|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 December 2007
doi: 10.1242/dev.009662
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institut de Biologie du Développement de Marseille Luminy, UMR6216 CNRS Université de la Méditerranée, Case 907 Parc Scientifique de Luminy, 13288 Marseille Cedex 09, France.
* Author for correspondence (e-mail: kerridge{at}ibdml.univ-mrs.fr)
Accepted 30 October 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Hox, optix/Six3, Head, Trunk
| INTRODUCTION |
|---|
|
|
|---|
The morphological diversity along the anteroposterior axis of vertebrates
and invertebrates relies in part on the activity of Hox genes
(Kaufman et al., 1990
;
Lewis, 1978
). Hox proteins are
evolutionarily conserved transcription factors that control the expression of
downstream target genes (Graba et al.,
1997
; Pearson et al.,
2005
) through a DNA-binding domain called the homeodomain
(McGinnis et al., 1984
;
Scott and Weiner, 1984
). Hox
genes in most species reside in clusters. In Drosophila melanogaster,
they are localised in two complexes
(Kaufman et al., 1990
;
Lewis, 1978
): the Antennapedia
and Bithorax complexes. Hox genes are expressed according to the spatial
colinearity rule, with 3' genes acting in the head, median genes acting
in the trunk and 5' genes in the tail parts of the embryo. Loss of Hox
genes results in the transformation of one segment into a neighbouring,
usually anterior one, whereas ectopic Hox activity usually involves posterior
homeotic transformations (Gonzalez-Reyes
and Morata, 1991
; Lewis,
1978
).
On the basis of expression patterns and the sequence similarity of their
homeodomains, Hox proteins from a wide variety of species have been grouped
into three classes (Schubert et al.,
1993
; Duboule,
1994
; de Rosa et al.,
1999
): Anterior (A), Central (C) and Posterior (P). In
Drosophila, Labial (Lab) is an A class protein functional in the
head, Proboscipedia (Pb) is an A class protein with no known function during
embryogenesis, Deformed (Dfd) and Sex combs reduced (Scr) are divergent C
class proteins active mostly in gnathal segments, whereas Antennapedia (Antp),
Ultrabithorax (Ubx) and Abdominal A (AbdA) are C class proteins active in
thoracic and/or abdominal segments. Finally, Abdominal B (AbdB) is the sole P
class protein active in the tail as well as in the posterior trunk
(Sanchez-Herrero et al.,
1985
). To date, the only functional data relevant to this
classification is the ability of A and C class genes to rescue the
tritocerebrum mutant phenotype of the lab gene
(Hirth et al., 2001
).
As Hox genes are physically clustered on the chromosome, they probably
arose by tandem duplication and acquired novel functions during evolution
(Lewis, 1951
). Many targets of
Hox genes have been described (Graba et
al., 1997
; Pearson et al.,
2005
; Svingen and Tonissen,
2006
) that are controlled directly by individual, or at most
three, Hox proteins. Established targets therefore represent novel, acquired
functions, as none of the targets are regulated by all or the majority of Hox
genes. There is evidence however that most Hox genes have a common function
for the repression of head in the trunk, as their loss results in the
differentiation of head structures in each trunk segment in the fly and the
beetle Tribolium (Lewis, 1978
;
Stuart et al., 1991
;
Struhl, 1983
). This common
activity may therefore represent an ancient function. If so, Hox genes might
be expected to regulate common target genes or activities involved in head
development. Although some putative, common targets have been reported
recently in a microarray approach following ectopic expression of most, but
not all, Hox genes in the embryo (Hueber
et al., 2007
) no candidate for a common target of Hox proteins has
yet been identified.
Hox genes do not act alone for segment diversity of the embryo. In the
trunk, the zinc-finger protein Teashirt (Tsh) is co-expressed and acts with
Scr, Antp, Ubx, AbdA and AbdB (hereafter referred to as HoxCP) to promote
trunk. Importantly, the loss of all of these proteins causes a complete
transformation of the ventral trunk into head identity
(Roder et al., 1992
).
Consistent with the notion that Hox genes and tsh suppress head
identity, ectopic activity of Antp, Ubx, AbdA or Tsh replace certain head
identities with trunk structures
(Gonzalez-Reyes and Morata,
1990
; de Zulueta et al.,
1994
). Hox and tsh genes thus share a common activity to
repress head formation in the trunk. Additionally, to achieve their function,
Hox proteins usually need the presence of their co-factors, Extradenticle
(Exd) and Homothorax (Hth) (Mann,
1995
; Mann and Affolter,
1998
), which are also homeodomain proteins
(Ryoo and Mann, 1999
) and are
highly conserved in bilaterians (Moens and
Selleri, 2006
). Together, they form complexes that increase Hox
DNA-binding specificity to regulate their target genes.
In vertebrates and invertebrates Wnt genes have been implicated in a
variety of processes during embryogenesis
(Klingensmith and Nusse, 1994
;
Logan and Nusse, 2004
). In
Xenopus and fish, maternal Wnt/β-catenin signalling is crucial
for the organisation of the whole body plan, including the head. Later zygotic
Wnt/β-catenin is required for repression of head
(Niehrs, 1999
;
Popperl et al., 1997
) showing
that Wnt signalling promotes trunk at the expense of head. By contrast, though
much is known about the role of Drosophila Wingless (Wg) in
patterning the posterior region of each trunk segment
(Sanson, 2001
;
Wodarz and Nusse, 1998
), a
related role for Wg signalling in repressing head has not been identified.
Here, we show that the Six-gene family member optix, encoding a
conserved homeodomain protein normally limited to the head
(Kawakami et al., 2000
;
Seimiya and Gehring, 2000
), is
repressed by all C and P class Hox genes in the trunk or tail. Additionally,
we demonstrate that the Hox co-factors Extradenticle, Homothorax and Teashirt
are necessary for the repression of optix in the trunk, and that Wg
signalling and Engrailed contributes to this repression. Therefore,
Drosophila has developed multiple inputs to repress head development
in the trunk. From an evolutionary standpoint, we propose that one of the most
ancient functions of Hox genes is to repress head, a function shared with
other non-Hox genes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In situ hybridisation and immunostaining
For in situ hybridisation, Digoxigenen (DIG)-labelled antisense RNA probes
for optix, were generated by transcription with T3 RNA polymerase
(Promega) of NotI-digested LD05472 (BDGP: Berkeley
Drosophila genome Project) with DIG-RNA labelling mix containing the
UTPDIG (Roche). For wg a DIG-labelled antisense RNA probe was
generated by digestion with XbaI and transcription with T3 RNA
polymerase. Standard procedures were used, except that signals were amplified
using the Tyramide Signal Amplification kit (NEN Life Science). Primary
antibodies were: rat anti-Scr (1:200), mouse anti-Antp (1:10, DSHB,
Developmental Studies Hybridoma Bank), mouse anti-Ubx (1:1)
(White and Wilcox, 1985
), rat
anti-AbdA (1:400, J. Casanova), mouse anti-AbdB (1:10, DSHB), rabbit anti-Tsh
(1:1000, S. Cohen), rat anti-Elav (1:10, DSHB) and mouse anti-En (1:10, DSHB).
Embryos were mounted in Fluoromount-G (Southern Biotechnology Associates) and
analysed with an LSM 510 Zeiss confocal microscope.
RNAi production of tsh and optix hairpin loops
For dsRNA synthesis, three optix regions of 413, 570 and 375 base
pairs (bp) were amplified from the EST clone LD05472 (BDGP) by PCR with primer
pairs 5'CACCAGATTATAGCACCCAG3' and
5'CTTCTGCTCGCCATCCCAGA3'; 5'GCATCCAGCATAGCCAGAAC3' and
5'TGTAGGCAGCCGCGTAGGCC3'; and 5'CAGCGGGTCTGAGGTGTCCA3'
and 5'GGGGCCACTGGGACCGCCAT3' with T7 promoter sequence at the
5' end (5'TAATACGACTCACTATAGGGAGACCAC3'). The PCR product
served as template for the T7 transcription reaction with Ribomax Large Scale
Production kit (Promega). The dsRNAs were resuspended in DEPC-treated water,
quantified and diluted to 5 µM in DEPC-treated water. Embryos from 30
minute egg-collections of OreR flies were dechorionated, aligned on
heptane-glued cover slips, desiccated and covered with oil. Embryos injected
with dsRNA, were allowed to develop at 25°C and cuticles were prepared or
fixed and stained. RNAi probes for tsh were described by Laugier et
al. (Laugier et al., 2005
).
Control embryos were injected with DEPC-treated water.
| RESULTS |
|---|
|
|
|---|
To analyse the individual capacities of HoxCP genes to ensure this
function, we examined cuticles from embryos carrying individual Hox gene
activities in tsh HoxCP larvae. Cuticle preparations show that Scr
function represses head in the extreme anterior trunk but is incapable of
making denticles without Tsh (Fig.
1D) (see Roder et al.,
1992
). Antp, Ubx and AbdA similarly repress head
(Fig. 1E-G), but each acts in a
specific way: Antp induces denticles similar to those found in the thorax
(Fig. 1E, see legend), Ubx to
those found in the first abdominal segment
(Fig. 1F) and AbdA induces
denticles with second abdominal identity
(Fig. 1G). Finally, AbdB
represses head identity producing naked cuticle but does not induce denticles
(Fig. 1H). At the molecular
level, we have examined the expression of shaven baby (svb),
which is expressed in the cells destined to form denticles in the larva
(Payre et al., 1999
). For each
Hox gene capable of inducing denticles (Antp, Ubx or abdA),
svb is detected ventrally in each trunk segment where these genes are
active (see Fig. S1 in the supplementary material). The activities of Scr and
AbdB, in the absence of Tsh, are incapable of inducing svb expression
or denticles ventrally (see Fig. S1 in the supplementary material).
In conclusion, though only Tsh, Antp, Ubx and AbdA are capable of inducing denticles, Tsh, Scr, Antp, Ubx, AbdA and AbdB all contribute independently to the shared role of repressing head development.
|
In wild type, optix is expressed from the blastoderm stage in a
ring of cells at the anterior end of the embryo that is destined to form the
clypeolabrum, the pharynx and the acron, according to the projections on the
fate map (Fig. 2A)
(Seimiya and Gehring, 2000
).
At the end of germ band elongation (Fig.
2B), the anterior cephalic domain extends dorsally then is
separated in two parts, while new small patches of optix expression
appear in cells located in the lateral parts of the maxillary and labial
segments. By stage 14, optix is detected in the ectoderm covering the
supra oesophageal ganglion, which gives rise to certain parts of the brain
(Fig. 2C)
(Seimiya and Gehring, 2000
),
together with the patches observed in the gnathal segments.
The normal domains of optix are unchanged following the loss of HoxCP gene activities (Fig. 2A,D). However, ectopic optix expression is detected from stage 11 onwards in groups of epidermal cells in the extreme ventral and anterior part (Fig. 2D,F) of the labial, three thoracic, eight abdominal and a small group of cells in the ninth abdominal, segments (arrows Fig. 2D,F). The ectopic optix expression domains are not localised to the posterior domain of the segments in HoxCP embryos, where the majority of sclerotic plates develop (Fig. 1B)
Loss of tsh alone has no effect on the expression of optix (not shown). By contrast, the joint absence of HoxCP and tsh functions leads to a posterior enlargement of the ectopic patches of optix in each trunk segment (Fig. 2E,F) compared with loss of HoxCP genes alone (Fig. 2D).
We conclude that HoxCP genes are sufficient to repress optix in homologous anterior parts of each trunk segment, whereas HoxCP genes combine with tsh to repress optix in homologous, more posterior, ventral regions of each trunk segment.
The role of optix in head development
In light of these observations, we wondered whether Optix is required for
the normal development of the embryonic head and for the transformation of
trunk in tsh HoxCP embryos. We examined the cuticular phenotypes of
loss-of-function larvae either using three optix mutant alleles
(FlyBase), or induced by the injection of three different dsRNAi constructs
into wild-type embryos (Fig.
3A, n>400 embryos for each probe). Both techniques
gave similar phenotypes, suggesting that the insertion alleles are amorphs or
strong hypomorphs. Indeed, homozygotes and hemizygotes are indistinguishable
from each other and from optix RNAi-injected embryos. For the latter
(n=210), 70%-80% gave no signal upon hybridisation with
optix probes compared with control water-injected embryos
(n=154), where 95% of embryos exhibited expression (not shown).
|
As optix has an embryonic function in the head, it could be responsible for the crinkled cuticle present in the trunk of tsh HoxCP embryos. However, loss of optix, tsh and HoxCP genes or inactivation of optix and tsh by dsRNAi injection in HoxCP embryos were indistinguishable from tsh HoxCP mutants (Fig. 3F). We conclude that Optix is not the only factor responsible for the head morphology present in the trunk of such embryos. However, it represents an excellent molecular marker for head.
Finally, we examined the effects of early (Fig. 3G) and late (not shown) ectopic optix expression, to determine whether optix expression in the trunk is functional. In both cases, the trunk is abnormal with penetrant (95%, n=230) defects in germ band retraction (Fig. 3G) and in dorsal closure (not shown), suggesting that the negative regulation of optix in the trunk is important.
Individual capacities of Hox genes to repress optix
Next, we examined the individual capacities of HoxCP genes to
repress optix. Addition of Scr, Antp, Ubx, abdA or
AbdB genes individually in tsh HoxCP context results in the
loss of ectopic patches of optix in the domains where each Hox gene
is expressed (Fig. 4A-F).
Similar results were found on restoring individual Hox gene functions to
HoxCP embryos (data not shown). We conclude that Scr, Antp, Ubx,
abdA and AbdB are sufficient to repress optix in
homologous anterior parts of each trunk segment, where they are active.
We then asked whether the more anterior Hox genes lab, pb and
Dfd affected optix expression. Dfd is a divergent C
type Hox gene (Schubert et al.,
1993
), expressed in the maxillary and mandibular segments in
wild-type embryos (Chadwick and McGinnis,
1987
). Loss of Dfd induces ectopic optix
expression in the ventral part of the maxillary segment (arrow,
Fig. 4G). Products of the A
class gene lab are detected in the intercalary segment of wild-type
embryos (Diederich et al.,
1989
). Loss of lab causes no detectable effect on the
localisation of optix transcripts (compare
Fig. 4H with
Fig. 2B). To ensure that the
loss of lab does not affect the expression of optix, we
expressed lab ectopically in the absence of HoxCP genes
using the prd-Gal4 driver, which is expressed in a pair rule pattern.
No alteration in the ectopic expression of optix was detected
ventrally (not shown), showing that Lab is unable to repress optix in
the trunk. The A class Hox Pb is detected in the gnathal segments but has no
known function during embryogenesis (Pultz
et al., 1988
) and has no effect on the expression of
optix (not shown).
|
Effects of ectopic expression of Hox and tsh genes upon optix expression
Next, we asked whether ectopic Hox or tsh production
could repress optix expression in its normal domains in the head and
gnathal segments. Ubiquitous expression in the epidermis from stage 10 (using
69B-Gal4) of Tsh, Scr, Antp, Ubx, abdA and AbdB represses
optix in the late gnathal domains, but not in the initial domain in
the true head (Fig. 5A-C, not
shown). However, earlier production of Hox or Tsh proteins ubiquitously from
the blastoderm stage, using the nullo-Gal4 driver, strongly reduced
or removed optix expression in the initial head, as well as the
gnathal regions (Fig. 5D,E, not
shown).
We then analysed the effect of ubiquitous activity of Dfd, Lab and Pb on
optix expression. Mis-expressed Dfd does not repress optix
in the head or in the gnathal segments, the normal domain of Dfd expression
(Fig. 5F)
(Chadwick and McGinnis, 1987
);
however, the gnathal patches of optix are enlarged (compare
Fig. 5F,
Fig. 2B,C and
Fig. 5A) and in the thorax
ectopic optix is detected in pairs of lateral groups of cells. These
patches possibly correspond to ectopic maxillary structures (mouth hooks)
known to develop in these positions in larvae upon expression of Dfd
(Fig. 5F)
(Kuziora and McGinnis, 1988
)
and correlate with one role of optix for normal mouth hook
development (Fig. 3B-E).
Similarly, early (but not late) ectopic induction of Lab also results in
ectopic optix expression in the thorax
(Fig. 5G), where three pairs of
lateral patches of cells are detected. In addition in the maxillary and labial
segments, the patches of optix are enlarged (compare
Fig. 5A with F). Neither early
nor late ectopic Pb expression has any effect on the expression of
optix (not shown).
These results corroborate the idea that tsh and all Hox genes active in the embryo can regulate the optix gene. However, only tsh, central and posterior Hox genes have a common function to repress the expression of optix, each acting in distinct domains of the gnathal and/or trunk domains of the ventral epidermis. The A class genes lab and pb, are the only Hox genes that cannot repress optix expression. Although Dfd represses optix in the ventral maxillary epidermis (Fig. 4G), ectopic assays indicate that Dfd and Lab, but not Pb, are capable of activating optix in more lateral positions.
The Hox co-factors Extradenticle and Homothorax repress optix expression in the trunk
To increase their DNA-binding specificity and regulate their targets, Hox
proteins require the activity of co-factors
(Mann, 1995
;
Mann and Affolter, 1998
;
Mann and Chan, 1996
) including
Exd and Hth. We examined optix expression in exd and
hth embryos. For both, optix is expressed ectopically in a
large ventral part of twelve trunk [maxillary (Mx) to A7] segments from stage
11 onwards (Fig. 6A-D). Ectopic
optix expression is more intense in the posterior two gnathal and
thoracic segments compared with the abdominal domains of these embryos,
indicating a thoracic transformation to a more anterior identity, which is
coherent with the differentiation of head-like, crinkled cuticle in the thorax
of the larvae (insets Fig.
6E,F). In addition, in A8, where AbdB is strongly detected in the
epidermis (Fig. 6A,B), and A9,
optix is neither detected in exd nor hth embryos.
We conclude that these Hox co-factors are required for the prevention (by Hox
protein) of head development and/or optix expression in the trunk,
with the exception of A8 and 9.
|
With this aim, we removed en or wg in tsh HoxCP embryos. In both contexts, optix expression is detected throughout the ventral part of each trunk segment with far fewer ventral cells that are devoid of optix signal (Fig. 7C,D). In embryos that lack only wg or en function, no ectopic activation of optix is seen (not shown) implying that the repressive action of Wg or En upon optix relies on the absence of Hox and Tsh proteins. Ectopic Wg or En production has no clear effect on the normal expression of optix (not shown). These results are perhaps not surprising, as these genes are normally co-expressed in specific cells in the head (Fig. 2F, Fig. 7A). These results favour the idea that Wg signalling and En contribute to the suppression of head development in the Drosophila trunk, but these activities are only revealed in the absence of Hox and Tsh (Fig. 7E).
| DISCUSSION |
|---|
|
|
|---|
|
The A class Hox genes, lab and pb, are not involved in the repression of optix during embryogenesis. As Lab, like optix, is expressed and active in the true head, this is not surprising. However, lab is able to activate optix, following early and continuous ectopic expression. pb is not active in the embryo and is not able to repress or activate optix. Thus, optix is a common target of all seven fly Hox genes that are active in the embryo.
Genes outside of the Hox complex contribute to head repression in the trunk
We further document that tsh contributes to the morphological
repression of head (de Zulueta et al.,
1994
; Roder et al.,
1992
), and the molecular repression of optix in the trunk
(Fig. 2E). However, loss of Tsh
alone does not cause derepression of optix in the trunk; its activity
is only revealed when HoxCP genes are absent, showing that Tsh and
HoxCP genes have common functions. Interestingly three vertebrate
orthologues of tsh have been described that are expressed in distinct
caudal rostral and dorsal ventral domains of the mouse embryo
(Caubit et al., 2000
;
Manfroid et al., 2004
).
In addition, Exd and Hth repress optix in the maxillary, labial,
thoracic and first seven abdominal segments
(Fig. 6A-D). The highly
conserved nature of these Hox co-factors and our observations support the
notion that the Hox/Exd/Hth interaction is an ancient one. However, there is
one exception to this rule. Ectopic expression of optix is not
detected in the eighth or ninth abdominal segments, where the AbdB, P class,
Hox protein acts, in either exd
(Fig. 6A) or hth
mutant embryos (Fig. 6B). Exd
binds to Hox proteins via the hexapeptide motif and specific C-terminal
regions (Chang et al., 1995
;
Knoepfler and Kamps, 1995
).
Unique among Hox proteins, AbdB does not possess the classical hexapeptide
motif and has not been reported to bind Exd in vitro
(Mann and Affolter, 1998
). Our
results suggest that AbdB can repress optix
(Fig. 4F,
Fig. 6A,B) in the absence of
these co-factors; its ability to act independently of these co-factors has
already been shown for the formation of the filzkörpers
(Peifer and Wieschaus,
1990
).
|
|
Tsh and HoxCP proteins do not repress the expression of optix in
ventral posterior regions of the trunk segments
(Fig. 2E), but do so when Wg or
En are also abrogated. As loss of en, wg or tsh or in double
combinations does not lead to ectopic optix expression in the trunk,
our results favour the idea that Wg signalling and En share a common function
with tsh and HoxCP genes to repress head in the trunk. We
note that Tsh has been implicated in the late function of Wg signalling for
the patterning of the trunk segments
(Gallet et al., 1998
;
Gallet et al., 1999
) and that
Exd is required for the maintenance of wg, en and tsh
transcription (Peifer and Wieschaus,
1990
; Rauskolb and Wieschaus,
1994
), which could explain the extent of optix ectopic
patches in this context (Fig.
6A,D).
This is the first evidence suggesting that Wg signalling is capable of
repressing head in any invertebrate species, though this is a well documented
function for Wnt signalling in vertebrates
(Niehrs, 1999
;
Popperl et al., 1997
). The
role of wg for the suppression of head in the fly trunk is masked by
a redundant, activity shared by HoxCP and Tsh factors. In the brain of mice
lacking Six3 (optix orthologue), Wnt1 expression is
extended anteriorly, leading to posteriorisation of the brain. Thus, forebrain
regionalisation requires the repression of Wnt1 by Six3
(Lagutin et al., 2003
).
Role of Optix during embryonic head development
The phenotypic analysis of optix during embryogenesis reveals that
it acts in the labrum (Fig. 3):
its initial blastoderm domain of expression
(Fig. 2A). Additionally,
optix is involved in the normal development of the mouth hooks
(Fig. 3D) and is detected in a
pair of cells from stage 11 in the maxillary segment from which the hooks
derive (Fig. 2B). Previously,
Optix has been shown to induce ectopic eye development
(Seimiya and Gehring, 2000
) in
the adult, following ectopic optix production. In all organisms
tested, the expression of Six3 is limited to the forebrain and the
optic vesicles. In vertebrates, gain of function induces an enlarged brain and
eye or ectopic retina or lens development
(Bovolenta et al., 1998
;
Liu et al., 2006
;
Loosli et al., 1999
;
Zuber et al., 1999
), whereas
loss of function leads to the failure of forebrain development or eye
formation (Carl et al., 2002
;
Lagutin et al., 2003
). Six3
family members, including Optix, therefore have activities restricted to parts
of the head.
Evolutionary considerations
Bilaterians (especially the chordates) possess both Hox and parologous Para
Hox complexes (Garcia-Fernandez,
2005
). Analysis of these clusters indicates that they arose by
gene duplication and divergence. A recent study has compared the Hox and
paraHox complexes from both triploblast and diploblast (cniderians) species
and suggests that the original `protoHox' complex was made up of only anterior
class Hox genes (Chourrout et al.,
2006
). This idea is consistent with the observation that, during
embryogenesis of vertebrate and some invertebrate
(Scholtz et al., 1994
)
species, the head is the first to develop morphologically, with the central
parts added on during later steps of development. Furthermore, one school of
thought favours the idea, from the observation of gene expression patterns in
cnidarian species, that ancient organisms possessed a large head with no trunk
and reduced tail parts (Meinhardt,
2002
). Our results favour the idea that head is evolutionarily
more primitive than trunk, as the C and P Hox genes repress head and the head
specific gene optix in the trunk. Early ectopic expression of the
sole A class Hox that is active in the embryo, Lab, can activate
optix (Fig. 5G). This
effect may represent a vestige of the most ancient Hox function: the
modification of head identity (see Hirth
et al., 2001
).
In conclusion, we show that HoxCP genes share a common role to suppress head development in the trunk in addition to their well documented, novel roles for segment identity. This common function has been retained by all central and posterior Hox proteins, as well as by their co-actors Exd, Hth, Tsh, Wg and En. Clearly, our results favour the idea that complex organisms have acquired multiple factors to repress head, as well as the acquisition of novel functions to diversify the trunk. As these factors are conserved in vertebrates, we expect these roles, at least in part, to be conserved.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/2/291/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bovolenta, P., Mallamaci, A., Puelles, L. and Boncinelli, E. (1998). Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors. Mech. Dev. 70,201 -203.[CrossRef][Medline]
Carl, M., Loosli, F. and Wittbrodt, J. (2002).
Six3 inactivation reveals its essential role for the formation and patterning
of the vertebrate eye. Development
129,4057
-4063.
Carroll, S. B. (1995). Homeotic genes and the evolution of arthropods and chordates. Nature 376,479 -485.[CrossRef]
Casanova, J., Sanchez-Herrero, E., Busturia, A. and Morata, G. (1987). Double and triple mutant combinations of bithorax complex of Drosophila. EMBO J. 6,3103 -3109.[Medline]
Caubit, X., Core, N., Boned, A., Kerridge, S., Djabali, M. and Fasano, L. (2000). Vertebrate orthologues of the Drosophila region-specific patterning gene teashirt. Mech. Dev. 91,445 -448.[CrossRef]
Chadwick, R. and McGinnis, W. (1987). Temporal and spatial distribution of transcripts from the Deformed gene of Drosophila. EMBO J. 6,779 -789.[Medline]
Chang, C. P., Shen, W. F., Rozenfeld, S., Lawrence, H. J.,
Largman, C. and Cleary, M. L. (1995). Pbx proteins display
hexapeptide-dependent cooperative DNA binding with a subset of Hox proteins.
Genes Dev. 9,663
-674.
Chourrout, D., Delsuc, F., Chourrout, P., Edvardsen, R. B., Rentzsch, F., Renfer, E., Jensen, M. F., Zhu, B., de Jong, P., Steele, R. E. et al. (2006). Minimal ProtoHox cluster inferred from bilaterian and cnidarian Hox complements. Nature 442,684 -687.[CrossRef][Medline]
de Rosa, R., Grenier, J. K., Andreeva, T., Cook, C. E., Adoutte, A., Akam, M., Carroll, S. B. and Balavoine, G. (1999). Hox genes in brachiopods and priapulids and protostome evolution. Nature 399,772 -776.[CrossRef][Medline]
de Zulueta, P., Alexandre, E., Jacq, B. and Kerridge, S. (1994). Homeotic complex and teashirt genes co-operate to establish trunk segmental identities in Drosophila. Development 120,2287 -2296.[Abstract]
Diederich, R. J., Merrill, V. K., Pultz, M. A. and Kaufman, T.
C. (1989). Isolation, structure, and expression of
labial, a homeotic gene of the Antennapedia Complex involved in
Drosophila head development. Genes Dev.
3, 399-414.
Duboule, D. (1994). A Guidebook to Homeobox Genes. Oxford: Oxford University Press.
FlyBase Consortium (1999). The FlyBase database
of the Drosophila Genome Projects and community literature. Nucleic
Acids Res. 27,85
-88.
Gallet, A., Erkner, A., Charroux, B., Fasano, L. and Kerridge, S. (1998). Trunk-specific modulation of Wingless signalling in Drosophila by Teashirt binding to Armadillo. Curr. Biol. 8,893 -902.[CrossRef][Medline]
Gallet, A., Angelats, C., Erkner, A., Charroux, B., Fasano, L. and Kerridge, S. (1999). The C-terminal domain of Armadillo binds to hypophosphorylated Teashirt to modulate Wingless signalling in Drosophila. EMBO J. 18,2208 -2217.[CrossRef][Medline]
Garcia-Fernandez, J. (2005). The genesis and evolution of homeobox gene clusters. Nat. Rev. Genet. 6, 881-892.[Medline]
Gebelein, B., Culi, J., Ryoo, H. D., Zhang, W. and Mann, R. S. (2002). Specificity of Distalless repression and limb primordia development by abdominal Hox proteins. Dev. Cell 3,487 -498.[CrossRef][Medline]
Gebelein, B., McKay, D. J. and Mann, R. S. (2004). Direct integration of Hox and segmentation gene inputs during Drosophila development. Nature 431,653 -659.[CrossRef][Medline]
Gonzalez-Reyes, A. and Morata, G. (1990). The developmental effect of overexpressing a Ubx product in Drosophila embryos is dependent on its interactions with other homeotic products. Cell 61,515 -522.[CrossRef][Medline]
Gonzalez-Reyes, A. and Morata, G. (1991). Organization of the Drosophila head as revealed by the ectopic expression of the Ultrabithorax product. Development 113,1459 -1471.[Abstract]
Graba, Y., Aragnol, D. and Pradel, J. (1997). Drosophila Hox complex downstream targets and the function of homeotic genes. BioEssays 19,379 -388.[CrossRef][Medline]
Hazelrigg, T. and Kaufman, T. C. (1983).
Revertants of dominant mutations associated with the antennapedia gene complex
of Drosophila melanogaster: cytology and genetics.
Genetics 105,581
-600.
Hirth, F., Loop, T., Egger, B., Miller, D. F., Kaufman, T. C.
and Reichert, H. (2001). Functional equivalence of
Hox gene products in the specification of the tritocerebrum during
embryonic brain development of Drosophila. Development
128,4781
-4788.
Hueber, S., Bezdan, D., Henz, S., Blank, M., Wu, H. and Lohmann,
I. (2007). Comparative analysis of Hox downstream genes in
Drosophila. Development
134,381
-392.
Jürgens, G., Lehmann, R., Scharding, M. and Nüsslein-Volhard, C. (1986). Segmental organization of the head in the embryo of Drosophila melanogaster: a blastoderm fate map of the cuticle structures of the larval head. Roux's Arch. Dev. Biol. 195,359 -377.[CrossRef]
Kaufman, T. C., Seeger, M. A. and Olsen, G. (1990). Molecular and genetic organization of the Antennapedia gene complex of Drosophila melanogaster. Adv. Genet. 27,309 -362.
Kawakami, K., Sato, S., Ozaki, H. and Ikeda, K. (2000). Six family genes structure and function as transcription factors and their roles in development. BioEssays 22,616 -626.[CrossRef][Medline]
Klingensmith, J. and Nusse, R. (1994). Signaling by wingless in Drosophila. Dev. Biol. 166,396 -414.[CrossRef][Medline]
Knoepfler, P. S. and Kamps, M. P. (1995). The pentapeptide motif of Hox proteins is required for cooperative DNA binding with Pbx1, physically contacts Pbx1, and enhances DNA binding by Pbx1. Mol. Cell. Biol. 15,5811 -5819.[Abstract]
Kuziora, M. A. and McGinnis, W. (1988). Autoregulation of a Drosophila homeotic selector gene. Cell 55,477 -485.[CrossRef][Medline]
Lagutin, O. V., Zhu, C. C., Kobayashi, D., Topczewski, J.,
Shimamura, K., Puelles, L., Russell, H. R., McKinnon, P. J., Solnica-Krezel,
L. and Oliver, G. (2003). Six3 repression of Wnt signaling in
the anterior neuroectoderm is essential for vertebrate forebrain development.
Genes Dev. 17,368
-379.
Laugier, E., Yang, Z., Fasano, L., Kerridge, S. and Vola, C. (2005). A critical role of teashirt for patterning the ventral epidermis is masked by ectopic expression of tiptop, a paralog of teashirt in Drosophila. Dev. Biol. 283,446 -458.[CrossRef][Medline]
Lewis, E. B. (1951). Pseudoallelism and gene evolution. Cold Spring Harb. Symp. Quant. Biol. 16,159 -174.[Medline]
Lewis, E. B. (1978). A gene complex controlling segmentation in Drosophila. Nature 276,565 -570.[CrossRef][Medline]
Liu, W., Lagutin, O. V., Mende, M., Streit, A. and Oliver, G. (2006). Six3 activation of Pax6 expression is essential for mammalian lens induction and specification. EMBO J. 25,5383 -5395.[CrossRef][Medline]
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 20,781 -810.[CrossRef][Medline]
Loosli, F., Winkler, S. and Wittbrodt, J.
(1999). Six3 overexpression initiates the formation of ectopic
retina. Genes Dev. 13,649
-654.
Manfroid, I., Caubit, X., Kerridge, S. and Fasano, L.
(2004). Three putative murine Teashirt orthologues specify trunk
structures in Drosophila in the same way as the Drosophila teashirt
gene. Development 131,1065
-1073.
Mann, R. S. (1995). The specificity of homeotic gene function. BioEssays 17,855 -863.[CrossRef][Medline]
Mann, R. S. and Chan, S. K. (1996). Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet. 12,258 -262.[CrossRef][Medline]
Mann, R. S. and Affolter, M. (1998). Hox proteins meet more partners. Curr. Opin. Genet. Dev. 8, 423-429.[CrossRef][Medline]
McGinnis, W., Levine, M. S., Hafen, E., Kuroiwa, A. and Gehring, W. J. (1984). A conserved DNA sequence in homoeotic genes of the Drosophila Antennapedia and Bithorax complexes. Nature 308,428 -433.[CrossRef][Medline]
Meinhardt, H. (2002). The radial-symmetric hydra and the evolution of the bilateral body plan: an old body became a young brain. BioEssays 24,185 -191.[CrossRef][Medline]
Merrill, V. K., Diederich, R. J., Turner, F. R. and Kaufman, T. C. (1989). A genetic and developmental analysis of mutations in labial, a gene necessary for proper head formation in Drosophila melanogaster. Dev. Biol. 135,376 -391.
Moens, C. B. and Selleri, L. (2006). Hox cofactors in vertebrate development. Dev. Biol. 291,193 -206.[CrossRef][Medline]
Niehrs, C. (1999). Head in the WNT: the molecular nature of Spemann's head organizer. Trends Genet. 15,314 -319.[CrossRef][Medline]
Payre, F., Vincent, A. and Carreno, S. (1999). ovo/svb integrates Wingless and DER pathways to control epidermis differentiation. Nature 400,271 -275.[CrossRef][Medline]
Pearson, J. C., Lemons, D. and McGinnis, W. (2005). Modulating Hox gene functions during animal body patterning. Nat. Rev. Genet. 6, 893-904.[CrossRef][Medline]
Peifer, M. and Wieschaus, E. (1990). Mutations
in the Drosophila gene extradenticle affect the way specific homeo
domain proteins regulate segmental identity. Genes
Dev. 4,1209
-1223.
Popperl, H., Schmidt, C., Wilson, V., Hume, C. R., Dodd, J., Krumlauf, R. and Beddington, R. S. (1997). Misexpression of Cwnt8C in the mouse induces an ectopic embryonic axis and causes a truncation of the anterior neuroectoderm. Development 124,2997 -3005.[Abstract]
Pultz, M. A., Diederich, R. J., Cribbs, D. L. and Kaufman, T.
C. (1988). The proboscipedia locus of the Antennapedia
complex: a molecular and genetic analysis. Genes Dev.
2, 901-920.
Rauskolb, C. and Wieschaus, E. (1994). Coordinate regulation of downstream genes by Extradenticle and the homeotic selector proteins. EMBO J. 13,3561 -3569.[Medline]
Rauskolb, C., Smith, K. M., Peifer, M. and Wieschaus, E. (1995). Extradenticle determines segmental identities throughout Drosophila development. Development 121,3663 -3673.[Abstract]
Rieckhof, G. E., Casares, F., Ryoo, H. D., Abu-Shaar, M. and Mann, R. S. (1997). Nuclear translocation of Extradenticle requires homothorax, which encodes an Extradenticle related homeodomain protein. Cell 91,171 -183.[CrossRef][Medline]
Riley, P. D., Carroll, S. B. and Scott, M. P.
(1987). The expression and regulation of Sex combs reduced
protein in Drosophila embryos. Genes Dev.
1, 716-730.
Roder, L., Vola, C. and Kerridge, S. (1992). The role of the teashirt gene in trunk segmental identity in Drosophila. Development 115,1017 -1033.[Abstract]
Ryoo, H. D. and Mann, R. S. (1999). The control
of trunk Hox specificity and activity by Extradenticle. Genes
Dev. 13,1704
-1716.
Sanchez-Herrero, E., Vernos, I., Marco, R. and Morata, G. (1985). Genetic organization of Drosophila bithorax complex. Nature 313,108 -113.[CrossRef][Medline]
Sanson, B. (2001). Generating patterns from fields of cells. Examples from Drosophila segmentation. EMBO Rep. 2,1083 -1108.[CrossRef][Medline]
Scholtz, G., Patel, N. H. and Dohle, W. (1994). Serially homologous engrailed stripes are generated via different cell lineages in the germ band of amphipod crustaceans (Malacostraca, Peracarida). Int. J. Dev. Biol. 38,471 -478.[Medline]
Schubert, F. R., Nieselt-Struwe, K. and Gruss, P.
(1993). The Antennapedia-type homeobox genes have evolved from
three precursors separated early in metazoan evolution. Proc. Natl.
Acad. Sci. USA 90,143
-147.
Scott, M. P. and Weiner, A. J. (1984).
Structural relationships among genes that controldevelopment: sequence
homology between the Antennapedia, Ultrabithorax, and fushi
tarazu loci of Drosophila. Proc. Natl. Acad. Sci.
USA 81,4115
-4119.
Seimiya, M. and Gehring, W. J. (2000). The Drosophila homeobox gene optix is capable of inducing ectopic eyes by an eyeless-independent mechanism. Development 127,1879 -1886.[Abstract]
Snodgrass, R. E. (1938). Evolution of Annelida, Onychophora and Arthropoda. Smithson. Misc. Coll. 138.
Struhl, G. (1983). Role of the esc+ gene product in ensuring the selective expression of segment specific homeotic genes in Drosophila. J. Embryol. Exp. Morphol. 76,297 -331.[Medline]
Stuart, J., Brown, S., Beeman, R. and Denell, R. (1991). A deficiency of the homeotic complex of the beetle Tribolium. Nature 350,72 -74.[CrossRef][Medline]
Svingen, T. and Tonissen, K. F. (2006). Hox transcription factors and their elusive mammalian gene targets. Heredity 97,88 -96.[CrossRef][Medline]
Wakimoto, B. T. and Kaufman, T. C. (1981). Analysis of larval segmentation in lethal genotypes associated with the Antennapedia gene complex in Drosophila melanogaster. Dev. Biol. 81,51 -64.
White, R. A. and Wilcox, M. (1985). Distribution of Ultrabithorax proteins in Drosophila. EMBO J. 4,2035 -2043.[Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14,59 -88.[CrossRef][Medline]
Zuber, M. E., Perron, M., Philpott, A., Bang, A. and Harris, W. A. (1999). Giant eyes in Xenopus laevis by overexpression of XOptx2. Cell 98,341 -352.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
A. Hijazi, W. Masson, B. Auge, L. Waltzer, M. Haenlin, and F. Roch boudin is required for septate junction organisation in Drosophila and codes for a diffusible protein of the Ly6 superfamily Development, July 1, 2009; 136(13): 2199 - 2209. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||