|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 5, 2008
doi: 10.1242/10.1242/dev.022442


1 Institut de Biologie du Développement de Marseille-Luminy (IBDML),
UMR6216, CNRS, Université de la Méditerranée, F-13288
Marseille cedex 09, France.
2 Nephro-Urology Unit, UCL Institute of Child Health, 30 Guilford Street, London
WC1N 1EH, UK.
3 Weatherall Institute of Molecular Medicine, University of Oxford, John
Radcliffe Hospital, Oxford OX3 9DS, UK.
4 Max-Delbrueck-Center for Molecular Medicine, Robert-Roessle-Strasse 10, 13125
Berlin, Germany.
5 Department of Zoology, University of Cambridge, Downing Street, Cambridge CB2
3EJ, UK.
Authors for correspondence (e-mails:
a.woolf{at}ich.ucl.ac.uk;
fasano{at}ibdml.univ-mrs.fr)
Accepted 30 July 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Gene targeting, Teashirt 3 (Tshz3), UPJO, Ureter, Smooth muscle
| INTRODUCTION |
|---|
|
|
|---|
A dilated renal pelvis, or hydronephrosis, occurs in 0.9-7.7% of human
gestations, the exact incidence depending on the criteria used to define the
upper normal limit of the pelvic diameter
(Ek et al., 2007
;
Gunn et al., 1995
;
Ismaili et al., 2006
).
Although most such dilatations are transient normal variants, others persist
after birth and thus represent congenital malformations. In this context, a
common diagnosis is unilateral or, less often, bilateral pelvi-ureteric
junction obstruction (PUJO), present in up to 0.3-0.4% of all babies
(Ek et al., 2007
;
Gunn et al., 1995
;
Ismaili et al., 2006
). PUJO
ureters are not anatomically blocked but have aberrant SM arrangement where
the proximal ureter joins the renal pelvis
(dell'Agnola et al., 1990
;
Zhang et al., 2000
). Ureteric
peristalsis propels urine from the renal pelvis towards the urinary bladder,
and a failure of this activity causes `functional' flow impairment leading to
urinary tract dilatation and kidney damage
(Mendelsohn, 2004
).
Peristalsis is propagated distally along the urinary tract by SM in the ureter
coat. Therefore, failure in SM differentiation along the urinary outflow tract
may be an important primary cause of functional obstruction and
hydronephrosis.
Between mouse embryonic day (E) 10 and 11, the metanephric mesenchyme (MM) signals to the ureteric bud (UB) to promote its outgrowth from the mesonephric duct and entry into the MM. Thereafter, UB branching morphogenesis generates kidney collecting ducts, and UB branch tip signals induce MM cells to aggregate and undergo mesenchymal-to-epithelial transition, forming nephrons. Meanwhile the unbranched stalk of the UB outside the MM elongates to form the ureter tube epithelium, the `urothelium', while surrounding mesenchymal cells also contribute to the ureter becoming the cells of the lamina propria, SM and connective tissue.
Reciprocal signalling between the epithelial and mesenchymal components of
ureter is essential for correct ureter development
(Airik and Kispert, 2007
;
Mendelsohn, 2006
). UB stalk
epithelia secrete sonic hedgehog (SHH), which has a proliferative effect on
ureteric mesenchyme and induces bone morphogenetic protein 4 (BMP4) in
peri-urothelial mesenchymal cells (Yu et
al., 2002
). Inactivation of Shh in the urinary tract
delays ureteric SMC maturation and causes loss of stromal cells located
between the urothelial and SM layers (Yu
et al., 2002
). BMP4 promotes the differentiation of ureteric
mesenchyme into SMCs and also facilitates urothelial maturation
(Brenner-Anantharam et al.,
2007
; Miyazaki et al.,
2003
; Raatikainen-Ahokas et
al., 2000
). In response to signals from ureteric mesenchyme, UB
stalk epithelia mature into urothelia, and express uroplakin (UPK)-rich
plaques on their apical surfaces to maintain the `water-tight' properties of
this epithelium (Jenkins and Woolf,
2007
).
Recently, other mouse models confirmed that, unless mesenchymal cells
surrounding the ureter stalk differentiate normally, congenital malformations
of the urinary tract will arise. The transcription factor TBX18 is expressed
in undifferentiated mesenchymal cells around ureter. In
Tbx18-/- mice, absence of condensation and differentiation
of ureteral mesenchymal cells into SM results on congenital hydronephrosis
(Airik et al., 2006
). Deletion
of a regulatory subunit of calcineurin, Cnb1 (Ppp3r1 - Mouse
Genome Informatics) in the mesenchyme of the developing urinary tract results
in reduced proliferation in the SMCs, leading to defective postnatal
pyeloureteral peristalsis and renal obstruction
(Chang et al., 2004
). Despite
these insights, there is still a crucial need to develop new mouse models for
congenital ureter malformations to help understand the mechanisms that
underlie SM differentiation.
In Drosophila, renal (Malpighian) tubules (MpTs) are major
excretory and osmoregulatory organs. They derive from two cell populations,
ectodermal epithelial buds and surrounding mesenchymal mesoderm, and
unexpected parallels exist between MpTs development and vertebrate
nephrogenesis (Denholm et al.,
2003
). Several fly MpT genes such as Kr, cut, hibris and
Odd have vertebrate homologues (Glis2, Cux1, nephrin and
Osr, respectively) implicated in kidney development
(Sharma et al., 2004
;
Tena et al., 2007
;
Vanden Heuvel et al., 1996
;
Zhang et al., 2002
). We have
previously shown that stellate cells within MpT express two related
zinc-finger transcription factors, teashirt (tsh) and
tiptop (tio) (Denholm et
al., 2003
; Laugier et al.,
2005
). Furthermore, we found that the three mouse teashirt (Tshz)
genes were functionally equivalent to Drosophila tsh in terms of
rescuing homeotic and segment polarity phenotypes of a tsh-null
mutant fly (Caubit et al.,
2005
; Manfroid et al.,
2004
).
Based on the above observations about the Tsh/Tshz families, we
suspected that they might be expressed in, and have roles in, mammalian renal
tract development. Here, we show that mouse ureteric SMC precursors express
Tshz3 and that Tshz3-null mutant mice have congenital
hydronephrosis without anatomical obstruction. Ex vivo, the spontaneous
contractions that occurred in proximal segments of wild-type embryonic ureter
explants were absent in Tshz3 mutant ureters. In vivo, prior to the
onset of hydronephrosis, mutant proximal ureters failed to express contractile
SMC markers, whereas these molecules were detected in controls. Mutant
embryonic ureters expressed Shh and Bmp4 transcripts, as
normal, with appropriate expression of Ptch1 and pSMAD1/5/8 in target
SM precursors, whereas myocardin, a key regulator for SMC differentiation
(Wang and Olson, 2004
), was
not expressed in Tshz3 null ureters. In wild-type embryonic renal
tract explants, exogenous BMP4 upregulated Tshz3 and myocardin
expression. Thus, Tshz3 is required for proximal ureteric SMC
differentiation downstream of SHH and BMP4.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of Tshz3-null mice
Animals were treated according to protocols approved by the French Ethical
Committee. Male chimeras, generated after injection of
Tshz3lacZ/+ ES cells into C57BL/6J blastocysts, were mated
to C57BL/6J females. Offspring (n=249) were assayed for germline
transmission of the Tshz3lacZ allele but no transmission
was PCR detected. Male chimeras were then mated to CD1 females. F1
Tshz3lacZ/+ animals were intercrossed to obtain
Tshz3lacZ/lacZ mutant mice. Alternatively, F1
Tshz3lacZ/+ males were crossed to CD1 females to generate
Tshz3lacZ/+, and mutant mice were analysed after six
generations on the CD1 background. Genomic DNA was PCR-genotyped. Primers
(5'GGAAGGGACTGGCTGCTATTG3' and
5'CGATACCGTAAAGCACGAGG3') for the neo sequence amplified
a 478 bp fragment from the recombinant allele, and primers for exon 2
(5'CGGAGCATCTGGACCGCTATT3' and
5'CTGATATACGTGGAAGGAGTC3') amplified a 630 bp fragment from the
wild-type allele. Representative and reproducible morphology and gene/protein
expression patterns based on four to 20 embryos for each genotype at each
embryonic stage are shown.
Immunoprobing and in situ hybridisation
Tissues were fixed in 4% paraformaldehyde. Paraffin-embedded sections (5-10
µm) were stained with Haematoxylin and Eosin or Masson's trichrome. X-Gal
staining was performed as described
(Relaix et al., 2004
).
Immunostaining was performed either on 14 µm cryosections of tissues or on
paraffin-embedded sections after quenching endogenous peroxidase and antigen
retrieval followed by reaction with secondary antibodies (details available on
request). Whole explants were blocked in 5% goat serum/PBS/0.3% Triton X-100
then incubated with mouse anti-smooth muscle
actin (SMAA; Sigma, clone
1A4; 1/1000) and rabbit anti-E-cadherin (G. Rougon, IBDML-France; 1/500)
antibodies. Guinea-pig anti-TSHZ3 antibody (1/5000) was raised against mouse
amino acids 557-664, cloned as a His-tagged fusion protein in pET14b (Novagen)
and produced by A. Garratt's laboratory. Other primary antibodies were: rabbit
anti-β-galactosidase (Cappel; 1/1000); rabbit anti-Pax2 (Zymed; 1/50);
mouse anti-proliferating cell nuclear antigen (PCNA; BD Pharmingen; 1/200);
rabbit anti-pSMAD1/5/8 (Cell Signaling; 1/200); rabbit anti-retinaldehyde
dehydrogenase 2 (RALDH2; 1/2000) (P. McCaffery, University of Aberdeen, UK);
goat anti-myocardin (sc-21559; Santa-Cruz; 1/200); rabbit anti-aquaporin 2
(Chemicon; 1/400); sheep anti-uromodulin (Biodesign, AMS Biotechnology
Distribution; 1/500); rabbit anti-SM myosin heavy chain (SMMHC;
anti-MHC204/200; 1/500; M. Conti and R. Adelstein, Laboratory of Molecular
Cardiology, Bethesda, USA) (Kelley et al.,
1991
); rabbit anti-SM protein alpha 22kDA (SM22a; 1/1000) (M.
Gimona, Austrian Academy of Sciences, Salzburg, Austria); and rabbit antiserum
to total UPK (1/100; T. T. Sun, New York School of Medicine, USA). Apoptotic
cells were detected using the In Situ Death Detection Kit (Roche). For each
sample, the number of apoptotic cells, and the total number of cells were
counted for each of the following cell populations in the proximal ureter:
urothelium, aggregated mesenchyme and loose mesenchyme.
India ink solution was injected into renal pelves as described previously
(Airik et al., 2006
). In situ
hybridisation using digoxigenin-labelled or radioactive probes was performed
on sections as described (Caubit et al.,
2005
). Probes used were: Bmp4 (B. Hogan, Duke University,
Durham, USA); Ptch1 (M. Scott, HHMI, Stanford University School of
Medicine, USA); Shh (D. Epstein, University of Pennsylvania School of
Medicine, USA); Smaa and Myocd (E. Oslon, University of
Texas Southwestern Medical Center, Dallas, USA); foxd1 (A. Kispert,
Medizinische Hochschule Hannover, Germany); and Raldh2 (J.
Xavier-Neto, HC.FMUSP, São Paulo-SP, Brazil).
Embryonic ureter culture and video microscopy
E15.5 ureters were dissected and explanted onto platforms (Millipore; pore
size 0.4 µm) and cultured in defined, serum-free media, as described for
embryonic mouse urinary bladders (Burgu et
al., 2006
). The timelapse imaging is detailed in the movie legends
(see supplementary material). Images were analysed using Metamorph
software.
Metanephric explant cultures
Kidney rudiments were isolated and cultured as described
(Brenner-Anantharam et al.,
2007
). Explants, each consisting of a metanephros and an attached
ureter, were isolated from E12.5 mouse embryos and cultured for 96 hours. For
real-time quantitative PCR (qPCR) analyses, explants were isolated from E13.5
mouse embryos and cultured for 72 hours. In some cultures, 100 ng/ml
recombinant BMP4 (R&D Systems) was added to the culture medium. In all
cases, medium was changed daily. RNA was isolated using TRIsure Reagent
(Bioline) according to the manufacturer's instructions. Total RNA was
reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad Laboratories).
Real-time PCR was performed on a PTC-200 DNA Engine Opticon System (Bio-Rad
Laboratories) using iQ SYBR Green Supermix (Bio-Rad Laboratories). Primer
sequences used for Sybr RT-PCR are as follows: Tshz3,
5'-gcgcgcagcagcctatgtttc and 3'-tcagccatccggtcactcgtc;
Myocd, 5'-caaggcttaataccgccactg and
3'-aatgtgcatagtaaccaggctg; Id3, 5'-agcttagccaggtggaaatcct
and 3'-tcagctgtctggatcgggag. Results were normalised to Hprt
expression.
|
| RESULTS |
|---|
|
|
|---|
Generation of mice containing a null mutation of Tshz3
To address the issue of the functional contribution of Tshz3 in
the developing renal tract, we generated mice homozygous for a null mutation
in the Tshz3 gene (Tshz3lacZ)
(Fig. 2A-D). Chimeras were
mated to CD1 females and seven chimeras achieved germline transmission.
Crossing Tshz3lacZ/+ parents failed to produce viable null
mutant offspring but genotyping E18.5 litters showed that homozygous mutants
(Tshz3lacZ/lacZ) developed at the expected Mendelian
ratio. E18.5 Tshz3lacZ/lacZ embryos obtained after
Caesarian section became cyanotic and died within 1 hour. They showed no
external anatomical differences from the wild types, but they did not move
spontaneously and reacted only to strong stimuli.
Tshz3lacZ/lacZ lungs sunk, whereas control lungs floated
on water (data not shown). Thus, Tshz3lacZ/lacZ animals
die because of an inability to breathe. The rapid death is unlikely to be
associated with renal tract defects described below because even severe kidney
excretory failure is not fatal for at least 1 day. Instead, it is likely that
Tshz3 is also necessary for respiration and this is the focus of a
separate investigation.
Using comparative analysis on whole mounts and tissues sections, we confirmed that the expression of the Tshz3lacZ allele recapitulated the expression pattern of endogenous Tshz3, providing evidence that the Tshz3 gene was correctly targeted. Part of this analysis is illustrated in Fig. 2, where TSHZ3 and β-galactosidase (β-gal) were detected in periureteral mesenchymal cells and excluded from the epithelium in transverse sections of E14.5 ureters; inactivation of the Tshz3 locus was attested by the absence of TSHZ3 protein in Tshz3lacZ/lacZ (Fig. 2E).
Inactivation of Tshz3 causes hydroureter and SMCs malformation
Mutant urinary tracts displayed a prominent proximal hydroureter and the
kidneys were markedly hydronephrotic (Fig.
3B,C): a fully penetrant bilateral phenotype evident from E16.5
that affects both sexes. In heterozygous embryos, rare cases (4/80) of
unilateral hydroureter occurred. Histological analysis confirmed dilation of
the renal pelvis in null mutants (Fig.
3D,E) and showed that the dilated proximal ureters were
thin-walled (Fig. 3I,J). In
wild-type ureters, the multilayered epithelium was surrounded by condensed
mesenchymal cells that differentiated into multiple SM layers
(Fig. 3F,G). Close inspection
of Tshz3lacZ/lacZ proximal ureters revealed that the
structural organisation of these muscular layers was lost, leading to a thin
layer of mesenchymal cells. The urothelium was present but arranged in a
monolayer as a consequence of the distension of the proximal ureter
(Fig. 3I,J). However, the
distal ureter did not appear to be affected because mesenchymal cell layers
were properly organised and the urothelium multilayered as normal
(Fig. 3H,K).
|
To determine the onset of urinary tract malformations in Tshz3lacZ/lacZ, we harvested embryos from timed mating and analysed urinary tract histology. From E12.5, we observed that the mesenchymal progenitors condensed as normal around the ureteric epithelium until E15.5 (data not shown) (see Fig. S2G,H in the supplementary material). However, at E16, as hydroureter developed, peri-urothelial cells appeared less organised compared with wild-type ureters (Fig. 3L-O).
Analysis of E18.5 mutant urinary tracts by India ink injection revealed no sign of physical obstruction: ink flowed down the ureter into the bladder, suggesting that hydroureter and hydronephrosis were caused by functional, rather than by anatomical, obstruction (Fig. 3P-R). Furthermore, because the structural organisation of ureteric muscle is lost in Tshz3lacZ/lacZ embryos, our results suggest that Tshz3 could play a role in ureteric SMC differentiation.
Lack of Tshz3 perturbs peristalsis in forming ureters
To test for functional obstruction, which is caused by impaired
peristalsis, we studied cultured embryonic ureters. When maintained in culture
for up to 6 days, wild-type E15.5 ureters elongated and underwent spontaneous
contractions several times/minute (Fig.
4A; see Movie 1 in the supplementary material). Contractions
initiated approximately one-fifth of the way down the ureter and were followed
by distal propagation: the most proximal parts of the explants also contracted
immediately after the initiation of peristalsis
(Fig. 4C) and, in vivo, this
would probably `squeeze' the renal papilla, which protrudes into the pelvis
and proximal ureter. Null mutant ureters explanted at E15.5 (when urinary
tract dilatation is not yet present) also grew, initiated contractions at a
similar proximal/distal level and propagated a pulse-wave distally.
Significantly, however, null mutant proximal ureters completely failed to
contract (Fig. 4D; see Movie 2
in the supplementary material). This result strongly supports the hypothesis
that abnormal peristalsis of the proximal part of the ureter occurs in vivo,
causing a functional obstruction that leads to hydronephrosis and
hydroureter.
|
Tshz3 deficiency causes perturbed development of ureteric SMC
To test whether the hydronephrosis and hydroureter observed in the
Tshz3 mutant were caused by abnormalities in the SM, we examined SMCs
development in Tshz3lacZ/lacZ ureters. A hallmark of SMCs
differentiation is the elevated expression of SMC-selective differentiation
marker genes, including Smaa, Smmhc and Sm22a
(Owens, 1995
). The
differentiation of SM in the mouse ureter and the pelvis has been documented
to occur in a proximodistal wave (McHugh,
1995
; Yu et al.,
2002
). In wild-type embryos, SMAA is first detected at E14.5 in
few cells within aggregated mesenchyme of the proximal ureter and the nascent
renal pelvis (data not shown) (see also Yu
et al., 2002
). Examination of proximal ureters of E15.5
Tshz3lacZ/lacZ mutant embryos revealed almost absent
expression of SMC contractile proteins, including SMAA, SMMHC and SM22
(Fig. 6D-F) versus controls
embryos (Fig. 6A-C).
|
|
Next, we determined whether the failure of SMC development might reflect defects in proliferation and/or apoptosis of periureteric cells (see Fig. S3 and Table S1 in the supplementary material). As assessed by PCNA immunostaining (see Fig. S3A,B in the supplementary material), we recorded no significant difference in proliferation between wild-type and mutant proximal ureters. As assessed by TUNEL analyses, apoptosis was never detected in aggregated cells around the urothelium in either genotype, whereas there was a similar, low prevalence in urothelia and also mesenchymal cells outside the aggregated mesenchymal layer. Furthermore, comparison of expression between Tshz3lacZ/+ and Tshz3lacZ/lacZ ureters revealed similar numbers of β-gal-positive cells in both genotypes (see Fig. S3C,D in the supplementary material). Thus, Tshz3 was not essential for SMC precursor proliferation or survival.
|
Recent studies suggest that a signal from the ureteric mesenchyme to the
ureteric epithelium participates in the differentiation of the urothelium
(Airik et al., 2006
). To
investigate whether loss of Tshz3 in the ureteric mesenchyme would
compromise differentiation of the ureteric epithelium, we analysed UPK
expression in E18.5 Tshz3lacZ/lacZ proximal ureters.
Expression in both mutant and wild-type urothelium indicated that, despite
failed SMCs differentiation, urothelia matured normally
(Fig. 6R,T).
Tshz3 is downstream to SHH and BMP4 with regard to ureteric SMC differentiation
SHH signalling plays an essential role in ureteric SMC development by
promoting proliferation of ureteric mesenchymal cells and inducing them to
secrete BMP4; BMP4 in turn promotes SMC differentiation and
Bmp4+/- mice exhibit hydroureter
(Brenner-Anantharam et al.,
2007
; Miyazaki et al.,
2000
; Yu et al.,
2002
). We sought evidence for SHH signalling by in situ
hybridisation for Shh, Ptch1 and Bmp4 in
Tshz3lacZ/lacZ proximal ureters. Shh was
expressed by E15.5 urothelia of both wild type and
Tshz3lacZ/lacZ, and Ptch1 and Bmp4 were
expressed in peri-urothelial cells in both genotypes
(Fig. 7A-F). In addition, we
analysed the phosphorylation of SMAD proteins considered as mediators of BMP
signal transduction (Massague et al.,
2005
). At E14.5, similar levels of nuclear pSMAD1/5/8 protein were
detected in periureteral mesenchymal cells in wild-type and Tshz3
mutant proximal ureters (Fig.
7G,H). Taken together, these results indicate that Tshz3
mutant mesenchyme was directly responding to SHH and BMP4 signalling, in the
same way as wild-type cells, even though they failed to form SMC.
|
|
| DISCUSSION |
|---|
|
|
|---|
Tshz3 and radial patterning
During ureter morphogenesis, Tshz3 was detected in the undifferentiated
mesenchymal cells that contribute to the SM, the adventitia and the stromal
layers. So far, very few genes have been implicated in the reciprocal signals
that trigger the specification, proliferation and differentiation of
epithelial and mesenchymal compartments. However, Shh, Bmp4 and
Tbx18 appear to have crucial roles in the development of both
compartments. SHH signalling is also required for establishing and/or
maintaining the stromal cells, a mesenchymal cell population of undefined
origin (Mahoney et al., 2006
;
Yu et al., 2002
). In
Tshz3 mutant ureters, expression of RALDH2 indicates that
differentiation of stromal cells occurs properly, suggesting that the
sub-epithelial mesenchymal cells are SHH-responsive. Analysis of the
Tshz3lacZ/lacZ mutant ureters indicates that
differentiation of the epithelium also occurs normally, and suggests that this
cannot depend on the differentiation of the SMCs themselves, but rather on
earlier events, as has been suggested by Bmp4 loss of function
analyses (Brenner-Anantharam et al.,
2007
). Our data also show that TSHZ3 is dispensable for
recruitment and condensation steps (see Fig. S2G,H in the supplementary
material) before SM differentiation itself
(Raatikainen-Ahokas et al.,
2000
). Therefore, the Tshz3 mutant provides a unique
genetic tool in which stromal and urothelial differentiation, and also
mesenchymal recruitment and condensation, are uncoupled from differentiation
of SMCs.
In vivo, urothelial Shh was expressed as normal in mutants, which
had overtly responsive adjacent mesenchymal cells, as shown by Ptch1
expression and indices of proliferation in the latter compartment.
Furthermore, BMP4 signalling was initiated as normal in Tshz3 mutant
ureters, as assessed by expression of Bmp4 and pSMAD1/5/8 in cells
around ureteric urothelia. Nevertheless, Tshz3-null mutation
specifically impaired the differentiation of SMC progenitors in proximal
uterers in vivo, and, ex vivo, exogenous BMP4 treatment did not rescue
Tshz3 mutant proximal ureter SMC differentiation, as assessed by SMAA
expression. Before E12.5, when BMP4 signalling is essential for SMC
differentiation (Brenner-Anantharam et al.,
2007
), TSHZ3 was expressed by SM progenitors and we showed that,
in renal tract explants, Tshz3 expression was enhanced upon BMP4
treatment. These results support the idea that Tshz3 is downstream of
BMP4 and might even be a direct target of BMP4 signalling.
Several studies suggest that BMP4 is not the only signal necessary for
ureteric SM differentiation and it is possible that TSHZ3 is required for
these other signals (Airik and Kispert,
2007
; Chang et al.,
2004
; Miyazaki et al.,
2003
; Yu et al.,
2002
). The molecular mechanisms whereby developmental signals
modulate the regulatory network for SM gene transcription warrants further
studies. In vivo, loss of Tshz3 leads to the absence of myocardin and
in vitro BMP4 stimulate Tshz3 and Myocd expression. This
study suggests that Tshz3 could serve as a central transcriptional factor that
integrates BMP4 signalling into the transcriptional regulatory network by
controlling the expression of myocardin, a key factor for SM
differentiation.
Regionalisation of the ureter
Tshz3 is evenly expressed in the mesenchyme along the entire
proximodistal axis of the ureter. However, in the absence of Tshz3,
SM markers were strongly downregulated in the proximal ureter and SM failed to
develop, whereas in the distal part of the ureter, weak expression of SM
proteins appears sufficient to produce functional SM. Therefore, our data show
that the proximal and distal parts of the ureter respond differently to the
absence of Tshz3, and hence show that the ureter is regionalised
along its length. Temporal regionalisation of the ureter along the
proximodistal axis is supported by the observation that SM differentiation
occurs in a wave from the kidney to the bladder
(Yu et al., 2002
). However, no
mesenchymal transcription factors differentially expressed along the ureter
have been found, which could support a spatial regionalisation of this
structure. According to its broad expression, it is unlikely that TSHZ3 alone
differentially controls gene expression in a proximodistal gradient but it
might well act as a co-factor of an essential regionalised factor or be
recruited by a signalling pathway that acts locally. Therefore, our
Tshz3-null mutant constitutes an excellent tool for the
identification of such regionalised factors.
Tshz3 mutant is a model for functional obstruction linked to SM impairment
The lack of Tshz3 is associated with bilateral hydronephrosis and
proximal hydroureter, with an onset before birth. This mouse phenotype is
reminiscent of human congenital PUJO, a common birth defect that is sometimes
associated with significant kidney damage caused by urinary flow impairment
(Decramer et al., 2006
;
Gunn et al., 1995
;
Ismaili et al., 2006
). PUJO
ureters are not anatomically blocked, but have aberrantly arranged SM in the
region where the proximal ureter joins the renal pelvis
(dell'Agnola et al., 1990
;
Zhang et al., 2000
). In an
intriguing parallel, we found that in Tshz3lacZ/lacZ mice,
SMC differentiation was impaired in the proximal ureter. Thus, we postulate
that the gross phenotypes of both Tshz3lacZ/lacZ mice and
human PUJO result from a failure of peristalsis in the region of the proximal
ureter, which leads to `functional' urine flow impairment. Recently, other
mouse models for congenital hydronephrosis with defects in SM have been
generated. Mutants for Shh and Tbx18 affect both urothelium
and SMC. Loss of Dlgh1 perturbs the orientation of the SMCs, causes a
slight delay in SMC maturation, and causes stromal cell defects
(Mahoney et al., 2006
).
Finally, inactivation of Cnb1, as well as At1, causes
obstruction after birth by affecting postnatal proliferation and maturation of
pelvic SMCs (Chang et al.,
2004
; Miyazaki et al.,
1998
). The Tshz3 mutant will be useful for analysing
prenatal functional kidney obstruction that results from incomplete SMC
differentiation in the absence developmental defects of other ureteric cell
populations. Mouse models have guided candidate gene screens for
identification of mutations causing human urinary tract malformations
(Jenkins and Woolf, 2007
;
Lu et al., 2007
). We suggest
that TSHZ3 should be examined as a candidate for congenital PUJO and
related disorders, such as multicystic dysplastic kidney, a disorder
characterised by severely disorganised ureteric and renal pelvic morphogenesis
(Woolf et al., 2004
).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/19/3301/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Airik, R. and Kispert, A. (2007). Down the tube
of obstructive nephropathies: the importance of tissue interactions during
ureter development. Kidney Int.
72,1459
-1467.
Airik, R., Bussen, M., Singh, M. K., Petry, M. and Kispert,
A. (2006). Tbx18 regulates the development of the ureteral
mesenchyme. J. Clin. Invest.
116,663
-674.
Breiteneder-Geleff, S., Matsui, K., Soleiman, A., Meraner, P.,
Poczewski, H., Kalt, R., Schaffner, G. and Kerjaschki, D.
(1997). Podoplanin, novel 43-kd membrane protein of glomerular
epithelial cells, is down-regulated in puromycin nephrosis. Am. J.
Pathol. 151,1141
-1152.
Brenner-Anantharam, A., Cebrian, C., Guillaume, R., Hurtado, R.,
Sun, T. T. and Herzlinger, D. (2007). Tailbud-derived
mesenchyme promotes urinary tract segmentation via BMP4 signaling.
Development 134,1967
-1975.
Burgu, B., McCarthy, L. S., Shah, V., Long, D. A., Wilcox, D. T.
and Woolf, A. S. (2006). Vascular endothelial growth factor
stimulates embryonic urinary bladder development in organ culture.
BJU Int. 98,217
-225.
Caubit, X., Tiveron, M. C., Cremer, H. and Fasano, L.
(2005). Expression patterns of the three Teashirt-related genes
define specific boundaries in the developing and postnatal mouse forebrain.
J. Comp. Neurol. 486,76
-88.
Chang, C. P., McDill, B. W., Neilson, J. R., Joist, H. E.,
Epstein, J. A., Crabtree, G. R. and Chen, F. (2004).
Calcineurin is required in urinary tract mesenchyme for the development of the
pyeloureteral peristaltic machinery. J. Clin. Invest.
113,1051
-1058.
Chung, K. H. and Chevalier, R. L. (1996).
Arrested development of the neonatal kidney following chronic ureteral
obstruction. J. Urol.
155,1139
-1144.
Decramer, S., Wittke, S., Mischak, H., Zurbig, P., Walden, M.,
Bouissou, F., Bascands, J. L. and Schanstra, J. P. (2006).
Predicting the clinical outcome of congenital unilateral ureteropelvic
junction obstruction in newborn by urinary proteome analysis. Nat.
Med. 12,398
-400.
dell'Agnola, C. A., Carmassi, L. M., Merlo, D. and Tadini,
B. (1990). Duration and severity of congenital hydronephrosis
as a cause of smooth muscle deterioration in pyelo-ureteral junction
obstruction. Z. Kinderchir.
45,286
-290.
Denholm, B., Sudarsan, V., Pasalodos-Sanchez, S., Artero, R.,
Lawrence, P., Maddrell, S., Baylies, M. and Skaer, H. (2003).
Dual origin of the renal tubules in Drosophila: mesodermal cells integrate and
polarize to establish secretory function. Curr. Biol.
13,1052
-1057.
Ek, S., Lidefeldt, K. J. and Varricio, L.
(2007). Fetal hydronephrosis; prevalence, natural history and
postnatal consequences in an unselected population. Acta Obstet.
Gynecol. Scand. 86,1463
-1466.
Gunn, T. R., Mora, J. D. and Pease, P. (1995).
Antenatal diagnosis of urinary tract abnormalities by ultrasonography after 28
weeks' gestation: incidence and outcome. Am. J. Obstet.
Gynecol. 172,479
-486.
Hoyer, J. R., Resnick, J. S., Michael, A. F. and Vernier, R.
L. (1974). Ontogeny of Tamm-Horsfall urinary glycoprotein.
Lab. Invest. 30,757
-761.
Huang, J., Cheng, L., Li, J., Chen, M., Zhou, D., Lu, M. M.,
Proweller, A., Epstein, J. A. and Parmacek, M. S. (2008).
Myocardin regulates expression of contractile genes in smooth muscle cells and
is required for closure of the ductus arteriosus in mice. J. Clin.
Invest. 118,515
-525.
Ismaili, K., Hall, M., Piepsz, A., Wissing, K. M., Collier, F.,
Schulman, C. and Avni, F. E. (2006). Primary vesicoureteral
reflux detected in neonates with a history of fetal renal pelvis dilatation: a
prospective clinical and imaging study. J. Pediatr.
148,222
-227.
Jen, Y., Manova, K. and Benezra, R. (1996).
Expression patterns of Id1, Id2, and Id3 are highly related but distinct from
that of Id4 during mouse embryogenesis. Dev. Dyn.
207,235
-252.
Jenkins, D. and Woolf, A. S. (2007).
Uroplakins: new molecular players in the biology of urinary tract
malformations. Kidney Int.
71,195
-200.
Kelley, C. A., Kawamoto, S., Conti, M. A. and Adelstein, R.
S. (1991). Phosphorylation of vertebrate smooth muscle and
nonmuscle myosin heavy chains in vitro and in intact cells. J.
Cell. Sci. Suppl. 14,49
-54.
Laugier, E., Yang, Z., Fasano, L., Kerridge, S. and Vola, C.
(2005). A critical role of teashirt for patterning the ventral
epidermis is masked by ectopic expression of tiptop, a paralog of teashirt in
Drosophila. Dev. Biol.
283,446
-458.
Li, J., Shiroyanagi, Y., Lin, G., Haqq, C., Lin, C. S., Lue, T.
F., Willingham, E. and Baskin, L. S. (2006). Serum response
factor, its cofactors, and epithelial-mesenchymal signaling in urinary bladder
smooth muscle formation. Differentiation
74, 30-39.
Li, S., Wang, D. Z., Wang, Z., Richardson, J. A. and Olson, E.
N. (2003). The serum response factor coactivator myocardin is
required for vascular smooth muscle development. Proc. Natl. Acad.
Sci. USA 100,9366
-9370.
Lu, W., van Eerde, A. M., Fan, X., Quintero-Rivera, F.,
Kulkarni, S., Ferguson, H., Kim, H. G., Fan, Y., Xi, Q., Li, Q. G. et al.
(2007). Disruption of ROBO2 is associated with urinary tract
anomalies and confers risk of vesicoureteral reflux. Am. J. Hum.
Genet. 80,616
-632.
Mahoney, Z. X., Sammut, B., Xavier, R. J., Cunningham, J., Go,
G., Brim, K. L., Stappenbeck, T. S., Miner, J. H. and Swat, W.
(2006). Discs-large homolog 1 regulates smooth muscle orientation
in the mouse ureter. Proc. Natl. Acad. Sci. USA
103,19872
-19877.
Manfroid, I., Caubit, X., Kerridge, S. and Fasano, L.
(2004). Three putative murine Teashirt orthologues specify trunk
structures in Drosophila in the same way as the Drosophila teashirt gene.
Development 131,1065
-1073.
Mansour, S. L., Thomas, K. R. and Capecchi, M. R.
(1988). Disruption of the proto-oncogene int-2 in mouse
embryo-derived stem cells: a general strategy for targeting mutations to
non-selectable genes. Nature
336,348
-352.
Marples, D., Knepper, M. A., Christensen, E. I. and Nielsen,
S. (1995). Redistribution of aquaporin-2 water channels
induced by vasopressin in rat kidney inner medullary collecting duct.
Am. J. Physiol. 269,C655
-C664.
Massague, J., Seoane, J. and Wotton, D. (2005).
Smad transcription factors. Genes Dev.
19,2783
-2810.
McHugh, K. M. (1995). Molecular analysis of
smooth muscle development in the mouse. Dev. Dyn.
204,278
-290.
Mendelsohn, C. (2004). Functional obstruction:
the renal pelvis rules. J. Clin. Invest.
113,957
-959.
Mendelsohn, C. (2006). Going in circles:
conserved mechanisms control radial patterning in the urinary and digestive
tracts. J. Clin. Invest.
116,635
-637.
Mitchell, E. K., Taylor, D. F., Woods, K., Davis, M. J., Nelson,
A. L., Teasdale, R. D., Grimmond, S. M., Little, M. H., Bertram, J. F. and
Caruana, G. (2006). Differential gene expression in the
developing mouse ureter. Gene Expr. Patterns
6, 519-538.
Miyazaki, Y., Tsuchida, S., Nishimura, H., Pope, J. C. t.,
Harris, R. C., McKanna, J. M., Inagami, T., Hogan, B. L., Fogo, A. and
Ichikawa, I. (1998). Angiotensin induces the urinary
peristaltic machinery during the perinatal period. J. Clin.
Invest. 102,1489
-1497.
Miyazaki, Y., Oshima, K., Fogo, A., Hogan, B. L. and Ichikawa,
I. (2000). Bone morphogenetic protein 4 regulates the budding
site and elongation of the mouse ureter. J. Clin.
Invest. 105,863
-873.
Miyazaki, Y., Oshima, K., Fogo, A. and Ichikawa, I.
(2003). Evidence that bone morphogenetic protein 4 has multiple
biological functions during kidney and urinary tract development.
Kidney Int. 63,835
-844.
Mombaerts, P., Wang, F., Dulac, C., Chao, S. K., Nemes, A.,
Mendelsohn, M., Edmondson, J. and Axel, R. (1996).
Visualizing an olfactory sensory map. Cell
87,675
-686.
Owens, G. K. (1995). Regulation of
differentiation of vascular smooth muscle cells. Physiol.
Rev. 75,487
-517.
Pipes, G. C., Creemers, E. E. and Olson, E. N.
(2006). The myocardin family of transcriptional coactivators:
versatile regulators of cell growth, migration, and myogenesis.
Genes Dev. 20,1545
-1556.
Raatikainen-Ahokas, A., Hytonen, M., Tenhunen, A., Sainio, K.
and Sariola, H. (2000). BMP-4 affects the differentiation of
metanephric mesenchyme and reveals an early anterior-posterior axis of the
embryonic kidney. Dev. Dyn.
217,146
-158.
Relaix, F., Rocancourt, D., Mansouri, A. and Buckingham, M.
(2004). Divergent functions of murine Pax3 and Pax7 in limb
muscle development. Genes Dev.
18,1088
-1105.
Schedl, A. (2007). Renal abnormalities and
their developmental origin. Nat. Rev. Genet.
8, 791-802.
Schmidt-Ott, K. M., Chen, X., Paragas, N., Levinson, R. S.,
Mendelsohn, C. L. and Barasch, J. (2006). c-kit delineates a
distinct domain of progenitors in the developing kidney. Dev.
Biol. 299,238
-249.
Sharma, M., Fopma, A., Brantley, J. G. and Vanden Heuvel, G.
B. (2004). Coexpression of Cux-1 and Notch signaling pathway
components during kidney development. Dev. Dyn.
231,828
-838.
Shepherd, T. G., Theriault, B. L. and Nachtigal, M. W.
(2008). Autocrine BMP4 signalling regulates ID3 proto-oncogene
expression in human ovarian cancer cells. Gene
414,95
-105.
Tena, J. J., Neto, A., de la Calle-Mustienes, E., Bras-Pereira,
C., Casares, F. and Gomez-Skarmeta, J. L. (2007). Odd-skipped
genes encode repressors that control kidney development. Dev.
Biol. 301,518
-531.
Vanden Heuvel, G. B., Bodmer, R., McConnell, K. R., Nagami, G.
T. and Igarashi, P. (1996). Expression of a cut-related
homeobox gene in developing and polycystic mouse kidney. Kidney
Int. 50,453
-461.
Wang, D. Z. and Olson, E. N. (2004). Control of
smooth muscle development by the myocardin family of transcriptional
coactivators. Curr. Opin. Genet. Dev.
14,558
-566.
Winyard, P. J., Risdon, R. A., Sams, V. R., Dressler, G. R. and
Woolf, A. S. (1996). The PAX2 tanscription factor is
expressed in cystic and hyperproliferative dysplastic epithelia in human
kidney malformations. J. Clin. Invest.
98,451
-459.
Woolf, A. S., Price, K. L., Scambler, P. J. and Winyard, P.
J. (2004). Evolving concepts in human renal dysplasia.
J. Am. Soc. Nephrol. 15,998
-1007.
Yu, J., Carroll, T. J. and McMahon, A. P.
(2002). Sonic hedgehog regulates proliferation and
differentiation of mesenchymal cells in the mouse metanephric kidney.
Development 129,5301
-5312.
Zhang, F., Nakanishi, G., Kurebayashi, S., Yoshino, K.,
Perantoni, A., Kim, Y. S. and Jetten, A. M. (2002).
Characterization of Glis2, a novel gene encoding a Gli-related, Kruppel-like
transcription factor with transactivation and repressor functions. Roles in
kidney development and neurogenesis. J. Biol. Chem.
277,10139
-10149.
Zhang, P. L., Peters, C. A. and Rosen, S.
(2000). Ureteropelvic junction obstruction: morphological and
clinical studies. Pediatr. Nephrol.
14,820
-826.
This article has been cited by other articles:
![]() |
D. Jenkins, X. Caubit, A. Dimovski, N. Matevska, C. M. Lye, F. Cabuk, Z. Gucev, V. Tasic, L. Fasano, and A. S. Woolf Analysis of TSHZ2 and TSHZ3 genes in congenital pelvi-ureteric junction obstruction Nephrol. Dial. Transplant., September 10, 2009; (2009) gfp453v1. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||