|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 6 August 2008
doi: 10.1242/dev.022202
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Developmental Skin Biology Unit, NIAMS, National Institutes of Health,
Bethesda, MD 20892, USA.
2 Department of Dermatology and Cell and Developmental Biology, University of
Pennsylvania School of Medicine, Philadelphia, PA 19104, USA.
* Author for correspondence (e-mail: morassom{at}mail.nih.gov)
Accepted 16 July 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Dlx3, Hair cycle, Homeobox, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Mikkola and Millar,
2006). A series of signaling molecules is involved in each step of
primary hair development and differentiation. Wnt signaling is crucial for the
initiation of hair follicle (hf) development
(Andl et al., 2002), and Shh
controls proliferation of the epithelial hair germ
(Chiang et al., 1999). Noggin,
BMP and ectodysplasin (Eda) signaling play important roles at early stages of
hf placode development (Botchkarev et al.,
1999; Mou et al.,
2006; Schmidt-Ullrich et al.,
2006; Pummila et al.,
2007). The dermal papilla (DP) remains associated with the
overlying epithelial matrix cells, which undergo an upward differentiation
process to give rise to the different hf lineages such as the medulla, cortex
and cuticle of the hair shaft and the inner root sheath (IRS)
(Millar, 2002;
Fuchs, 2007). The matrix is
derived from epithelial stem cells located in the bulge region of the hf
(Cotsarelis et al., 1990;
Taylor et al., 2000;
Oshima et al., 2001;
Levy et al., 2005). Several
important pathways and transcription factors that initiate and promote
differentiation of the matrix cells have been determined, including Gata3 and
Cutl [which regulate IRS differentiation
(Ellis et al., 2001;
Kaufman et al., 2003;
Kurek et al., 2007)] and BMP
signaling, and transcription factors such as Msx2, Foxn1 and Hoxc13 that are
required for hair shaft differentiation
(Godwin and Capecchi, 1998;
Meier et al., 1999;
Kulessa et al., 2000;
Tkatchenko et al., 2001;
Ma et al., 2003;
Johns et al., 2005).
After early follicle morphogenesis, the hf undergoes cyclic transformations
known as anagen (growth phase), catagen (regression) and telogen (resting
phase), allowing the study of essential stages of proliferation and
differentiation (Schmidt-Ullrich and Paus,
2005). Cyclical renewal of the hair is thought to recapitulate
some of the signaling and control mechanisms found between the DP and
overlying epithelial cells during the embryonic onset of hair formation
(Oliver and Jahoda, 1988;
Hardy, 1992;
Schmidt-Ullrich and Paus,
2005).
Several of the transcription factors with distinct and important roles in
the developing hf are homeobox-containing proteins such as Msx2, Lhx2 and
Hoxc13 (Godwin and Capecchi,
1998; Tkatchenko et al.,
2001; Ma et al.,
2003; Rhee et al.,
2006). Homeodomain transcription factors play crucial roles in
many developmental processes, ranging from organization of the body plan to
differentiation of individual tissues. Dlx3 belongs to the Dlx family of
homeodomain transcription factors (Dlx1-6). In the genome, they are organized
into three pairs of inverted, convergently transcribed genes, termed
Dlx1-2, Dlx3-4 and Dlx5-6
(Morasso and Radoja,
2005).
Dlx3 has an essential role in epidermal, osteogenic and placental
development (Morasso et al.,
1996; Morasso et al.,
1999; Beanan and Sargent,
2000; Hassan et al.,
2004). Importantly, an autosomal dominant mutation in DLX3 is
responsible for the ectodermal dysplasia termed Tricho-Dento-Osseous syndrome
(TDO), which is characterized by defects in teeth and bone development, and
abnormalities in hair shaft morphology and diameter
(Price et al., 1998;
Wright et al., 2008). Despite
strong evidence suggesting a major role for Dlx3 in epithelial appendage and
hf development, early lethality of loss-of-function mutants have precluded the
analysis of the specific function of Dlx3 in these processes
(Morasso et al., 1999). Taking
advantage of a Dlx3Kin/+ line that has the β-galactosidase
(lacZ) gene inserted into the Dlx3 locus, we present a
thorough analysis of the broad Dlx3 expression during the hair cycle. Using a
K14cre line that expresses the Cre recombinase in epidermal cells and their
derivatives (Andl et al.,
2004), and a floxed Dlx3 line, we determined the role of Dlx3 in
hair development by epidermal-specific ablation. The most striking defects in
the conditional knockout mice were complete alopecia owing to a failure in hf
development, concomitant with lack of expression of transcriptional regulators
necessary for the differentiation of the IRS and hair shaft, and inability to
undergo cyclic regeneration postnatally. Our results demonstrate that loss of
ectodermal Dlx3 leads to altered morphogenesis, differentiation and cycling of
the hfs. Taken together with the pathological conditions of individuals with
TDO, these results establish Dlx3 as a crucial regulator of hair
development.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Genotype of the Dlx3Kin/+ mouse line was determined by Southern blot analysis and PCR (Fig. 1A). Three oligonucleotides were used for the genotyping by PCR: PCRforward Dlx3Kin/+ primer (GGGTCTTTGCCACTTTCTGTCTGTCATTTGCATAGA) is located 449 bp upstream from the transcription start site of the Dlx3 gene; for determination of the wild-type allele, we utilized PCRreverse1 Dlx3Kin/+ (CCTGCGAGCCCATTGAGATTGAACTGGTGGTGGTAG), which is located 432 bp downstream from the transcription start site located on Exon 1, and generates a 880 bp fragment; and for the determination of the lacZ knock-in allele, we used PCRforward Dlx3Kin/+ primer (same as above) and PCRreverse2 Dlx3Kin/+ (TGAAACGCTGGGCAATATCGCGGCTCAGTTCG) located 280 bp downstream from the transcription start site of lacZ gene and generates a 730 bp fragment. The cycling conditions were: 94°C for 5 minutes followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 72°C for 1 minute.
For the Dlx3f/f line, recombination was determined by Southern
blot (Fig. 3A). For the
epidermal-specific ablation of Dlx3, we used a K14cre line that has been
previously characterized (Andl et al.,
2004). The Cre-mediated deletion of Dlx3 to generate the
K14cre;Dlx3Kin/f or K14cre;Dlx3f/f was assessed by PCR
with the following oligonucleotides: PCRforward Dlx3Kin/+ primer
and PCRreverse-cre primer (TGTAAGGTGTGTCATTTTCCTCAACGGGTG) generating a 2.15
kb fragment (Fig. 3C). The
cycling conditions were: 94°C for 5 minutes followed by 35 cycles of
94°C for 30 seconds, 60°C for 30 seconds and 68°C for 4 minutes.
Throughout this study, the K14cre;Dlx3Kin/f or
K14cre;Dlx3f/f lines were analyzed obtaining similar results. All
animal work was approved by the NIAMS Animal Care and Use Committee.
X-gal staining and treatment with benzyl-benzoate/benzyl alcohol
X-gal staining of Dlx3Kin/+ whole embryos or individual
dissected organs was performed with 1 mg/ml
5-Br-4-Cl-3-indolyl-β-D-galactosidase (X-gal), 5 mM potassium
ferricyanide, 5 mM potassium ferrocyanide and 2 mM MgCl2 in PBS and
the detergent NP-40 (0.02%). Samples were fixed at 4°C in 4%
paraformaldehyde/PBS. X-gal stained Dlx3Kin/+ embryos were cleared
by treatment with benzyl-benzoate/benzyl alcohol 2:1 mixture after dehydration
in methanol.
Histology, immunofluorescence and confocal microscopy
Skin sections (10 µm) were stained with either primary antibodies
overnight at 4°C for immunofluorescent staining or Hematoxylin/Eosin. The
antibodies and dilutions used were anti-Dlx3 (1:250, Morasso Laboratory)
(Bryan and Morasso, 2000),
anti-β-galactosidase (1:250, Abcam), anti-PCNA (1:100, Calbiochem),
anti-β-catenin (1:200, Sigma), anti-Phospho-Smad1/5/8 (1:50, Cell
Signaling Technology), anti-Lef1 (1:100, Cell Signaling Technology),
anti-Hoxc13 (1:50, Novus Biologicals), anti-Gata3 (1:100, Santa Cruz),
anti-AE13 (type I hair keratin, 1:10, gift from T. T. Sun), anti-AE15
(trichohyalin, 1:10, gift from T. T. Sun), anti-adipophilin (1:100,
Fitzgerald), anti-K1 (1:500, Covance), anti-K10 (1:500, Covance), anti-K15
(1:100, Thermo Scientific), anti-K17 (1:1000, gift from P. Coulombe), anti-K35
(previous nomenclature Ha5) and anti-K85 (previous nomenclature Hb5) (1:50,
Progen) and secondary antibodies: Alexa Fluor 488 or Alexa Fluor 546 goat
anti-mouse, rabbit, chicken or guinea pig IgG (1:250, Molecular Probes). MOM
immunodetection kit and antigen unmasking solutions (Vector Laboratories) were
used to reduce background staining if applicable. The slides were mounted with
Vector Shield (Vector Laboratories) and examined using laser-scanning confocal
microscope 510 Meta (Zeiss).
Hair follicle cell preparation and western blot analysis
Primary mouse hf cells were isolated from the dermis of mouse skins by
Ficoll density gradient centrifugation after treatment with collagenase 0.35%
and DNase 250 units/ml. Protein samples from hf cells were subjected to
western blot analysis. The antibodies and dilutions used: anti-Dlx3 (1:1000,
Morasso laboratory), anti-K35 (1:1000, Progen) and anti-
-tubulin
(1:2000, Abcam). The immunoreactive proteins were detected using the
horseradish peroxidase-linked secondary antibody (Vector Laboratories).
Cloning, cell culture, transfection and reporter assays
The -1055 to +134 bp DNA fragment of the K35 promoter was inserted into the
pGL3-Basic vector (Promega). Site-directed mutations of putative Dlx3 binding
sites on the K35 promoter were performed using the ExSitePCR-based
site-directed mutagenesis kit (Stratagene). The V5-tagged Dlx3 was cloned into
the pCI-neo vector (Promega).
Transformed PAM212 mouse keratinocytes
(Yuspa et al., 1980) were
co-transfected with 1 µg of each construct using FuGENE 6 transfection
reagent (Roche) (Hwang et al.,
2007). Luciferase activity was measured 24-36 hours after the
transfection using the Dual-Luciferase Reporter Assay System (Promega). The
pRL-TK vector was also co-transfected as an internal control for the assay.
Each transfection was carried out in duplicate and the experiment was repeated
three times.
Chromatin immunoprecipitation (ChIP) assays
Primary mouse hf cells or transfected hf cells with pCI-neo-V5-Dlx3
construct were used for ChIP assays
(Radoja et al., 2007).
Chromatin was incubated with control anti-mouse IgG, anti-Lef1, anti-Dlx3
(Abnova) or anti-V5 antibody (Serotec) overnight at 4°C. The samples were
eluted after washing and PCR reactions were performed by sets of specific
primers: hair keratin K32 (previous nomenclature Ha2),
GGCAACACAGGACAGGCTATGGCAG (forward), CATGGGGGAGTGTTGATGTTTATACTTGGCCCC
(reverse); hair keratin K35, ACGGGGCTTCTGTTTTACGAGGCCGG (forward),
CCCTAGCCCGACTTTATACTTCTGCCCCA (reverse); Hoxc13, GTTAGGG
GAGGGGGGCAGAGAGGCTTAATTTGG (forward), TACCGAAGTCTCTAAATTGGGGCTTGG (reverse);
Dlx3, GTGTGTGTGTGTGTGTGTGTGTGTGTATTAGGGGTA (forward),
CGTGCCTCTCTCCGCGTCCCAAGCCACAGTCAAATG (reverse); GAPDH, TACTAGCGGTTTTACGGGCG
(forward), TCGAACAGGAGGAGCAGAGAGCGA (reverse).
Electrophoretic mobility shift (EMSA) and supershift assays
EMSA was performed as described by Feledy et al.
(Feledy et al., 1999). For
supershift assays, primary mouse hf cells were isolated as described above.
Nuclear extracts were prepared according to the manufacturer's instructions
(Active Motif).
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Sumiyama et al., 2003) was
preserved with the targeting strategy used. Homozygous Dlx3Kin/Kin
mice recapitulate the early lethality previously reported for ablation of Dlx3
function in Dlx3-/- mice
(Morasso et al., 1999).
Heterozygous Dlx3Kin/+ mice were used for X-gal staining to reveal
the temporal and spatial expression of Dlx3. The hair cycle is an ideal system for studying the regulation of cell proliferation, differentiation and apoptosis in regenerative tissues. The hf is a prominent site of Dlx3 expression during hair development, shown by in situ hybridization (see Fig. S1 in the supplementary material) and visualized by lacZ detection in whole-mount and sections of embryos from Dlx3Kin/+ mice (Fig. 1B). Detailed analysis of Dlx3 expression throughout the hair cycle using an anti-Dlx3 antibody revealed expression in the hf matrix (Fig. 2A, P1). By the anagen stage (P9), Dlx3 expression extended to the inner root sheath (IRS) and hair-forming compartments, including cortex, medulla and cuticle. Nuclear Dlx3 expression persisted in the catagen follicle, and in the resting, telogen bulge (magnified image in Fig. 2A, P20). The domain of Dlx3 expression is cyclically re-expanded in the first post-natal hf growth cycle (Fig. 2A, P30). To assess the validity of using lacZ expression as readout of endogenous Dlx3 expression, we performed immunohistochemistry with antibodies against Dlx3 and lacZ on sections of P1 of Dlx3Kin/+ dorsal skin. As seen in Fig. 2B (top panel), the pattern of Dlx3 expression is virtually identical by detection with either anti-Dlx3 or anti-lacZ antibodies. The anti-lacZ used in these studies was generated in chicken, which gave versatility in the colocalization studies performed using antibodies raised in rabbit or mouse.
|
). Dlx3 was expressed in the hair matrix cells,
inner root sheath as well as in hair-forming compartments such as the cortex,
medulla and cuticle. The merged images confirmed that Dlx3 expression
encompasses areas of K35 and K85 expression, and is also present in the IRS,
which is K35/K85 negative (Fig.
2B).
Disrupted hf development in epidermal-Cre-mediated deletion of Dlx3
As Dlx3-/- mice die during embryogenesis, to understand
better the role of Dlx3 during development, we generated mice carrying a
floxed Dlx3 allele (Dlx3f/f)
(Fig. 3A). To assess the
specific functions of Dlx3 during epidermal development, we ablated Dlx3
expression in the skin by K14cre-mediated inactivation of the conditional Dlx3
allele generating K14cre;Dlx3Kin/f or K14cre;Dlx3f/f
lines. The K14cre line used has been previously characterized as showing
specific expression in the epidermis, hfs and oral epithelium
(Andl et al., 2004).
Specificity of expression was corroborated by crosses of the K14cre mice with
mice from the reporter Rosa26 line, which allows identification of cells
expressing Cre and their descendants by β-galactosidase staining
(Soriano, 1999). In this
study, mice from the Dlx3f/f and Dlx3Kin/f lines were
indistinguishable from wild-type mice. Mice from either
K14cre;Dlx3Kin/f or K14cre;Dlx3f/f lines gave the same
results. The role of Dlx3 was demonstrated by analyzing
K14cre;Dlx3Kin/f or K14cre;Dlx3f/f mice, where the most
noticeable deficiency was complete absence of hair
(Fig. 3B). These mutant mice
showed aberrant growth and weight loss, and complete and permanent
alopecia.
The specificity of Cre-mediated recombination in skin was determined by PCR and western blot analysis (Fig. 3C,D). Western blots were performed with hf extracts from P12 skin, and verified absence of Dlx3 protein in the K14cre;Dlx3Kin/f hf. Immunofluorescence with anti-Dlx3 demonstrated specific and complete recombination in K14cre;Dlx3Kin/f mice, where no expression of Dlx3 was detected (Fig. 3E), demonstrating efficient K14 Cre-mediated deletion of the Dlx3 floxed allele.
To perform a thorough analysis of the defects in hair development and cycling in the K14cre;Dlx3Kin/f mice, dorsal skin samples were collected from mutant and wild-type littermates at 1, 5, 9, 12, 15, 18, 20 and 26 day(s) (P1 through P26), 13 weeks and 26 weeks after birth, sectioned and stained with Hematoxylin/Eosin (Fig. 4A; see Fig. S2A and Fig. S4 in the supplementary material, where the stages correspond as follows: P9-P12, late stages of postnatal hf morphogenesis; P15 catagen; P20 telogen; P26 first postnatal anagen). At P1, the K14cre;Dlx3Kin/f follicles appeared normal. Structural hf abnormalities were clearly observed by P5 in K14cre;Dlx3Kin/f mice (see Fig. S2A in the supplementary material). By P9, control hfs had formed large hair bulbs and differentiated hair shafts. By contrast, the mutant follicles had not developed hair bulbs and displayed morphologically abnormal undifferentiated shafts, with no apparent keratinized medulla. Dramatic defects in the inner root sheath and hair shaft of K14cre;Dlx3Kin/f hfs were observed by the end of the anagen phase at P12. By stage P15, utricles (cyst-like structures opening to the epidermis) and enlarged sebaceous glands developed in the upper part of the mutant hfs (Fig. 4A), and were still present at P18 (see Fig. S2A in the supplementary material). At this stage, the typical upward movement of the hair shaft and formation of the club structure in the upper hair bulb that characterized control follicles were not observed in the K14cre;Dlx3Kin/f follicles. Furthermore, the aberrant K14cre;Dlx3Kin/f hfs underwent an apparent regression by telogen phase P20, but no re-initiation of the hair cycle was observed by the first postnatal anagen at P26 or in samples from 13- and 26-week-old mutant skin (see Fig. S4 in the supplementary material).
|
We also performed immunohistochemistry with anti-K15 antibody to follow the
development of the bulge region, the location of the hf epithelial stem cells.
K15 is preferentially expressed in mouse bulge cells, with variable expression
in the immature mouse epidermis during the first few weeks after birth, and
anti-K15 antiserum may non-specifically label the sebaceous gland
(Liu et al., 2003). We observe
the predicted expression of K15 in wild-type hfs through the hair cycle, where
K15 is prominently detected in the hf bulge of the telogen follicles (see Fig.
S2B in the supplementary material). The expression pattern of K15 is present
in the K14cre;Dlx3Kin/f follicles through the hair cycle, and at
stages P15, P18 and P20 it is localized to the enlarged cyst-like structures.
However, K15 levels were somewhat diminished in the P26 bulge region of
K14cre;Dlx3Kin/f follicles when compared with wild-type
littermates.
In a few instances, abnormal detection of K1 and K10 expression was observed in the mutant follicles, suggesting a possible `epidermalization' of the hfs in the K14cre;Dlx3Kin/f mice. The expression of sebaceous cell marker, adipophilin was still maintained in mutant follicles although the area of staining became enlarged compared with controls (see Fig. S2C in the supplementary material).
Dlx3 is normally expressed in the differentiated layers of the epidermis
and we have previously shown that misexpression of Dlx3 in the basal
proliferative layer of the epidermis led to cessation of proliferation and
premature induction of terminal differentiation
(Morasso et al., 1996).
Histological analysis of K14cre;Dlx3Kin/f or
K14cre;Dlx3f/f stratified epidermis revealed that the epidermis
appears hyperplastic (Fig. 4C).
Immunochemical analysis using antibodies against PCNA and epidermal
differentiation markers such as K14 and K1 shows an increase in the number of
proliferative cells and thickening of the entire stratified epithelium, with
the underlying dermis also appearing thickened and hypercellular
(Fig. 4C). Taken together with
our previous report on Dlx3 misexpressing skin, these findings indicate that
the absence of a Dlx3-regulated differentiation signal might lead to epidermal
hyperplasia.
Dlx3 is an essential regulatory factor in the signaling pathway controlling hair development
To determine the role of Dlx3 in IRS and hair shaft differentiation, we
assessed by immunofluorescence the expression levels of established signaling
molecules and mediators such as Lef1, β-catenin and phospho-Smad1/5/8 in
K14cre;Dlx3Kin/f and control littermates
(Fig. 5A). The transcriptional
regulator Lef-1, and β-catenin, which localizes to the nucleus and
complexes with Lef1 to activate target genes, were analyzed as effectors of
the Wnt pathway. BMP signaling, assayed by staining for phospho-Smad1/5/8, is
normally expressed in differentiating hair matrix cells that give rise to the
IRS and hair shaft medulla, cortex and cuticle
(Andl et al., 2004). At P1,
detection of these factors was reduced, although it was present in the same
areas in mutant and control follicles. By P9, the expression of all factors
was reduced and altered. The expression of Lef1, although still present in the
K14cre;Dlx3Kin/f underdeveloped bulb matrix cells, was highly
diminished when compared with the control littermate hfs. This could be a
consequence of the underdevelopment of the hair bulb in the
K14cre;Dlx3Kin/f follicles (Fig.
5A). For β-catenin, expression was also reduced, although in
some cells still localized to the nucleus. The detection of phospho-Smad1/5/8
was seen in the differentiating matrix cells in the upper part of the
follicle, but no detection was found in the lower section of the
underdeveloped bulb region in the K14cre;Dlx3Kin/f follicles.
|
).
Analysis of the Dlx3 proximal promoter led to the identification of a putative
Lef1-binding motif (Fig. 5C).
To further investigate whether Dlx3 is a direct target of Lef1 regulation, we
performed chromatin immunoprecipitation (ChIP) with anti-Lef1 antibodies on
genomic DNA from primary mouse hfs. The results were normalized to IgG, and a
set of PCR primers for Gapdh was used to confirm the specificity of
immunoprecipitated genomic DNA (Fig.
5C). The PCR results verified that Lef1 binds the Dlx3 promoter in
vivo, demonstrating that Dlx3 is a potential immediate target of Lef1.
Dlx3 is a crucial regulator of transcriptional factors and hair keratin genes in hf development
To establish whether epidermal-specific Dlx3 deletion affects the
expression of hf differentiation markers and transcriptional regulators
necessary for the formation of the IRS and hair shaft, we studied the
expression of the following markers in skin samples at P1 and P9: the homeobox
transcription factor Hoxc13, which is expressed in the precortex, cuticle,
cortex and medulla; the transcriptional regulator Gata3, which is normally
expressed in the inner root sheath; the hair keratin marker AE13, which is
expressed in the hair shaft cortex and cuticle; and AE15 (trichohyalin), which
is expressed in the IRS and medulla. No detection of these proteins was found
in the K14cre;Dlx3Kin/f hfs during early stages of hair development
at P1, with significantly reduced expression at anagen stage P9 when compared
with wild-type littermates (Fig.
6A). Similar results were obtained by western blot using hf
extracts, where hair keratin K35 levels were highly decreased in the
K14cre;Dlx3Kin/f hfs at P10 (see Fig. S3A in supplementary
material). Our data indicate that Dlx3 is an essential regulator of Hoxc13,
Gata3, AE13 and AE15, and plays an indispensable role during normal hf
differentiation.
A conserved TAAT-motif was identified as a high-affinity binding site for
numerous homeodomain proteins (Desplan et
al., 1988). The Hoxc13 homeodomain protein is a regulator that
binds to TAAT motifs in the promoter regions of the hair keratin K32
(Krt32 - Mouse Genome Informatics; previously Ha2),
K35 (Krt35 - Mouse Genome Informatics; previously
Ha5) and K37 (Ha7) genes
(Jave-Suarez et al., 2002).
The Dlx3 consensus-binding motif has been established as TAATT
(Feledy et al., 1999), sharing
the preferred DNA-recognition core of many homeodomain proteins. Previous
studies have reported that the surrounding 5' and 3' base pairs of
the motif are important for selecting in vitro binding sites
(Svingen and Tonissen, 2003).
Competition binding assays (EMSA) were performed to compare specificity of the
binding of Dlx3 versus Hoxc13 in the motifs previously identified in the hair
keratin promoters (see Fig. S3B in the supplementary material). The sequence
and location of each putative binding site analyzed are indicated in Fig. S3C
in the supplementary material. The optimal consensus DNA-binding sequence for
Dlx3 (Feledy et al., 1999) was
32P-end-labeled, whereas putative Dlx3-binding sites derived from
the promoters of hair keratins and Hoxc13 genes were used as
unlabeled competitors. The consensus (Con) binding sequence for Dlx3 and
unspecific (Un) DNA were used as control competitors. Specific binding sites
for Dlx3 were identified in the promoter regions of hair keratins K32,
K35 and K37 genes. Several of these sites in the hair keratin
promoters had been previously described as Hoxc13-binding sites. We also
examined the ability of Dlx3 to bind to TAAT-motifs present in the proximal
promoter of Hoxc13 gene. EMSA and competition assays indicated that
Dlx3 strongly bound to a motif present 
600 bp upstream of the
transcriptional start site of Hoxc13 (between -564 and -599bp). These in vitro
results support the role of Dlx3 as an immediate upstream regulator of Hoxc13
and hair keratins.
|
|
Dlx3 is essential for the cyclic postnatal regeneration of the hf
An important finding in our studies on K14cre;Dlx3Kin/f mutants
is that ablation of epidermal Dlx3 leads to inability to re-initiate the hf
growth cycle postnatally (Fig.
4), where the inability to initiate the first postnatal anagen
might be due to the lack of Dlx3 function and, in addition, to altered
responsiveness of the abnormal hf.
Stimulation of hf stem cell proliferation at anagen onset is thought to
involve suppression of BMP signaling, and activation of the Wnt/β-catenin
pathway (Plikus et al., 2008).
Consistent with this report, deletion of Bmpr1a causes upregulated stem cell
proliferation, as well as failure of hf differentiation, whereas activation of
β-catenin signaling promotes anagen onset
(Kobielak et al., 2003;
Van Mater et al., 2003;
Andl et al., 2004;
Kobielak et al., 2007). To
address the underlying mechanisms responsible for the failure of anagen onset
in the Dlx3 mutant, we performed immunohistochemical analysis with antibodies
against the Wnt transcriptional effector Lef1 and phospho-Smad1/5/8 on skin
sections at P18, P20 and P26 (Fig.
7A). Mutant hf epithelial cells displayed nuclear Lef1 expression,
but a complete absence of phospho-Smad1/5/8 at all of these stages. These data
suggest that Dlx3 might be required for BMP signaling in telogen as well as
early anagen, and that the continual proliferation observed in mutant ORS
cells in catagen and telogen may be due in part to absence of BMP
signaling.
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). In this model, cells from the upper internal ORS directly
give rise to the medulla and cortex, while the keratin-free germinal matrix
compartment (GMC) contains amplifying cells that differentiate into the IRS
and cuticle (Langbein and Schweizer,
2005). As embryonic hf morphogenesis reaches completion (P9),
expression of the homeobox transcription factor Hoxc13 is detected in the
hair-shaft forming compartments of the matrix, cuticle, cortex and medulla
(Godwin and Capecchi, 1998;
Langbein and Schweizer, 2005;
Potter et al., 2006). Hoxc13
directly regulates expression of the hair keratin genes such as K32,
K35 and K37, and of the transcription factor Foxq1
(Jave-Suarez et al., 2002;
Potter et al., 2006), with its
role in hair development being supported by the findings that ablation or
overexpression of Hoxc13 in differentiating keratinocytes results in a
hairless phenotype (Godwin and Capecchi,
1998; Tkatchenko et al.,
2001). However, little is known about upstream regulation of
Hoxc13 expression. Here, we demonstrate that Hoxc13 is a target of Dlx3 in the
transcriptional control of hair shaft development. Furthermore, microarray
analysis of RNA derived from mouse skin samples has shown that Dlx3 is part of
a gene expression network that includes the transcription factor Hoxc13 and
many of the hf keratin genes (A. Balmain, personal communication). Other
transcription factors such as Gata3 are required for proper differentiation of
the IRS (Kaufman et al., 2003;
Kurek et al., 2007). We find
that the mutant K14cre;Dlx3Kin/f hfs have significantly reduced
levels of Gata3. Based on Dlx3 expression in the IRS and in hair-shaft forming compartments of the matrix, cuticle, cortex and medulla, on the ability of Dlx3 to directly regulate hair keratins and Hoxc13, and on the reduced expression of Gata3 in the mutant IRS, we propose a model in which Dlx3 acts as a crucial controller of follicle differentiation (Fig. 7B).
|
).
The Wnt/β-catenin pathway is required for hf morphogenesis and
differentiation (Gat et al.,
1998; Millar et al.,
1999; Huelsken and Birchmeier,
2001; Huelsken et al.,
2001; Andl et al.,
2002; Narhi et al.,
2008), and Smad7-induced β-catenin degradation disrupts hf
development (Han et al.,
2006). In this study, we show that Dlx3 is a direct target of Lef1 regulation. During hair morphogenesis, Lef1 and Dlx3 expression overlap in the precortical region at early anagen (Fig. 5B). By full anagen, Dlx3 is expressed primarily in the differentiating parts of hf such as hair shaft and inner root sheath, whereas Lef1 expression is closer to the dermal papilla in the developed hair bulb (Fig. 5A). Our results show that mutant K14cre;Dlx3Kin/f hfs have diminished and aberrant Lef1 expression, which is maintained in the differentiating matrix and IRS cells, but is completely abolished in the GMC of the underdeveloped bulbs. We propose that as a direct target of Lef1, Dlx3 is an early effector of the Wnt signaling pathway in matrix cells that have migrated from the GMC and started differentiating to form the IRS and hair shaft lineages. In the absence of Dlx3, this differentiation process does not proceed, consistent with known roles of Dlx3 in directing cells to differentiate.
Our results also show colocalization of phospho-Smad1/5/8 and Dlx3, which
is consistent with a regulatory role of BMP signaling of Dlx3. Previous
results have shown Dlx3 to be a direct target of BMP signaling
(Luo et al., 2001;
Park and Morasso, 2002;
Hassan et al., 2004). However,
by stages P18, P20 and P26, phospho-Smad1/5/8 staining is absent from the hair
matrix and bulge region of the Dlx3 mutant follicles, indicating that BMP
signaling is disrupted during hair regression and regeneration
(Fig. 7).
Essential role of Dlx3 during re-initiation for cycling in first postnatal anagen
Regenerating hfs are derived from a reservoir of stem cells in the bulge,
the progeny of which migrate and will generate the distinct hf cell lineages.
A recent study has demonstrated that cyclic dermal BMPs control hf epithelial
stem cell activation, with high levels of BMP signaling being associated with
the resting non-proliferative phase of hf growth cycle
(Plikus et al., 2008).
Furthermore, BMP signaling within the DP appears to be important in
instructing the bulge stem cells to initiate the next cycle of hf formation
(Rendl et al., 2008). An
important finding in our study is that epithelial Dlx3 ablation leads to
persistent proliferation in the regressing hf and in the inability of the hf
to re-initiate the first postnatal anagen, despite expression of Lef1 and K15.
Significantly, active BMP signaling is completely absent in mutant follicles
at these stages, suggesting that persistent proliferation may be due in part
to lack of BMP signaling. Altogether, our data support a model where Dlx3 and
BMP may act in a positive-feedback loop in a specific subset of follicle
cells. This is suggestive of the feedback loop between BMP4 and the Msx1
homeobox gene during early tooth development
(Tucker and Sharpe, 2004).
Another homeodomain Lhx2 is expressed in the postnatal bulge compartment,
and studies show that Lhx2 functions to specify and maintain the hf stem cell
character but not their differentiation
(Rhee et al., 2006). It is
plausible that Dlx3 expression in the telogen bulge region plays an important
role in the stem cell differentiation, in contrast to the role of Lhx2 in
maintaining the undifferentiated state. As the follicles do not appear to have
entered a normal telogen phase, subsequent phenotypic abnormalities might
reflect not only any effects of Dlx3 deficiency on anagen induction, but also
the altered responsiveness of an abnormal hf. Altogether, these important
findings show that in the absence of Dlx3-coordinated differentiation, the new
anagen phase cannot be initiated.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/18/3149/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Andl, T., Reddy, S. T., Gaddapara, T. and Millar, S. E.
(2002). WNT signals are required for the initiation of hair
follicle development. Dev. Cell
2, 643-653.[CrossRef][Medline]
Andl, T., Ahn, K., Kairo, A., Chu, E. Y., Wine-Lee, L., Reddy,
S. T., Croft, N. J., Cebra-Thomas, J. A., Metzger, D., Chambon, P. et al.
(2004). Epithelial Bmpr1a regulates differentiation and
proliferation in postnatal hair follicles and is essential for tooth
development. Development
131,2257
-2268.
Beanan, M. J. and Sargent, T. D. (2000).
Regulation and function of Dlx3 in vertebrate development. Dev.
Dyn. 218,545
-553.[CrossRef][Medline]
Botchkarev, V. A., Botchkareva, N. V., Roth, W., Nakamura, M.,
Chen, L. H., Herzog, W., Lindner, G., McMahon, J. A., Peters, C., Lauster, R.
et al. (1999). Noggin is a mesenchymally derived stimulator
of hair-follicle induction. Nat. Cell Biol.
1, 158-164.[CrossRef][Medline]
Bryan, J. T. and Morasso, M. I. (2000). The
Dlx3 protein harbors basic residues required for nuclear localization,
transcriptional activity and binding to Msx1. J. Cell
Sci. 113,4013
-4023.[Abstract]
Chiang, C., Swan, R. Z., Grachtchouk, M., Bolinger, M.,
Litingtung, Y., Robertson, E. K., Cooper, M. K., Gaffield, W., Westphal, H.,
Beachy, P. A. et al. (1999). Essential role for Sonic
hedgehog during hair follicle morphogenesis. Dev.
Biol. 205,1
-9.[CrossRef][Medline]
Cotsarelis, G., Sun, T. T. and Lavker, R. M.
(1990). Label-retaining cells reside in the bulge area of
pilosebaceous unit: implications for follicular stem cells, hair cycle, and
skin carcinogenesis. Cell
61,1329
-1337.[CrossRef][Medline]
Desplan, C., Theis, J. and O'Farrell, P. H.
(1988). The sequence specificity of homeodomain-DNA interaction.
Cell 54,1081
-1090.[CrossRef][Medline]
Ellis, T., Gambardella, L., Horcher, M., Tschanz, S., Capol, J.,
Bertram, P., Jochum, W., Barrandon, Y. and Busslinger, M.
(2001). The transcriptional repressor CDP (Cutl1) is essential
for epithelial cell differentiation of the lung and the hair follicle.
Genes Dev. 15,2307
-2319.
Feledy, J. A., Morasso, M. I., Jang, S. I. and Sargent, T.
D. (1999). Transcriptional activation by the homeodomain
protein distal-less 3. Nucleic Acids Res.
27,764
-770.
Fuchs, E. (2007). Scratching the surface of
skin development. Nature
445,834
-842.[CrossRef][Medline]
Gat, U., DasGupta, R., Degenstein, L. and Fuchs, E.
(1998). De Novo hair follicle morphogenesis and hair tumors in
mice expressing a truncated beta-catenin in skin. Cell
95,605
-614.[CrossRef][Medline]
Godwin, A. R. and Capecchi, M. R. (1998).
Hoxc13 mutant mice lack external hair. Genes Dev.
12, 11-20.
Han, G., Li, A. G., Liang, Y. Y., Owens, P., He, W., Lu, S.,
Yoshimatsu, Y., Wang, D., Ten Dijke, P., Lin, X. et al.
(2006). Smad7-induced beta-catenin degradation alters epidermal
appendage development. Dev. Cell
11,301
-312.[CrossRef][Medline]
Hardy, M. H. (1992). The secret life of the
hair follicle. Trends Genet.
8, 55-61.[Medline]
Hassan, M. Q., Javed, A., Morasso, M. I., Karlin, J., Montecino,
M., van Wijnen, A. J., Stein, G. S., Stein, J. L. and Lian, J. B.
(2004). Dlx3 transcriptional regulation of osteoblast
differentiation: temporal recruitment of Msx2, Dlx3, and Dlx5 homeodomain
proteins to chromatin of the osteocalcin gene. Mol. Cell.
Biol. 24,9248
-9261.
Huelsken, J. and Birchmeier, W. (2001). New
aspects of Wnt signaling pathways in higher vertebrates. Curr.
Opin. Genet. Dev. 11,547
-553.[CrossRef][Medline]
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and
Birchmeier, W. (2001). beta-Catenin controls hair follicle
morphogenesis and stem cell differentiation in the skin.
Cell 105,533
-545.[CrossRef][Medline]
Hwang, J., Kalinin, A., Hwang, M., Anderson, D. E., Kim, M. J.,
Stojadinovic, O., Tomic-Canic, M., Lee, S. H. and Morasso, M. I.
(2007). Role of Scarf and its binding target proteins in
epidermal calcium homeostasis. J. Biol. Chem.
282,18645
-18653.
Jave-Suarez, L. F., Winter, H., Langbein, L., Rogers, M. A. and
Schweizer, J. (2002). HOXC13 is involved in the regulation of
human hair keratin gene expression. J. Biol. Chem.
277,3718
-3726.
Johns, S. A., Soullier, S., Rashbass, P. and Cunliffe, V. T.
(2005). Foxn1 is required for tissue assembly and desmosomal
cadherin expression in the hair shaft. Dev. Dyn.
232,1062
-1068.[CrossRef][Medline]
Kaufman, C. K., Zhou, P., Pasolli, H. A., Rendl, M., Bolotin,
D., Lim, K. C., Dai, X., Alegre, M. L. and Fuchs, E. (2003).
GATA-3: an unexpected regulator of cell lineage determination in skin.
Genes Dev. 17,2108
-2122.
Kobielak, K., Pasolli, H. A., Alonso, L., Polak, L. and Fuchs,
E. (2003). Defining BMP functions in the hair follicle by
conditional ablation of BMP receptor IA. J. Cell Biol.
163,609
-623.
Kobielak, K., Stokes, N., de la Cruz, J., Polak, L. and Fuchs,
E. (2007). Loss of a quiescent niche but not follicle stem
cells in the absence of bone morphogenetic protein signaling. Proc.
Natl. Acad. Sci. USA 104,10063
-10068.
Kulessa, H., Turk, G. and Hogan, B. L. (2000).
Inhibition of Bmp signaling affects growth and differentiation in the anagen
hair follicle. EMBO J.
19,6664
-6674.[CrossRef][Medline]
Kurek, D., Garinis, G. A., van Doorninck, J. H., van der Wees,
J. and Grosveld, F. G. (2007). Transcriptome and phenotypic
analysis reveals Gata3-dependent signalling pathways in murine hair follicles.
Development 134,261
-272.
Langbein, L. and Schweizer, J. (2005). Keratins
of the human hair follicle. Int. Rev. Cytol.
243, 1-78.[CrossRef][Medline]
Levy, V., Lindon, C., Harfe, B. D. and Morgan, B. A.
(2005). Distinct stem cell populations regenerate the follicle
and interfollicular epidermis. Dev. Cell
9, 855-861.[CrossRef][Medline]
Liu, Y., Lyle, S., Yang, Z. and Cotsarelis, G.
(2003). Keratin 15 promoter targets putative epithelial stem
cells in the hair follicle bulge. J. Invest. Dermatol.
121,963
-968.[CrossRef][Medline]
Luo, T., Matsuo-Takasaki, M. and Sargent, T. D.
(2001). Distinct roles for Distal-less genes Dlx3 and Dlx5 in
regulating ectodermal development in Xenopus. Mol. Reprod.
Dev. 60,331
-337.[CrossRef][Medline]
Ma, L., Liu, J., Wu, T., Plikus, M., Jiang, T. X., Bi, Q., Liu,
Y. H., Muller-Rover, S., Peters, H., Sundberg, J. P. et al.
(2003). `Cyclic alopecia' in Msx2 mutants: defects in hair
cycling and hair shaft differentiation. Development
130,379
-389.
Meier, N., Dear, T. N. and Boehm, T. (1999).
Whn and mHa3 are components of the genetic hierarchy controlling hair follicle
differentiation. Mech. Dev.
89,215
-221.[CrossRef][Medline]
Merrill, B. J., Gat, U., DasGupta, R. and Fuchs, E.
(2001). Tcf3 and Lef1 regulate lineage differentiation of
multipotent stem cells in skin. Genes Dev.
15,1688
-1705.
Mikkola, M. L. and Millar, S. E. (2006). The
mammary bud as a skin appendage: unique and shared aspects of development.
J. Mammary Gland Biol. Neoplasia
11,187
-203.[CrossRef][Medline]
Millar, S. E. (2002). Molecular mechanisms
regulating hair follicle development. J. Invest.
Dermatol. 118,216
-225.[CrossRef][Medline]
Millar, S. E., Willert, K., Salinas, P. C., Roelink, H., Nusse,
R., Sussman, D. J. and Barsh, G. S. (1999). WNT signaling in
the control of hair growth and structure. Dev. Biol.
207,133
-149.[CrossRef][Medline]
Morasso, M. I. and Radoja, N. (2005). Dlx
genes, p63, and ectodermal dysplasias. Birth Defects Res. C Embryo
Today 75,163
-171.[CrossRef][Medline]
Morasso, M. I., Markova, N. G. and Sargent, T. D.
(1996). Regulation of epidermal differentiation by a Distal-less
homeodomain gene. J. Cell Biol.
135,1879
-1887.
Morasso, M. I., Grinberg, A., Robinson, G., Sargent, T. D. and
Mahon, K. A. (1999). Placental failure in mice lacking the
homeobox gene Dlx3. Proc. Natl. Acad. Sci. USA
96,162
-167.
Mou, C., Jackson, B., Schneider, P., Overbeek, P. A. and Headon,
D. J. (2006). Generation of the primary hair follicle
pattern. Proc. Natl. Acad. Sci. USA
103,9075
-9080.
Narhi, K., Jarvinen, E., Birchmeier, W., Taketo, M. M., Mikkola,
M. L. and Thesleff, I. (2008). Sustained epithelial
{beta}-catenin activity induces precocious hair development but disrupts hair
follicle down-growth and hair shaft formation.
Development 135,1019
-1028.
Oliver, R. F. and Jahoda, C. A. (1988).
Dermal-epidermal interactions. Clin. Dermatol.
6, 74-82.[CrossRef][Medline]
Oshima, H., Rochat, A., Kedzia, C., Kobayashi, K. and Barrandon,
Y. (2001). Morphogenesis and renewal of hair follicles from
adult multipotent stem cells. Cell
104,233
-245.[CrossRef][Medline]
Park, G. T. and Morasso, M. I. (2002). Bone
morphogenetic protein-2 (BMP-2) transactivates Dlx3 through Smad1 and Smad4:
alternative mode for Dlx3 induction in mouse keratinocytes. Nucleic
Acids Res. 30,515
-522.
Plikus, M. V., Mayer, J. A., de la Cruz, D., Baker, R. E.,
Maini, P. K., Maxson, R. and Chuong, C. M. (2008). Cyclic
dermal BMP signalling regulates stem cell activation during hair regeneration.
Nature 451,340
-344.[CrossRef][Medline]
Potter, C. S., Peterson, R. L., Barth, J. L., Pruett, N. D.,
Jacobs, D. F., Kern, M. J., Argraves, W. S., Sundberg, J. P. and Awgulewitsch,
A. (2006). Evidence that the satin hair mutant gene Foxq1 is
among multiple and functionally diverse regulatory targets for Hoxc13 during
hair follicle differentiation. J. Biol. Chem.
281,29245
-29255.
Price, J. A., Bowden, D. W., Wright, J. T., Pettenati, M. J. and
Hart, T. C. (1998). Identification of a mutation in DLX3
associated with tricho-dento-osseous (TDO) syndrome. Hum. Mol.
Genet. 7,563
-569.
Pummila, M., Fliniaux, I., Jaatinen, R., James, M. J.,
Laurikkala, J., Schneider, P., Thesleff, I. and Mikkola, M. L.
(2007). Ectodysplasin has a dual role in ectodermal
organogenesis: inhibition of Bmp activity and induction of Shh expression.
Development 134,117
-125.
Radoja, N., Guerrini, L., Lo, Iacono, N., Merlo, G. R.,
Costanzo, A., Weinberg, W. C., La, Mantia, G., Calabro, V. and Morasso, M.
I. (2007). Homeobox gene Dlx3 is regulated by p63 during
ectoderm development: relevance in the pathogenesis of ectodermal dysplasias.
Development 134,13
-18.
Rendl, M., Polak, L. and Fuchs, E. (2008). BMP
signaling in dermal papilla cells is required for their hair
follicle-inductive properties. Genes Dev.
22,543
-557.
Rhee, H., Polak, L. and Fuchs, E. (2006). Lhx2
maintains stem cell character in hair follicles.
Science 312,1946
-1949.
Schmidt-Ullrich, R. and Paus, R. (2005).
Molecular principles of hair follicle induction and morphogenesis.
BioEssays 27,247
-261.[CrossRef][Medline]
Schmidt-Ullrich, R., Tobin, D. J., Lenhard, D., Schneider, P.,
Paus, R. and Scheidereit, C. (2006). NF-kappaB transmits Eda
A1/EdaR signalling to activate Shh and cyclin D1 expression, and controls
post-initiation hair placode down growth. Development
133,1045
-1057.
Soriano, P. (1999). Generalized lacZ expression
with the ROSA26 Cre reporter strain. Nat. Genet.
21, 70-71.[CrossRef][Medline]
Sumiyama, K., Irvine, S. Q., Stock, D. W., Weiss, K. M.,
Kawasaki, K., Shimizu, N., Shashikant, C. S., Miller, W. and Ruddle, F. H.
(2002). Genomic structure and functional control of the Dlx3-7
bigene cluster. Proc. Natl. Acad. Sci. USA
99,780
-785.
Sumiyama, K., Irvine, S. Q. and Ruddle, F. H.
(2003). The role of gene duplication in the evolution and
function of the vertebrate Dlx/distal-less bigene clusters. J.
Struct. Funct. Genomics 3,151
-159.[CrossRef][Medline]
Svingen, T. and Tonissen, K. F. (2003). Altered
HOX gene expression in human skin and breast cancer cells. Cancer
Biol. Ther. 2,518
-523.[Medline]
Taylor, G., Lehrer, M. S., Jensen, P. J., Sun, T. T. and Lavker,
R. M. (2000). Involvement of follicular stem cells in forming
not only the follicle but also the epidermis. Cell
102,451
-461.[CrossRef][Medline]
Thesleff, I., Vaahtokari, A. and Partanen, A. M.
(1995). Regulation of organogenesis. Common molecular mechanisms
regulating the development of teeth and other organs. Int. J. Dev.
Biol. 39,35
-50.[Medline]
Tkatchenko, A. V., Visconti, R. P., Shang, L., Papenbrock, T.,
Pruett, N. D., Ito, T., Ogawa, M. and Awgulewitsch, A.
(2001). Overexpression of Hoxc13 in differentiating keratinocytes
results in downregulation of a novel hair keratin gene cluster and alopecia.
Development 128,1547
-1558.[Abstract]
Tucker, A. and Sharpe, P. (2004). The
cutting-edge of mammalian development; how the embryo makes teeth.
Nat. Rev. Genet. 5,499
-508.[Medline]
Van Mater, D., Kolligs, F. T., Dlugosz, A. A. and Fearon, E.
R. (2003). Transient activation of beta -catenin signaling in
cutaneous keratinocytes is sufficient to trigger the active growth phase of
the hair cycle in mice. Genes Dev.
17,1219
-1224.
Wright, J. T., Hong, S. P., Simmons, D., Daly, B., Uebelhart, D.
and Luder, H. U. (2008). DLX3 c.561_562delCT mutation causes
attenuated phenotype of tricho-dento-osseous syndrome. Am. J. Med.
Genet. 146,343
-349.
Yuspa, S. H., Hawley-Nelson, P., Koehler, B. and Stanley, J.
R. (1980). A survey of transformation markers in
differentiating epidermal cell lines in culture. Cancer
Res. 40,4694
-4703.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
