also
affect the turnover of Su(H) on the DNA. Recent studies have shown that the
nuclear translocation of Nintra not only causes the switch from a
repression to an activation complex, but also affects the Su(H) binding
turnover at the DNA. In the presence of Nintra, Su(H) occupancy of
target binding sites is higher than in its absence, suggesting that Su(H)
binds dynamically to DNA (Krejci and Bray,
2007
). Further studies will be required to precisely assess the
role of Roe in N target repression.
The fact that Roe can bind to regulatory sequences independently of the
core N-transcriptional machinery raises the interesting possibility of
differential target-specific modulation. This mode of regulation is
particularly useful in the fine control of multiple cellular outcomes elicited
by a single signaling pathway, as is the case of N in the developing eye. In
this regard, in a roe loss-of-function background, we observed
upregulated expression of the N-target genes of the E(spl)-C,
involved in ommatidial assembly; by contrast, we did not observe any effect on
the N-target CyclinA, which is required in interommatidial cells to
control proliferation (not shown) (Baonza
and Freeman, 2005
).
Rn and Roe: one gene with two isoforms and two functions
The Roe and Rn isoforms of the rn gene share the last 450
C-terminal residues, including five of the six Zn fingers. However, rescue
experiments performed in previous studies show they are not functionally
interchangeable (St Pierre et al.,
2002
). Studies on the function of the Rn isoform during wing
development have shown that it is required for hinge development, without any
relationship to N signaling regulation
(del Alamo et al., 2002
). Our
data and these previous studies indicate that Roe is a transcriptional
repressor, whereas Rn is likely to function as an activator
(Terriente Felix et al.,
2007
). The rn gene is thus a notable example of how
functional diversification can be achieved during evolution by domain swapping
among proteins through alternative splicing and promoter usage.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/17/2895/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1995). Current Protocols in Molecular Biology. New York, NY: John Wiley and Sons.
Baonza, A. and Freeman, M. (2005). Control of cell proliferation in the Drosophila eye by Notch signaling. Dev. Cell 8,529 -539.[CrossRef][Medline]
Basler, K. and Struhl, G. (1994). Compartment boundaries and the control of Drosophila limb pattern by Hedgehog protein. Nature 368,208 -214.[CrossRef][Medline]
Berman, B. P., Pfeiffer, B. D., Laverty, T. R., Salzberg, S. L., Rubin, G. M., Eisen, M. B. and Celniker, S. E. (2004). Computational identification of developmental enhancers: conservation and function of transcription factor binding-site clusters in Drosophila melanogaster and Drosophila pseudoobscura. Genome Biol. 5,R61 .[CrossRef][Medline]
Bray, S. J. (2006). Notch signalling: a simple pathway becomes complex. Nat. Rev Mol. Cell. Biol. 7, 678-689.[CrossRef][Medline]
Cagan, R. L. and Ready, D. F. (1989). Notch is
required for successive cell decisions in the developing Drosophila retina.
Genes Dev. 3,1099
-1112.
Castro, B., Barolo, S., Bailey, A. M. and Posakony, J. W.
(2005). Lateral inhibition in proneural clusters: cis-regulatory
logic and default repression by Suppressor of Hairless.
Development 132,3333
-3344.
Cooper, M. T. and Bray, S. J. (1999). Frizzled regulation of Notch signalling polarizes cell fate in the Drosophila eye. Nature 397,526 -530.[CrossRef][Medline]
Cooper, M. T. and Bray, S. J. (2000). R7 photoreceptor specification requires Notch activity. Curr. Biol. 10,1507 -1510.[CrossRef][Medline]
Cooper, M. T., Tyler, D. M., Furriols, M., Chalkiadaki, A., Delidakis, C. and Bray, S. (2000). Spatially restricted factors cooperate with notch in the regulation of Enhancer of split genes. Dev. Biol. 221,390 -403.[CrossRef][Medline]
Daga, A., Karlovich, C. A., Dumstrei, K. and Barnejee, U.
(1996). Patterning of cells in the Drosophila eye by Lozenge,
which shares homologous domains with AML1. Genes Dev.
10,1194
-1205.
de Celis, J. F., Tyler, D. M., de Celis, J. and Bray, S. J. (1998). Notch signalling mediates segmentation of the Drosophila leg. Development 125,4617 -4626.[Abstract]
del Alamo, D. and Mlodzik, M. (2006). Frizzled/PCP-dependent asymmetric neuralized expression determines R3/R4 fates in the Drosophila eye. Dev. Cell 11,887 -894.[CrossRef][Medline]
del Alamo, D., Terriente, J., Galindo, M. I., Couso, J. P. and
Diaz-Benjumea, F. J. (2002). Different mechanisms initiate
and maintain wingless expression in the Drosophila wing hinge.
Development 129,3995
-4004.
Delaney, J. R., Stoven, S., Uvell, H., Anderson, K. V., Engstrom, Y. and Mlodzik, M. (2006). Cooperative control of Drosophila immune responses by the JNK and NF-kappaB signaling pathways. EMBO J. 25,3068 -3077.[CrossRef][Medline]
Doherty, D., Jan, L. Y. and Jan, Y. N. (1997). The Drosophila neurogenic gene big brain, which encodes a membrane-associated protein, acts cell autonomously and can act synergistically with Notch and Delta. Development 124,3881 -3893.[Abstract]
Doroquez, D. B. and Rebay, I. (2006). Signal integration during development: mechanisms of EGFR and Notch pathway function and cross-talk. Crit. Rev. Biochem. Mol. Biol. 41,339 -385.[CrossRef][Medline]
Fanto, M. and Mlodzik, M. (1999). Asymmetric Notch activation specifies photoreceptors R3 and R4 and planar polarity in the Drosophila eye. Nature 397,523 -526.[CrossRef][Medline]
Fanto, M., Weber, U., Strutt, D. I. and Mlodzik, M. (2000). Nuclear signaling by Rac and Rho GTPases is required in the establishment of epithelial planar polarity in the Drosophila eye. Curr. Biol. 10,979 -988.[CrossRef][Medline]
Fleming, R. J., Purcell, K. and Artavanis-Tsakonas, S. (1997). The NOTCH receptor and its ligands. Trends Cell. Biol. 7,437 -441.[CrossRef][Medline]
Flores, G. V., Duan, H., Yan, H., Nagaraj, R., Fu, W., Zou, Y., Noll, M. and Barnejee, U. (2000). Combinatorial signaling in the specification of unique cell fates. Cell 103, 75-85.[CrossRef][Medline]
Fortini, M. E., Rebay, I., Caron, L. A. and Artavanis-Tsakonas, S. (1993). An activated Notch receptor blocks cell-fate commitment in the developing Drosophila eye. Nature 365,555 -557.[CrossRef][Medline]
Freeman, M. (1994). Misexpression of the Drosophila argos gene, a secreted regulator of cell determination. Development 120,2297 -2304.[Abstract]
Freeman, M. (1996). Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophila eye. Cell 87,651 -660.[CrossRef][Medline]
Fu, W. and Noll, M. (1997). The Pax2 homolog
sparkling is required for development of cone and pigment cells in the
Drosophila eye. Genes Dev.
11,2066
-2078.
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan, Y. N. (1994). Atonal is the proneural gene for Drosophila photoreceptors. Nature 369,398 -400.[CrossRef][Medline]
Jimenez, G. and Ish-Horowicz, D. (1997). A chimeric enhancer-of-split transcriptional activator drives neural development and achaete-scute expression. Mol. Cell. Biol. 17,4355 -4362.[Abstract]
Kao, H. Y., Ordentlich, P., Koyano-Nakagawa, N., Tang, Z.,
Downes, M., Kintner, C. R., Evans, R. M. and Kadesch, T.
(1998). A histone deacetylase corepressor complex regulates the
Notch signal transduction pathway. Genes Dev.
12,2269
-2277.
Kopan, R. (2002). Notch: a membrane-bound
transcription factor. J. Cell Sci.
115,1095
-1097.
Krejci, A. and Bray, S. (2007). Notch
activation stimulates transient and selective binding of Su(H)/CSL to target
enhancers. Genes Dev.
21,1322
-1327.
Kumar, J. P. and Moses, K. (2001). The EGF
receptor and notch signaling pathways control the initiation of the
morphogenetic furrow during Drosophila eye development.
Development 128,2689
-2697.
Lai, E. C. (2004). Notch signaling: control of
cell communication and cell fate. Development
131,965
-973.
Lai, E. C. and Rubin, G. M. (2001). Neuralized
is essential for a subset of Notch pathway-dependent cell fate decisions
during Drosophila eye development. Proc. Natl. Acad. Sci.
USA 98,5637
-5642.
Lecourtois, M. and Schweisguth, F. (1995). The
neurogenic suppressor of hairless DNA-binding protein mediates the
transcriptional activation of the enhancer of split complex genes triggered by
Notch signaling. Genes Dev.
9,2598
-2608.
Li, Y. and Baker, N. E. (2001). Proneural enhancement by Notch overcomes Suppressor-of-Hairless repressor function in the developing Drosophila eye. Curr. Biol. 11,330 -338.[CrossRef][Medline]
Logeat, F., Bessia, C., Brou, C., LeBail, O., Jarriault, S.,
Seidah, N. G. and Israel, A. (1998). The Notch1 receptor is
cleaved constitutively by a furin-like convertase. Proc. Natl.
Acad. Sci. USA 95,8108
-8112.
Miller, D. T. and Cagan, R. L. (1998). Local induction of patterning and programmed cell death in the developing Drosophila retina. Development 125,2327 -2335.[Abstract]
Moloney, D. J., Panin, V. M., Johnston, S. H., Chen, J., Shao, L., Wilson, R., Wang, Y., Stanley, P., Irvine, K. D., Haltiwanger, R. S. et al. (2000). Fringe is a glycosyltransferase that modifies Notch. Nature 406,369 -375.[CrossRef][Medline]
Nagel, A. C., Krejci, A., Tenin, G., Bravo-Patino, A., Bray, S.,
Maier, D. and Preiss, A. (2005). Hairless-mediated repression
of notch target genes requires the combined activity of Groucho and CtBP
corepressors. Mol. Cell. Biol.
25,10433
-10441.
Nellesen, D. T., Lai, E. C. and Posakony, J. W. (1999). Discrete enhancer elements mediate selective responsiveness of Enhancer of split Complex genes to common transcriptional activators. Dev. Biol. 213, 33-53.[CrossRef][Medline]
Okajima, T. and Irvine, K. D. (2002). Regulation of notch signaling by o-linked fucose. Cell 111,893 -904.[CrossRef][Medline]
Pan, D. and Rubin, G. M. (1997). Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell 90,271 -280.[CrossRef][Medline]
Rusconi, J. C., Hays, R. and Cagan, R. L. (2000). Programmed cell death and patterning in Drosophila. Cell Death Differ. 7,1063 -1070.[CrossRef][Medline]
Selkoe, D. and Kopan, R. (2003). Notch and Presenilin: regulated intramembrane proteolysis links development and degeneration. Annu. Rev. Neurosci. 26,565 -597.[CrossRef][Medline]
Simpson, P. (1997). Notch signaling in development: on equivalence groups and asymmetric developmental potential. Curr. Opin. Genet. Dev. 7, 537-542.[CrossRef][Medline]
St Pierre, S. E., Galindo, M. I., Couso, J. P. and Thor, S.
(2002). Control of Drosophila imaginal disc development by rotund
and roughened eye: differentially expressed transcripts of the same gene
encoding functionally distinct zinc finger proteins.
Development 129,1273
-1281.
Sun, Y., Jan, L. Y. and Jan, Y. N. (1998). Transcriptional regulation of atonal during development of the Drosophila peripheral nervous system. Development 125,3731 -3740.[Abstract]
Terriente Felix, J., Magarinos, M. and Diaz-Benjumea, F. J.
(2007). Nab controls the activity of the zinc-finger
transcription factors Squeeze and Rotund in Drosophila development.
Development 134,1845
-1852.
Van Vactor, D. L., Jr, Cagan, R. L., Kramer, H. and Zipursky, S. L. (1991). Induction in the developing compound eye of Drosophila: multiple mechanisms restrict R7 induction to a single retinal precursor cell. Cell 67,1145 -1155.[CrossRef][Medline]
Wallberg, A. E., Pedersen, K., Lendahl, U. and Roeder, R. G.
(2002). p300 and PCAF act cooperatively to mediate
transcriptional activation from chromatin templates by notch intracellular
domains in vitro. Mol. Cell. Biol.
22,7812
-7819.
Wilson, J. J. and Kovall, R. A. (2006). Crystal structure of the CSL-Notch-Mastermind ternary complex bound to DNA. Cell 124,985 -996.[CrossRef][Medline]
Wolff, T. and Ready, D. F. (1993). Pattern formation in the Drosophila retina. In The Development of Drosophila melanogaster (ed. M. Bate and A. Martinez-Arias), pp. 1277-1326. Cold Spring Harbor, NY: Cold Spring Harbor Press.
Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117,1223 -1237.[Abstract]
Zhou, S., Fujimuro, M., Hsieh, J. J., Chen, L., Miyamoto, A.,
Weinmaster, G. and Hayward, S. D. (2000). SKIP, a
CBF1-associated protein, interacts with the ankyrin repeat domain of NotchIC
To facilitate NotchIC function. Mol. Cell. Biol.
20,2400
-2410.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||