spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 11 September 2008
doi: 10.1242/dev.022830


Development 135, 3355-3367 (2008)
Published by The Company of Biologists 2008


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.022830v1
135/20/3355    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mudumana, S. P.
Right arrow Articles by Drummond, I. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mudumana, S. P.
Right arrow Articles by Drummond, I. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

odd skipped related1 reveals a novel role for endoderm in regulating kidney versus vascular cell fate

Sudha P. Mudumana1, Dirk Hentschel2, Yan Liu1, Aleksandr Vasilyev1 and Iain A. Drummond1,*

1 Nephrology Division, Massachusetts General Hospital, Charlestown, MA 02129, USA.
2 Renal Division, Brigham and Women's Hospital, Boston, MA 02115, USA.

* Author for correspondence (e-mail: idrummon{at}receptor.mgh.harvard.edu)

Accepted 26 August 2008


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The kidney and vasculature are intimately linked both functionally and during development, when nephric and blood/vascular progenitor cells occupy adjacent bands of mesoderm in zebrafish and frog embryos. Developmental mechanisms that underlie the differentiation of kidney versus blood/vascular lineages remain unknown. The odd skipped related1 (osr1) gene encodes a zinc-finger transcription factor that is expressed in the germ ring mesendoderm and subsequently in the endoderm and intermediate mesoderm, prior to the expression of definitive kidney or blood/vascular markers. Knockdown of osr1 in zebrafish embryos resulted in a complete, segment-specific loss of anterior kidney progenitors and a compensatory increase in the number of angioblast cells in the same trunk region. Histology revealed a subsequent absence of kidney tubules, an enlarged cardinal vein and expansion of the posterior venous plexus. Altered kidney versus vascular development correlated with expanded endoderm development in osr1 knockdowns. Combined osr1 loss of function and blockade of endoderm development by knockdown of sox32/casanova rescued anterior kidney development. The results indicate that osr1 activity is required to limit endoderm differentiation from mesendoderm; in the absence of osr1, excess endoderm alters mesoderm differentiation, shifting the balance from kidney towards vascular development.

Key words: Odd-skipped related, Endoderm, Pronephros, Vasculature, Glomerulus, Kidney development, Zebrafish


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The kidney and vasculature are mesodermal derivatives that originate from adjacent regions of gastrulating fish and frog embryos (Iraha et al., 2002Go; Kimelman, 2006Go; Kimmel et al., 1990Go; Walmsley et al., 2002Go). Soon after gastrulation is complete, zebrafish kidney progenitors, which are marked by the expression of transcriptional regulators such as pax2a (Krauss et al., 1991Go; Majumdar et al., 2000Go) and lim1 (Toyama and Dawid, 1997Go), and blood/vascular progenitors, which are marked by expression of scl (Gering et al., 1998Go) and gata1 (Detrich et al., 1995Go), are found in adjacent stripes of mesoderm lateral to the somites. These tissues, referred to as intermediate mesoderm (IM) in nephric development and lateral plate mesoderm (LPM) in blood vascular development, serve as the source of all pronephric cells, the posterior blood islands, and the main vessels of the trunk, the dorsal aorta and the cardinal vein. Analysis of mesoderm patterning in frog embryos has demonstrated overlapping expression of the vascular marker fli1 and the kidney marker lim1 in intermediate mesoderm (Walmsley et al., 2002Go), suggesting that, prior to cell differentiation, kidney and blood/vascular cells may share a common progenitor cell population. The close association of kidney and vascular progenitor cells during development is ultimately manifested as a functional relationship in the mature organs, where arterial blood is filtered by the kidney glomerulus and metabolites recovered by kidney tubules are delivered directly back to the venous blood supply. This relationship between kidney and vascular tissues raises the idea that the specification of kidney and vascular progenitor cells in early embryos may be influenced by common developmental regulatory factors.

Both kidney and vascular patterning is strongly influenced by bone morphogenetic proteins (BMPs) during gastrulation (Kimelman, 2006Go; Kimelman and Griffin, 2000Go; Pyati et al., 2005Go; Stickney et al., 2007Go; Szeto and Kimelman, 2004Go). Zebrafish mutants defective in BMP signaling, such as swirl/bmp2b (Kishimoto et al., 1997Go; Nguyen et al., 1998Go), snailhouse/bmp7 (Dick et al., 2000Go; Schmid et al., 2000Go) and somitabun/smad5 (Hild et al., 1999Go), show a reduced number of both kidney and blood cell progenitors, and an expansion of dorsal somites. However, ventralized/posteriorized mutants that lack BMP inhibitors such as chordino/chordin and the tolloid antagonist ogon/sizzled show an enlargement of kidney and blood precursor cell populations and a loss of anterior somites (Hammerschmidt et al., 1996Go; Leung et al., 2005Go; Miller-Bertoglio et al., 1999Go). Signaling events occurring later in development may also affect kidney versus blood/vascular fates. Post-gastrulation expression of a dominant-negative BMP receptor expands the gata1-positive blood progenitor cell population and reduces the number of pax2a-positive kidney progenitor cells in the ventroposterior mesoderm (Gupta et al., 2006Go). Mutations in BMP4 affect ventrolateral mesoderm at post-gastrulation stages, favoring blood and kidney development at the expense of vascular development (Stickney et al., 2007Go). Evidence has also been presented that blood/vascular and kidney fates may be mutually exclusive in the mesoderm. Ectopic overexpression of the blood/vascular transcriptional regulators scl and lmo2 during early development results in expansion of the blood/vascular progenitor cell population at the expense of kidney progenitors, indicating that intermediate mesoderm can be transfated to blood/vasculature mesoderm (Gering et al., 2003Go). These findings suggest that the differentiation of the blood/vascular and kidney lineages are linked at multiple stages of development. It is likely that, in addition to BMP signaling, other morphogens and transcriptional circuitry is required to ultimately define lateral mesoderm cell lineages.

The zinc-finger transcription factor odd-skipped related 1 (osr1) is initially expressed in the mesendoderm in gastrulating zebrafish embryos and, later, in a broad domain of lateral plate/intermediate mesoderm that encompasses both kidney and vascular mesoderm in chick, mouse and zebrafish embryos (James et al., 2006Go; Tena et al., 2007Go; Wang et al., 2005Go). Mouse embryos lacking a functional Osr1 gene show cardiac defects and kidney agenesis (James et al., 2006Go; Wang et al., 2005Go). Knockdown experiments in zebrafish have also revealed a role for osr1 in pronephric development (Tena et al., 2007Go). We present here evidence that osr1 is not only required for zebrafish kidney development but that it also controls the commitment of mesoderm to the angioblast cell fate. Surprisingly, we find that the function of osr1 in post-gastrulation mesoderm differentiation is linked to an early role in regulating mesoderm versus endoderm differentiation during gastrulation. Our findings reveal a novel role for endoderm in determining the balance of kidney versus angioblast cell differentiation during somitogenesis.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid constructs
The zebrafish osr1 gene was identified by tblastn search of zebrafish genomic DNA sequence (Sanger Center zebrafish genome project; http://www.sanger.ac.uk/Projects/D_rerio/) using mouse Osr1 protein sequence as query. Reverse blastx using zebrafish osr1 coding sequence as query against GenBank confirmed the zebrafish gene as the closest osr1 ortholog. Full-length osr1 was amplified by RT-PCR from RNA obtained from 24 hpf wild-type Tü/AB embryos and cloned into pCR4 vector. Additional plasmid probes (lim1, pax2a, pax8, nbc1, nephrin, wt1a, ae2, myoD, ret1, scl, gata1, flk1, nkx2.5, etsrp1, pu.1 and trpm7) have been previously described. Synthetic capped mRNAs for rescue experiments were synthesized from linearized full-length plasmid constructs using mMessage Machine kit (Ambion, USA). Specifically, pax2a mRNA and osr1 mRNA was obtained by in vitro transcription with sp6 polymerase from a NotI-linearized and a KpnI-linearized full-length construct, respectively.

Zebrafish embryos
Wild-type zebrafish were maintained according to established protocols (Westerfield, 1995Go). The embryos for experiments were collected from crosses of wild-type Tü/AB adults, grown at 28°C and fixed at the indicated developmental stages. bonnie and clyde homozygous mutant embryos were obtained from an incross of bonm425/+ heterozygotes.

Morpholino antisense oligonucleotides
Morpholino oligonucleotides were designed to either target the translation start site or the splice donor site of target mRNAs. The following morpholino oligonucleotides were used: osr1 ex2d (osr1MO), ATCTCATCCTTACCTGTGGTCTCTC; osr1 ATG, GGAGCGTCTTACTACCCATGACTAA; osr1CoMO, AATCAGTACCCATCATTCTGCGAGG; scl ATG, GCTCGGATTTCAGTTTTTCCATCAT (Sumanas and Lin, 2006Go); pax2a E2, TATGTGCTTTTTCTTACCTTCCGAG; pax8 E5, TTTCTGCACTCACTGTCATCGTGTC (Hans et al., 2004Go); pax8 E9, ACCGGCGGCAGCTCACCTGATACCA (Hans et al., 2004Go); sox32 ATG,CAGGGAGCATCCGGTCGAGATACAT (Dickmeis et al., 2001Go).

Microinjections and molecular analysis
Morpholino oligonucleotides were diluted in 100 mM KCl and 10 mM HEPES and injections were performed using a nanoliter2000 microinjector (World Precision Instruments). Injection concentrations ranged from 0.05 mM to 0.2 mM and injection volume was set at 4.6 nl/embryo (1.4-7.4 ng/embryo). Efficiency of morpholino splicing was confirmed by RT-PCR. Total RNA from single embryos at different stages was isolated using Trizol according to the manufacturer's instructions. RT followed by nested PCR was performed with gene-specific nested forward and reverse primers, and purified for sequencing. Full-length mRNAs were injected into one- to two-cell embryos and grown at 28°C for further analysis.

Whole-mount in situ hybridization and immunohistochemistry
Whole-mount in situ hybridization on embryos of different stages was performed using antisense RNA probes labeled with digoxigenin or fluorescein (Boehringer Mannheim, Germany) as described previously (Thisse et al., 2004Go). Stained embryos were fixed, cleared with dimethylformamide, transferred into PBS:Glycerol (1:1) and photographed on a Leitz MZ12 or Nikon E800 microscope equipped with Spot Image digital camera. Whole-mount immunohistochemistry for NaK ATPase (alpha6F monoclonal) was performed as described by Drummond et al. (Drummond et al., 1998Go). Whole-mount double fluorescent in situ hybridization was performed as described previously [S. Holley, Yale University, CT, personal communication (Julich et al., 2005Go; Liu et al., 2007Go)]. Stained embryos were dehydrated in methanol, cleared with 2:1 benzyl benzoate:benzyl alcohol, and examined with a Zeiss LSM5 Pascal-confocal microscope. For in situ hybridization of sections, embryos were sectioned in JB-4 to a thickness of 10 µm and examined using a Nikon E800 microscope.

Histochemistry
Embryos for histological analysis were fixed with 4% paraformaldehyde (PFA) in PBS overnight, followed by dehydration and embedding in JB-4 (Polysciences) and sectioned at 5-7 µm. Slides were stained in Methylene Blue/Azure II (Humphrey and Pittman, 1974Go).

Acridine Orange and TUNEL staining
Apoptosis in the embryos was assessed by Acridine Orange and TUNEL (terminal transferase mediated dUTP nick end-labeling). Live embryos were used for apoptotic cell staining with the vital dye Acridine Orange as described (Barrallo-Gimeno et al., 2004Go). Embryos were incubated in the dark in a 5 µg/ml Acridine Orange solution (diluted from a 5 mg/ml stock) for 30 minutes, washed with egg water and analyzed under a fluorescent Nikon E800 microscope. TUNEL staining was performed on embryos fixed with 4% PFA-PBS overnight at 4°C as described (Chi et al., 2003Go). The fixed embryos were dechorionated, washed and transferred through a graded series of methanol:PBT to 100% methanol. The embryos were rehydrated and permeabilized by proteinase K, re-fixed in 4% PFA-PBS, washed with PBT and incubated in blocking solution (3% H2O2 in methanol) for 1 hour at room temperature. The embryos were then washed in PBT and incubated in permeabilization solution (0.1% Triton X-100 in 0.1% sodium citrate) for 5 minutes on ice. The permeabilized embryos were then incubated for 1-3 hours with terminal transferase (Roche) and fluorescein-labeled ddUTP at 37°C. The embryos were washed with PBT several times, incubated in converter POD for 30 minutes at 37°C and detected using DAB.

Microangiography and vascular cell counts
48 hpf embryos were anaesthetized with Tricaine (16 mg/100 ml egg water), mounted in 3% methylcellulose and injected with a 5% solution of 2,000,000 Dalton Rhodamine dextran in Hank's buffer into the sinus venosus. After 5 minutes, the injected embryos were imaged on a Zeiss LSM5 Pascal confocal microscope. To quantify vascular cell number, nuclei were visualized in 15 µm plastic sections by DAPI staining. Endothelial cell nuclei were identified by tissue morphology using DIC optics to identify the cardinal vein and aorta in trunk cross-sections.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
osr1 expression during gastrulation and somitogenesis
osr1 is expressed the germ ring at 30% epiboly (Fig. 1A) (Tena et al., 2007Go) and, at 75% epiboly, in cells dispersed over the yolk in a pattern similar to endoderm progenitors (Kikuchi et al., 2000Go). Two-color in situ hybridization using osr1 and no tail (ntl) probes revealed that osr1 expression is restricted to vegetal tiers of mesendodermal cells closest to the margin and is not present in more-animal cells that express ntl. osr1 expression overlapped with sox32 expression in the most vegetal tiers of germ ring mesendoderm but not in cells of the yolk syncytial layer (YSL) (Fig. 1E,F). To discern whether osr1 was expressed in both mesoderm and endoderm progenitors, we used double-fluorescent in situ hybridization and confocal microscopy. Double-fluorescent in situ with osr1 and ntl probes reveal that osr1 and ntl expression overlapped in a subset of cells at 60% epiboly, whereas other more dispersed cells were positive for osr1 but not for ntl (Fig. 1G-I). To determine whether these cells were endodermal progenitors, we assayed expression of the endodermal markers sox17 and sox32. Double-fluorescent in situ revealed that dispersed osr1-expressing cells also expressed sox17 (Fig. 1J-L) and sox32 (Fig. 1M-O). The data indicate that osr1 is expressed in mesendoderm closest to the YSL at 30% epiboly; later, as epiboly progresses, osr1 is expressed in endoderm progenitors as well as in mesodermal cells that express ntl.


Figure 1
View larger version (97K):
[in this window]
[in a new window]

 
Fig. 1. osr1 expression during early gastrulation. (A,B) osr1 expression in the germ ring at 30% epiboly (A) and in the gastrulating cells at 75% epiboly (B). (C) Two-color in situ of osr1 (blue) and ntl (red) mRNA transcripts at 30% epiboly. (D) Cross-section of C at the level indicated shows that osr1 is not expressed in the ntl-positive mesodermal cells farther from the margin (red arrowhead) and is restricted to mesendoderm cells closest to the margin (blue arrowhead). (E) Colocalization of osr1 (blue) and sox32 (red) mRNA transcripts at 30% epiboly. (F) Cross-section of E at the level indicated shows osr1 expression in the mesendoderm cells with some overlap with sox32-positive endodermal cells (blue arrowhead) but the absence of osr1 expression in the sox32-positive YSL cells (red arrowhead). (G-O) Magnified lateral views of 60% epiboly embryos just above the blastoderm margin with dorsal on the right. (G-I) Double-fluorescent in situ hybridization of osr1 (red) and ntl (green) probes at 60% epiboly. The images represent a maximum intensity projection of a confocal z-series stack (four slices, 1.9 µm each). (I) Merge of G and H showing distinct expression of osr1 (G) in endoderm cells (red arrowhead, G,I) that do not express ntl (H). osr1 (G) is co-expressed with ntl (H) in mesendoderm cells (green arrowhead, H,I). (J-L) Double-fluorescent in situ hybridization of osr1 (red) and sox17 (green) at 60% epiboly. Images represent a single confocal slice of 1.9 µm. (L) Merge of J and L showing co-expression of osr1 and sox17 in endoderm cells. (M-O) Double-fluorescent in situ hybridization of osr1 (red) and sox32 (green) at 60% epiboly. Images represent a single confocal slice of 1.9 µm. (O) Merge of M and N showing co-expression of osr1 and sox32 in endoderm cells. Scale bars: in G,I,L, 10 µm for G-O.

 
Previous studies reported that zebrafish osr1 was co-expressed with the nephric markers pax2a and lim1 in the intermediate mesoderm during somitogenesis (Tena et al., 2007Go). To discern the osr1 expression pattern at higher resolution, we assayed its expression relative to known IM/LPM markers using single and two-color in situ hybridization. At the tailbud stage (10 hpf), lim1 is expressed in bilateral stripes of IM adjacent to presomitic mesoderm and in adaxial cells (Fig. 2A,B). By contrast, osr1 was expressed in cells displaced laterally and ventrally from the lim1 expression domain (Fig. 2C,D). During somitogenesis, this pattern persisted and osr1 was detected in bands of cells that superficially appear to be the intermediate mesoderm; however, histological sections of 18 hpf embryos show that these osr1-expressing cells lie ventral and lateral to the pronephros, and are excluded from the forming pronephros (Fig. 2E,F). This is also clear at 24 hpf (Fig. 2G,H) where sections of the trunk show osr1 expression in ventrolateral tissues, but not in the pronephros. Sections of 18 and 24 hpf embryos also revealed that osr1 was expressed in the endoderm at the midline. Endoderm expression was confirmed by examining older embryos where osr1 was shown to be expressed in the liver and gut at 48 hpf (see Fig. S1 in the supplementary material). Two color in situs revealed that osr1-expressing cells were lateral to pax2a (Fig. 2I,J), scl (Fig. 2L-M) and etsrp1 (Fig. 2O-Q) expressing cells. Sections of embryos double-stained for pax2a and osr1 confirmed that osr1 is expressed ventrally and laterally to the forming kidney (Fig. 2K). We conclude that osr1 is not expressed in the IM during somitogenesis, as previously reported. The lateral and ventral position of osr1-positive cells and the early expression osr1 in both mesoderm and endoderm suggests that this tissue is likely to be the zebrafish equivalent of the splanchnopleure (Funayama et al., 1999Go). In light of previous reports on osr1 function in nephrogenesis and our results that osr1 is not expressed in kidney tissue, we re-examined the osr1 loss-of-function phenotype.

osr1 is specifically required for proximal pronephric nephron development
Previous studies suggested that osr1 loss of function resulted in the complete absence of kidney tissue and gross edema (Tena et al., 2007Go). By contrast, we found that osr1 loss of function by morpholino knockdown (Fig. 3A,B) resulted in a segment-specific defect in the proximal nephron, whereas the distal nephron was relatively unaffected (Fig. 3C-F). The chloride-bicarbonate exchanger ae2 is expressed highly in the proximal nephron and at a lower level in the distal nephron at 24 hpf (Fig. 3C) (Shmukler et al., 2005Go). In osr1 morphants, ae2 expression is specifically missing in the proximal nephron, whereas expression in the distal nephron is unchanged (Fig. 3D; 90% of injected embryos; n=10). Expression of the NaK ATPase {alpha} subunit marks the full length of the nephron at 72 hpf (Drummond et al., 1998Go) (Fig. 3E). In confocal images of osr1 morphants, NaK ATPase-positive tubules were truncated, with proximal tubule segments missing (100% of injected embryos, n=15; Fig. 3F). Both NaK ATPase staining and ae2 in situ often revealed an asymmetric loss of the proximal nephron (Fig. 3D). In one experiment, nine out of 17 embryos showed asymmetric loss of the proximal nephron, while the remaining eight showed a symmetric loss (as shown in Fig. 4H). Similar proximal segment-specific loss was observed using in situ probes for lim1, pax8, osr2 and nbc1 (data not shown). Expression of more distal nephron segment markers trpM7 (Elizondo et al., 2005Go; Liu et al., 2007Go; Wingert et al., 2007Go) and ret1 (Bisgrove et al., 1997Go; Marcos-Gutierrez et al., 1997Go) were unaffected by osr1 loss of function (see Fig. S2 in the supplementary material). Similar results were obtained with both an osr1 ATG initiation codon blocking morpholino and the exon 2 splice donor morpholino; all subsequent experiments were performed with the exon 2 donor morpholino as we could more rigorously determine the efficacy of osr1 knockdown using RT-PCR. Apoptosis assays also revealed that loss of the proximal nephron was not due to cell death (see Fig. S3 in the supplementary material). These results indicate that kidney defects in osr1 morphants are specific to the proximal nephron and also that osr1 loss of function does not result in a general re-patterning of nephron segments.


Figure 2
View larger version (95K):
[in this window]
[in a new window]

 
Fig. 2. osr1 expression during zebrafish development. (A) Cross-section of a tailbud stage embryo showing expression of lim1 in cells of the IM (A, inset) adjacent to presomitic mesoderm (arrowhead) and myoD in adaxial cells adjacent to the notochord (nc). (B) Magnification of A showing proximity of lim1-positive IM to the border of presomitic mesoderm (arrowhead). (C,D) Cross-section of a tailbud stage embryo showing expression of osr1 in bilateral stripes (inset, C) in cells lateral and ventral to the expression of lim1 (C,D) (arrowheads indicate the anatomical border of presomitic mesoderm. (E) At 18 somites, osr1 is expressed in bilateral stripes just anterior to the somites and in lateral mesoderm of the trunk and tail. (F) Cross-section of embryo in E at the level indicated in E showing osr1 expression ventral and lateral to the pronephros (outlined in F) and endodermal cells (arrowhead, F). (G) osr1 expression at 24 hpf in cells overlying the yolk extension. (H) Cross-section of the embryo in G at the level indicated shows osr1 expression in the ventrolateral mesoderm distinct from the pronephric ducts (circles) and in endoderm (arrowhead, H). (I-K) Expression of osr1 (blue) and pax2a (red). (J) Magnified views of boxed region in I show non-overlapping expression of osr1 (blue arrowhead) and pax2a (red arrowhead) in the intermediate mesoderm. (K) Cross-section at the same level shows expression of osr1 (blue arrowhead) in cells ventral and lateral to the cells expressing pax2a (red arrowhead). (L-N) Expression of osr1 (blue) and scl (red) at 12 somites. Magnified views of boxed regions in L show non-overlapping expression of osr1 and scl in the posterior (M) and anterior (N) regions of the PLM. (O-Q) Expression of osr1 (blue) and etsrp1 (red) at 12 somites. Magnified views of boxed regions in O show non-overlapping expression of osr1 and etsrp1 in the posterior (P,P') and anterior (Q) regions of the PLM. (P,P') Magnified view of the boxed region in O at different focal planes showing osr1- and etsrp1-positive cells at different dorsoventral positions, with osr1 in more ventral (P) and etsrp1 in the more dorsal cells (P') with reference to yolk cells.

 
osr1 is required for glomerular morphogenesis
To determine whether pronephric glomerular development was affected by osr1 knockdown, we assayed expression of the Wilms tumor suppressor gene wt1a, a marker of podocyte specification (Bollig et al., 2006Go; Drummond et al., 1998Go; Majumdar and Drummond, 1999Go; Perner et al., 2007Go; Serluca and Fishman, 2001Go). In wild-type embryos, wt1a is expressed in anterior lateral mesoderm (Serluca and Fishman, 2001Go) and strongly in prospective pronephric podocytes at 24 hpf (Fig. 4A,C). At 48 hpf, wt1a-positive podocytes surround a compact glomerular vascular tuft derived from the aorta (Fig. 4E) (Drummond et al., 1998Go; Majumdar and Drummond, 1999Go). In osr1 morphants, wt1a was expressed at 26 hpf, although in a somewhat more dispersed pattern (Fig. 4B). Histological sections showed bilateral groups of podocyte progenitors ventral to the somites in all osr1 morphant embryos (Fig. 4D). However, these progenitors failed to coalesce into a compact structure at the midline, and a mature vascularized glomerulus is never formed. nephrin is an essential component of the pronephric glomerulus and is expressed in podocytes in wild-type embryos (Fig. 4G) (Kramer-Zucker et al., 2005Go). osr1 loss of function eliminated nephrin expression in podocytes (91% of injected embryos, n=12; Fig. 4H). Similarly, expression of podocin, another podocyte-specific marker, was absent from the glomerulus in osr1 morphants (data not shown). The data suggest that osr1 is not required for podocyte specification but rather functions at a later step in glomerular maturation associated with integration of blood vessels with podoctyes and the expression of the podocyte cell adhesion molecules nephrin and podocin.

osr1 loss of function expands the angioblast cell lineage
As derivatives of the IM/LPM also include the vasculature, blood and the heart, we analyzed the expression of vascular and blood markers in wild-type and osr1 morphant embryos. The transcription factor scl is expressed in both vascular and hematopoietic progenitor cells (Gering et al., 1998Go). In zebrafish, scl is first expressed during somitogenesis in cells that occupy bilateral stripes in the trunk IM/LPM (Gering et al., 1998Go) (Fig. 5A,C). Strikingly, the number of scl-expressing cells in the IM/LPM was significantly expanded in osr1 morphants at the 12-somite stage (89% of injected embryos, n=19; arrows, Fig. 5B). This expansion was most obvious in the anterior IM/LPM adjacent to somites 1-8 and to the domain of proximal nephron pax2a expression in wild-type embryos (Fig. 5A). Embryo staging was confirmed by double color in situ with myoD and scl (see Fig. S4 in the supplementary material). Expanded scl expression could also be seen in the posterior IM at 12 somites (Fig. 5D) and was evident in the region of the forming venous plexus at 26 hpf (100% of injected embryos, n=17; Fig. 5G,H). As scl-expressing cells could represent progenitors of either vascular or hematopoietic lineages (Gering et al., 1998Go), we next asked whether a specific lineage was affected by loss of osr1. flk1, the endothelial cell-specific receptor for VEGF is initially expressed in hemangioblasts and subsequently maintained in endothelial cells during vessel formation (Habeck et al., 2002Go; Liao et al., 1997Go; Thompson et al., 1998Go). Similar to scl, flk1 is expressed during early somitogenesis in bilateral stripes of IM/LPM cells (Liao et al., 1997Go) (Fig. 5C) that subsequently contribute to the main trunk vessels (Liao et al., 1997Go). In 12-somite osr1 morphants, expression of flk1 is significantly upregulated in the anterior trunk, similar to what we observed for scl expression (86% of injected embryos, n=35; arrows, Fig. 5D). etsrp1 is the earliest expressed transcription factor that controls vascular development without affecting hematopoietic development (Sumanas and Lin, 2006Go). Similar to scl and flk1, etsrp1 is expressed in bilateral stripes in the head and trunk of wild-type embryos during somitogenesis (Sumanas and Lin, 2006Go) (Fig. 5E). In 12-somite osr1 morphants, etsrp1e-epressing cells are significantly expanded in the anterior trunk IM/LPM (90% of injected embryos, n=11; arrows, Fig. 5F).


Figure 3
View larger version (69K):
[in this window]
[in a new window]

 
Fig. 3. osr1 knockdown results in segment-specific kidney defects. (A) osr1 gene structure and morpholino oligo targeting exon 2 (ex2d). (B) RT-PCR analysis of morpholino-induced osr1 mis-splicing. Blocking the exon 2 splice donor sequence resulted in the complete deletion of exon 2, which contains the ATG start codon and the entire coding sequence for the osr1 transcriptional regulatory domain and the first zinc finger. In embryos injected with 7.4 ng morpholino, no wild-type mRNA was detectable at 24 hpf, indicating that these morphant embryos were functionally null for osr1. A five-base pair mismatch control morpholino did not cause any molecular or phenotypic defects. Co-injection of osr1 synthetic mRNA along with the exon 2 donor morpholino rescued the osr1 phenotype in 53% (9/17) of embryos, as determined by pax2a expression (see Results), demonstrating specificity of the morpholino knockdown. (C) Expression of ae2 in the proximal pronephros (white arrowhead) is absent in osr1 morphants (D), whereas the distal pronephros is unaffected (black arrowhead). Immunofluorescence using anti-NaK ATPase alpha6F monoclonal antibody labels the entire pronephros in wild-type embryos (E), whereas expression is specifically lost (F) in the proximal nephron (white arrowhead) of osr1 morphants, leaving the distal pronephros unaffected (red arrowhead).

 


Figure 4
View larger version (102K):
[in this window]
[in a new window]

 
Fig. 4. osr1 is required for glomerular morphogenesis. (A,B) Expression of wt1a in control (A) and osr1 morphants (B) at 26 hpf. (C,D) Histological cross-sections of the 26 hpf glomerular progenitors in wild-type (C) and osr1 morphants (D) show equivalent expression of wt1a (arrows). (E,F) Cross-section of wild-type glomerulus at 48 hpf (E) shows wt1a expression in the midline vascularized glomerulus (arrow), whereas in osr1 morphants (F) wt1a-positive podocytes remain in an immature state (arrows) and fail to coalesce to the midline. (G,H) Expression of the podocyte marker nephrin is lost in osr1 morphants (arrowhead, H) when compared with the control embryos (arrowhead, G). Segment-specific loss of ae2 expression in the proximal pronephros is evident in the osr1 morphants (H) when compared with controls (G) at 48 hpf.

 
The effect of osr1 on hematopoietic lineages was evaluated with the markers pu.1 for the monocytic lineage (Lieschke et al., 2002Go) and gata1 for the erythropoietic lineage (Detrich et al., 1995Go). In wild-type embryos, pu.1-positive myeloid progenitors are expressed in both the rostral blood island and the posterior intermediate mesoderm or caudal blood island (Fig. 5I). Contrary to what we observe for scl, flk and etsrp, in osr1 morphants, pu.1 expression was not expanded and in fact was reduced in the anterior IM/LPM (87% of injected embryos, n=16; Fig. 5J). We also found that migration of pu.1-expressing ALM macrophages appears advanced compared with controls (Fig. 5J). Similarly, expression of gata1-positive erythrocyte progenitors (Fig. 4K) was not expanded (arrow, Fig. 5L) and in fact was reduced in the anterior IM/LPM (74% of injected embryos, n=35). Analysis of the cardiac-specific homeobox gene nkx2.5 (Chen and Fishman, 1996Go) showed normal expression in osr1 morphants, indicating that osr1 does not affect the specification of cardiac progenitors (data not shown). These results indicate that osr1 is not only required for proximal nephron development but also acts to limit angioblast cell differentiation, most notably in the anterior IM/LPM.


Figure 5
View larger version (62K):
[in this window]
[in a new window]

 
Fig. 5. osr1 knockdown expands vascular progenitor tissue. (A) scl (blue) and pax2a (red) expression in wild-type embryos labels adjacent bands (arrowheads) of intermediate mesoderm in 12-somite stage wild-type embryos. (B) osr1 knockdown results in expansion of scl-positive tissue, most prominently in anterior LPM (arrowheads) and loss of pax2a-expressing cells. (C) flk1 (blue) and scl (red) expression in 12-somite wild-type embryos (arrowhead). (D) osr1 knockdown increases the number of flk1-expressing cells (arrowheads). (E) etsrp1 expression in control 12-somite embryos (arrowhead). (F) etsrp1 expression is expanded in 12-somite stage osr1 morphants (arrowheads). (G) At 26 hpf, scl is expressed in the blood islands and forming venous plexus (arrowhead). (H) 26 hpf osr1 morphants show an expansion of scl-positive tissue in the region of the forming venous plexus (arrowhead). (I,J) Expression of the monocyte lineage marker pu.1 in wild-type embryos (I) and osr1 morphants (J) shows a reduction of expression in the anterior aspect of its LPM expression domain (arrowheads). (K,L) Similarly, expression of the erythrocyte marker gata1 in wild-type embryos (K) and osr1 morphants (L) shows a reduction of expression in its most anterior expression domain (arrowheads).

 


Figure 6
View larger version (86K):
[in this window]
[in a new window]

 
Fig. 6. Overexpression of osr1 causes expansion of pronephric progenitor number and a reduction in angioblast number. Control embryos (A,C) and embryos injected with 100 pg of osr1 mRNA (B,D). (A) Control expression of pax2a is expanded after injection of osr1 mRNA (B), specifically in the mid-portion of the IM (arrowhead, B), which is normally downregulated in the control embryos at the 13-somite stage (arrowhead, A). myoD is used as an internal control for somite staging in these embryos (A,B). (C,D) Expression of scl is lost in the anterior lateral plate mesoderm (arrowhead, D) in the embryos injected with osr1 mRNA when compared with the uninjected controls (arrowhead, C).

 
osr1 overexpression expands kidney progenitors at the expense of angioblast cell number
To confirm results on osr1 loss of function, we tested whether osr1 gain of function would have opposite effects on patterning the anterior IM/LPM. By the 13-somite stage, pax2a is normally downregulated in the mid-portion of the IM in wild-type embryos (Fig. 6A). Ectopic expression of osr1 by synthetic osr1 mRNA injection at the one-cell stage resulted in enhanced expression of pax2a throughout the IM and specifically prevented the downregulation of pax2a in the mid-portion of the IM (78% of injected embryos, n=32; Fig. 6B). In a complementary fashion, scl expression in the anterior LPM (Fig. 6C) was specifically lost in osr1 morphants (70% of injected embryos, n=27) (Fig. 6D). No ectopic expression of either lineage marker was induced outside of their respective expression domains by osr1 overexpression. The results indicate that overexpression of osr1 is sufficient to re-pattern the anterior IM/LPM, adjacent to somites 1-8.

osr1 is required for pronephric epithelial differentiation and to limit the size of the axial vein
To assess whether a re-specification of mesoderm occurs in osr1 morphants, we sectioned control (Fig. 7A) and osr1 morphants (Fig. 7B) at 52 hpf, prior to the development of gross edema, to examine the morphology of the glomerulus, pronephric ducts and vasculature. At the level of pectoral fin in control embryos (Fig. 7C, inset), the glomerulus was visible ventral to the aorta as a compact structure (arrowhead, Fig. 7C). However, in osr1 morphants, all sectioned embryos lacked a vascularized glomerulus and pronephric tubules at the level of the pectoral fin (Fig. 7D, inset; n=4). Instead, all sectioned embryos showed prominent profiles of the cardinal veins (Fig. 7D, n=4), which in serial sections, could be distinguished from the pronephros by the presence of red blood cells in the lumen. In more posterior sections of wild-type embryos (Fig. 7E), the pronephros was visible as bilateral epithelial tubules (arrowhead, Fig. 7E) that flank the medial aorta and vein, here filled with nucleated red blood cells. In osr1 morphants, the pronephric tubules in the trunk were present but appeared smaller (arrowhead, Fig. 7F) compared with controls. Strikingly, the size of the medial vein was significantly enlarged in osr1 morphants (v in Fig. 7F) at all the A-P levels examined (v in Fig. 7D,F). To determine whether the increase in vein lumen size was associated with a corresponding increase in vein endothelial cell number and to rule out the possibility that vein expansion was secondary to edema, we counted DAPI stained endothelial cell nuclei in 15 µm sections (from the trunk region, as in Fig. 7E,F) of 36 hpf osr1 morphants that showed no pericardial expansion or other evidence of edema. osr1 morphants showed a significant increase in the number of vein endothelial cell nuclei [5.11±0.19/section (s.e.m.), n=26 compared with 3.04±0.09/section, n=25 in control]. Arterial size and endothelial cell number were not affected (2.6±0.1, n=25 in control versus 2.8±0.14, n=26 in morphants) in osr1 morphants. To further analyze the enlargement of veins in osr1 morphants, we performed microangiography on control and osr1 morphants at 48 hpf. Control embryos and osr1 morphants showed normal circulation in the dorsal aorta and intersomitic vessels. However, the venous plexus region distal to the yolk extension was dramatically expanded in all osr1 morphants examined (v in Fig. 7H; n=5) when compared with the control embryos (v in Fig. 7G). Taken together, the histology, cell counting and microangiography data strongly suggest that the venous cell fate is expanded in osr1 morphants.


Figure 7
View larger version (137K):
[in this window]
[in a new window]

 
Fig. 7. Loss of pronephric epithelial differentiation and vascular expansion in osr1 morphants. Control (A,C,E,G) and osr1 morphants (B,D,F,H) at 52 hpf. (A) Wild-type 52 hpf embryo showing position of histological sections in C and E. (B) osr1 morphant embryo showing position of histological sections in D and F. (C) Cross-section at the level of the fin buds (inset) shows normal glomerular structure (arrowhead) and connecting pronephric tubules. (D) Cross-section at the level of the fin buds in an osr1 morphant (inset) shows absence of pronephric tubules and glomerulus and expansion of cardinal vein (v). (E) In more posterior sections of wild-type embryos, the pronephric epithelial tubules (arrowhead) and cardinal vein are of roughly similar dimensions. (F) In osr1 morphants, pronephric tubules are reduced in diameter compared with wild-type (arrowhead) and the cardinal vein (v) is significantly expanded. (G) Angiogram of wild-type embryo trunk and tail region highlights the aorta (a) and the common tail vein (v). (H) Angiogram of an osr1 morphant highlights a grossly expanded venous plexus in the tail (v). Intersomitic vessels were present in osr1 morphants but are not shown in the confocal sections used in this projection.

 
osr1 acts upstream of pax2a in kidney development
Pax2 and Pax8 are known to function partially redundantly to control kidney development in the mouse (Bouchard et al., 2002Go). In zebrafish, pax2a is specifically required for proximal tubule cell differentiation in the pronephros (Majumdar et al., 2000Go). We therefore tested whether ectopic expression of pax2a in osr1 morphants would be sufficient to bypass a requirement for osr1 and revert the osr1 morphant phenotype to wild-type patterning of kidney and vascular tissues. We used the expression of ae2 as a measure of the proximal nephron length in control and experimental embryos. The length of ae2-positive proximal tubules in control embryos ranged from 300-500 µm (mean of 378 µm; 14/14, 100%) (Fig. 8A,G). In osr1 morphants, ae2 segment length was reduced (Fig. 8B) with 42% of embryos (11/26) in the 100-200 µm range, 50% of embryos in the 200-300 µm range and only 8% of the embryos (2/26) exhibiting wild-type segment length (Fig. 8G). The overall mean ae2-positive tubule length for osr1 morphants was 214 µm compared with 378 µm for controls. Injection of pax2a mRNA into osr1 morphants restored 60% of the embryos (18/28) to the wild-type proximal tubule length of 300-500 µm (mean of 331 µm) (Fig. 8C). In a complementary fashion, pax2a expression reverted the expanded domain of scl expression (compare Fig. 8D with 8E) to a wild-type pattern (Fig. 8F). The data indicate that in the absence of osr1 function, ectopic expression of pax2a is sufficient to specify proximal pronephric tubule differentiation. In addition, ectopic expression of pax2a is sufficient to limit angioblast differentiation in the intermediate mesoderm.

osr1 effects on mesoderm patterning are mediated by the endoderm
The simplest interpretation of our results so far would be that osr1 functions early in the IM/LPM upstream of pax2a and scl to drive kidney development while repressing angioblast differentiation. However, several inconsistencies with this model were evident in our data. First, our finding that the anterior IM/LPM was preferentially affected in osr1 morphants was not consistent with the broad posterior expression of osr1 in the IM that extended to the tailbud (Fig. 2C, inset). We were also surprised to find that the re-patterning of the IM/LPM by osr1 loss of function occurred progressively during somitogenesis and was not evident at the earliest stages of pax2a and scl expression. The early expression pattern of pax2a at the 5-somite stage in osr1 morphants (Fig. 9B) was, in fact, similar to the wild-type pattern (Fig. 9A). However the anterior IM pax2a expression domain at the 14-somite stage (Fig. 9C) was reduced in osr1 morphants (89% of injected embryos, n=37; Fig. 9D) and, by 24 hpf, completely absent (96% of injected embryos, n=53) (compare Fig. 9E with 9F). Similarly, scl expression was normal at the 8-somite stage in osr1 morphants (Fig. 9G,H) and only later, at the 14-somite stage, was found to be expanded in osr1 morphants (89% of injected embryos, n=19) (Fig. 9I,J). We could also rule out that the intermediate mesoderm was patterned by an antagonistic relationship between genes downstream of osr1 (pax2a and scl) as loss of function in these genes alone, or in combination with osr1 loss of function, did not result in expansion of the opposing lineage (see Fig. S5 in the supplementary material). These results, together with our finding that ectopic expression of osr1 only affected cell differentiation within the anterior IM/LPM, suggested that osr1 might act indirectly to pattern the mesoderm.


Figure 8
View larger version (54K):
[in this window]
[in a new window]

 
Fig. 8. Ectopic expression of pax2a rescues intermediate mesoderm patterning in osr1 morphants. (A-C) Expression of ae2 in the pronephros of 24 hpf control (A), osr1 morphant (B) and osr1 morphant co-injected with pax2a mRNA (C). Horizontal lines indicate the length of the wild-type ae2-positive proximal nephron segment. (D-F) Expression of scl in the anterior lateral mesoderm of 24 hpf control (D), osr1 morphant (E) and osr1 morphant co-injected with pax2a mRNA (F). Horizontal lines indicate the length of the wild-type scl-positive anterior lateral mesoderm. (G) Quantification of pax2a rescue of ae2-positive proximal pronephric nephron cells (see text for details).

 


Figure 9
View larger version (76K):
[in this window]
[in a new window]

 
Fig. 9. osr1 knockdown does not affect specification of pronephric and angioblast mesoderm, but does affect their subsequent maintenance. (A,B) Expression of pax2a and myoD in control (A) and osr1 morphants (B) is similar at five somites (arrowheads in A and B). myoD is used as a internal somite staging control. (C,D) Expression of pax2a in a 14-somite control (C) and osr1 morphants (D) reveals a substantial reduction in the number of pax2a-positive cells in the anterior IM (arrowheads, C,D). (E,F) Expression of pax2a in 24 hpf control (E) and osr1 morphants (F) shows a complete loss of pax2a-positive cells in the proximal pronephros (arrowheads, E,F). (G,H) Expression of scl in osr1 morphants (H) is similar to that of control embryos at 8 somites (G). (I,J) However, by the 14-somite stage, the number of scl-expressing cells is significantly upregulated in the anterior lateral plate mesoderm of osr1 morphants (arrowhead, J) when compared with control embryos at the same stage (arrowhead, I).

 
In addition to its expression in the IM/LPM, osr1 is expressed in the germ ring mesendoderm at the shield stage (Fig. 1) (Tena et al., 2007Go). We examined whether osr1 might function in mesendoderm patterning by assessing expression of the endoderm-specific markers, foxa2 and sox17. Strikingly, we found that endoderm differentiation was strongly enhanced in osr1 morphants. The number of sox17-positive cells at the shield stage (Fig. 10A-C) was significantly increased in osr1 morphants (100% of injected embryos, n=14; Fig. 10D-F). Similarly, the number of foxa2-positive cells (Fig. 10G-I) was increased in osr1 morphants (71% of injected embryos, n=21; Fig. 10J-L). Intensified expression of foxa2 at the 18-somite stage (86% of injected embryos, n=15; Fig. 10M,N) confirmed that development of the pharyngeal endoderm was enhanced by osr1 loss of function. sox32/casanova is a transcription factor that is required for all endodermal development (Alexander et al., 1999Go). As previously reported (Dickmeis et al., 2001Go), knockdown of sox32 using an antisense morpholino (Dickmeis et al., 2001Go) specifically eliminated foxa2-expressing endoderm (93% of injected embryos, n=15) but did not affect foxa2 expression in axial mesoderm (Fig. 10O).


Figure 10
View larger version (108K):
[in this window]
[in a new window]

 
Fig. 10. osr1 knockdown causes expansion of endoderm. (A-F) Expression of endoderm marker sox17 in control (A-C) and osr1 morphants (D-F) at the shield stage. (A,D) Dorsal views; (B,E) side views with dorsal facing; (C,F) magnified views of boxed regions in B,E, respectively. The number of tiers of sox17-expressing cells was significantly increased in osr1 morphants at the blastoderm margin (bar in E,F) and in the ventral region of the embryo (arrowhead, D) when compared with control (A,C; bar in B). (G-L) Expression of mesendoderm marker, foxa2 in control (G-I) and osr1 morphants (J-L) at the shield stage. (G,J) Dorsal views; (H,K) side views with dorsal facing; (I,L) magnified views of boxed regions in H,K, respectively. The number of tiers of foxa2-expressing cells were significantly increased in osr1 morphants with more layers of foxa2-expressing cells at the blastoderm margin (bar in K,L) and enhanced expression in the ventral region of the embryo (arrowhead, J) when compared with control (G,I; bar in H). (M-O) Expression of foxa2 at 18 somites in control (M), osr1 morphants (N) and sox32 (cas) morphants (O). Development of foxa2-positive pharyngeal endoderm was enhanced in osr1 morphants (arrowheads, N) when compared with control embryos (arrowheads, M) and was completely blocked by sox32 knockdown (arrowheads, O).

 


Figure 11
View larger version (97K):
[in this window]
[in a new window]

 
Fig. 11. Elimination of endoderm development in osr1 morphants rescues proximal pronephric phenotype. (A-D) Expression of pax2a in control (A), osr1 morphant (B), sox32 morphant (C) and osr1+sox32 double morphants (D). Loss of osr1 resulted in loss of proximal pax2a pronephric expression (arrowhead, B) when compared with control 18-somite stage embryos (arrowhead, A). sox32 (cas) morphants lacking endoderm showed slightly enhanced expression of pax2a in the proximal nephron (arrowhead, C). The loss of pax2a expression in the proximal pronephros of osr1 morphants was rescued by elimination of endoderm in the osr1+ sox32 double morphants (arrowhead, D). (E-G) Expression of pax2a in uninjected bon heterozygote incross embryos (E) and osr1 morpholino injected bon incross embryos (F,G) at 24 hpf. pax2a expression was lost from the proximal pronephros in 47 out of 64 of the injected embryos (73%) (F). Loss of pax2a expression from the proximal pronephros was rescued in 17 out of 64 (27%) osr1 MO injected, bon heterozygote incross embryos. Arrowheads in E-G indicate expression of pax2a in the proximal pronephros.

 
The ability to block endoderm development by sox32/casanova knockdown allowed us to test whether expanded endoderm development was responsible for re-patterning the mesoderm in the context of osr1 loss of function. As expected, knockdown of osr1 alone resulted in a reduction in pax2a-positive cells (90% of injected embryos, n=43; Fig. 11B) compared with control (Fig. 11A) at 18 somites. Knockdown of sox32 alone did not have noticeable effects on pax2a expression (98% of injected embryos, n=30; Fig. 11C). Remarkably, knockdown of sox32 and elimination of endoderm development in osr1 morphants restored pax2a expression to a normal wild-type pattern (74% of injected embryos, n=66). To confirm these results, we tested whether reduction in endoderm development in the mutant bonnie and clyde/mixer (bon) would rescue the osr1 loss-of-function phenotype. All embryos in an incross of bon heterozygotes showed a normal pattern of pax2a expression (Fig. 11E). Knockdown of osr1 in embryos of an incross of bon heterozygotes resulted in the expected osr1 phenotype in roughly three quarters of the embryos (73%; Fig. 11F), whereas the remaining quarter (27%) of the clutch showed a normal rescued pattern of pax2a expression (Fig. 11G). Rescue of pax2a expression by sox32 knockdown and the Mendelian ratio of pax2a rescued embryos in a bon+/- incross indicate that re-patterning of kidney versus vasculature in osr1 morphants can be accounted for by expanded development of endoderm. A primary function of osr1 may therefore be to pattern the mesendoderm during gastrulation.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The derivation of kidney and blood/vasculature from adjacent areas of mesoderm in developmental fate maps and the continued close association of progenitor cells during organogenesis (Crosier et al., 2002Go; Davidson and Zon, 2004Go; Fujimoto et al., 2001Go; Iraha et al., 2002Go; Kimelman, 2006Go; Kimelman and Griffin, 2000Go; Kimmel et al., 1990Go; Lane and Sheets, 2006Go; Vogeli et al., 2006Go; Walmsley et al., 2002Go) prompted us to examine whether genes acting during early development might affect the fate of both tissues. osr1 has been reported to be expressed in the intermediate mesoderm and required for mouse and zebrafish kidney development (James et al., 2006Go; So and Danielian, 1999Go; Wang et al., 2005Go). Our data indicate that osr1 is not simply required for kidney development but rather it acts early in development to pattern the mesendoderm that, in turn, has broader effects on development. Our results also show that in zebrafish, osr1 is not expressed in typical intermediate mesoderm but rather in more lateral and ventral cells that may represent the zebrafish splanchnopleure (Funayama et al., 1999Go). We find that osr1 expression in lateral cells (splanchnopleure) is not required for normal expression of pax2a as combined sox32/osr1 loss of function results in normal pax2a expression. Unexpectedly, the primary mechanism underlying osr1 loss-of-function phenotypes appears to be an increase in endoderm development that later acts to inhibit kidney and favor vascular cell differentiation in mesoderm.

A role for osr1 in mesendoderm patterning
Mesoderm and endoderm are derived from a mixed population of cells, the mesendoderm, that constitutes the germ ring in zebrafish embryos. Our results suggest that expression of osr1 in the germ ring plays an important role in mesendoderm patterning by acting as a repressor of endoderm formation. Both endoderm and mesoderm are induced by the Nodal-related factors cyclops and squint in zebrafish (Schier and Talbot, 2005Go). High levels of Nodal signals induce endoderm in the most marginal blastomeres, whereas in cells closer to the animal pole, induction of Tbox factors and FGF promote mesoderm development and antagonize endoderm development (Schier and Talbot, 2005Go). Ventral expression of BMPs has also been shown to antagonize endoderm development (Poulain et al., 2006Go). osr1 expression is known to respond to BMP signaling in chick embryo mesoderm (James and Schultheiss, 2005Go) and we have confirmed that early expression of osr1 in zebrafish requires the activity of a functional bmp2b gene (data not shown). One model of osr1 activity would be that after induction by bmp2b signaling, osr1 acts as a transcriptional repressor in mesendoderm cells (Tena et al., 2007Go), antagonizing transcriptional responses downstream of Nodal signaling (Schier and Talbot, 2005Go). However, the expression pattern of osr1 throughout the germ ring suggests that, in addition to BMP signaling, osr1 might also be responsive to FGF or nodal signaling (Rodaway et al., 1999Go). Further experiments examining signals upstream of osr1 expression will be required to better define osr1 function in the context of mesendoderm patterning.

Does altered mesendoderm patterning account for osr1 phenotypes?
In mouse embryos, disruption of the Osr1 gene causes severe defects in urogenital development (Wang et al., 2005Go). Mutant mice show no evidence of ureteric bud or metanephric kidney development and cellular defects in the Wolffian duct are evident at a very early stage (E8.5) (James et al., 2006Go; Wang et al., 2005Go). The nephrogenic mesenchyme shows reduced expression of Wt1 (Wang et al., 2005Go) and also fails to express many other genes that define this tissue (James et al., 2006Go). The absence of properly specified nephrogenic mesenchyme in the mouse Osr1 mutants, taken together with our results in the zebrafish raise the possibility that Osr1 in the mouse may play additional roles outside of the nephrogenic mesoderm to ensure proper patterning of the intermediate mesoderm. Although Osr1 expression in endoderm has not been detected in the mouse by in situ hybridization, recent analysis of a mouse Osr1 (Osr1) bac transgenic shows that the Osr1 gene contains regulatory elements that drive reporter expression (Cre) in endodermal organs (Grieshammer et al., 2008Go). Although suggestive of a function for osr1 in endoderm, further experiments will be required to critically assess this possibility.

Our results differ from a previous study of osr1 expression and function in zebrafish kidney development (Tena et al., 2007Go) where it was concluded that `knockdown of osr1 and osr2 results in the loss of all pronephric structures including the glomerulus'. We find that osr1 morphant kidney defects are restricted to the proximal nephron, and that glomerular morphogenesis is arrested in a stage-specific fashion, subsequent to podocyte wt1a expression. Our results are not due to a partial osr1 loss of function as we demonstrate that no wild-type osr1 mRNA can be detected by RT-PCR in osr1 morphants at 24 hpf. These discrepancies are most probably due to the fact that Tena et al. did not examine osr1 morphants with markers of the distal pronephros or the specification of glomerular podocytes by wt1a expression. In addition, in contrast to Tena et al., we show that zebrafish osr1 is not expressed in pax2a-positive pronephric kidney cells during somitogenesis, nor in mature glomeruli. We observe osr1 expression in cells adjacent to the forming pronephros at the 18-somite stage, which could have been easily mis-identified as the pronephros by Tena et al. In addition, we observe strong osr1 expression in the liver, next to the glomerulus, at 48 hpf, which at low magnification may have been mistaken for glomerular expression by Tena et al. Our results agree with expression studies in the chick showing that Osr1 is not expressed in differentiated kidney cells. Ectopic expression studies in the chick also support the idea that osr1 expression may actually impede kidney epithelial differentiation (James et al., 2006Go).

Given the previous work on osr1 and its broad early expression in the intermediate mesoderm, the segment-specific loss of kidney tissue and the selective expansion of vascular tissue in the anterior trunk of osr1 morphants that we observed was unexpected. In addition, the fact that patterning defects in pax2a-positive kidney progenitors and scl-positive angioblasts were observed relatively late in development, during somitogenesis, argues that osr1 plays a role in maintenance, but not in specification, of mesodermal lineages. The simplest interpretation of our results is that signals that repress kidney and enhance angioblast development emanate from anterior endoderm and thus most strongly affect the anterior intermediate/lateral plate mesoderm. A central role for endoderm in the context of osr1 loss of function may also help explain other phenotypes of osr1 mutants/morphants. Both mouse and zebrafish embryos lacking osr1 often show asymmetric loss of the Wolffian duct/pronephric duct on the left side (Wang et al., 2005Go) (our results), which has been interpreted to suggest the existence of a latent left-right asymmetry in the normally bilaterally symmetric kidney. Our results raise the alternative possibility that asymmetric loss of kidney tissue could be due to underlying asymmetries in endodermal tissues that negatively affect Wolffian/pronephric duct formation. Asymmetric defects in Wolffian duct development have also been reported in Gata3 knockout mice (Grote et al., 2006Go), which might be due to cell-autonomous effects of Gata3 loss of function in the Wolffian ducts. Interestingly, however, Gata3 is also expressed in endodermal tissues (Caprioli et al., 2001Go; Debacker et al., 1999Go), which may indirectly affect kidney development.

Although we observed an increase in vascular tissue in osr1 morphants, we did not observe a corresponding increase in blood cell development. This could be due to the fact that the most strongly affected tissue in osr1 morphants, the anterior intermediate mesoderm, is known to be enriched for flk-and scl-positive angioblasts in zebrafish, whereas more posterior mesoderm contains both angioblasts and hematopoietic precursors that express gata1 (Dooley et al., 2005Go). Alternatively, signals from expanded endoderm in osr1 morphants may selectively favor angioblast development over erythropoiesis.

The role of the endoderm in mesodermal organogenesis
Our findings suggest that the effects of osr1 loss of function on kidney and vascular patterning are mediated by signals from the endoderm. The endoderm is known to regulate the development of other mesodermal derivatives such as the heart (Alexander et al., 1999Go; Dickmeis et al., 2001Go; Kikuchi et al., 2000Go; Reiter et al., 1999Go). In chick and frog, the anterior endoderm induces cardiogenesis by secreting a combination of BMPs and soluble inhibitors of Wnt signaling such as Crescent and Dkk-1 (Marvin et al., 2001Go; Schneider and Mercola, 2001Go). In addition to its potential role as an inducer of heart tissue, endoderm provides a matrix upon which cardiac progenitors and angioblasts migrate to form a fused heart tube (Jin et al., 2005Go; Trinh and Stainier, 2004Go). Interestingly, lack of endoderm in the one eyed pinhead zebrafish mutant has been associated with a specific loss of vein, but not of aorta, development (Brown et al., 2000Go), which would be consistent with our results that an early expansion of endoderm expands vein but not aorta development. In the chick and mouse, sonic hedgehog signaling from endoderm is important for vasculogenesis (Vokes et al., 2004Go); however, this is apparently not essential in zebrafish (Jin et al., 2005Go). A candidate signal for the effect of endoderm on kidney development might be sonic hedgehog, as it is expressed in the endoderm and when expressed ectopically, hedgehog proteins can inhibit nephrogenesis (Urban et al., 2006Go). However, we found that cyclopamine treatment did not reverse the effects of osr1 knockdown on kidney cell differentiation (Y.L. and I.D., unpublished), making it unlikely that hedgehog is the endoderm-derived signal. Thus, although these studies demonstrate that the endoderm is a rich source of soluble signaling molecules, it remains to be seen whether endoderm-derived soluble factors pattern kidney tissue in the IM.

In summary, our studies have uncovered a new role for osr1 in patterning mesendoderm. osr1 acts to inhibit endoderm differentiation during gastrulation. Our work has also uncovered a previously unknown role for endoderm in maintaining cell fate decisions in the intermediate mesoderm. Enhanced endoderm development favors the angioblast cell fate over kidney cell fate - presumably by non-cell-autonomous signals. Further identification of osr1 primary target genes and the signals emanating from endoderm are likely to reveal important aspects of kidney and vascular progenitor cell differentiation.

Supplementary material
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/135/20/3355/DC1


    ACKNOWLEDGMENTS
 
We thank personnel in the Fish facility at MGH for help with fish husbandry, Dr Alan Davidson for the swirl mutant and for comments on this work, Dr Jing Wei Xiong for bonnie and clyde mutants and blood/vascular lineage markers, Randy Peterson and Chetana Sachidanandan for endoderm markers, Sasha Petrova for editing this manuscript, and Dr Tom Schultheiss for critical review of the data. This work was funded by a National Institute of Health grant (DK071041) to I.A.D. and by a postdoctoral fellowship from American Heart Association (0625923T) to S.P.M.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D. Y. (1999). casanova plays an early and essential role in endoderm formation in zebrafish. Dev. Biol. 215,343 -357.[CrossRef][Medline]

Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E. W. (2004). Neural crest survival and differentiation in zebrafish depends on mont blanc/tfap2a gene function. Development 131,1463 -1477.[Abstract/Free Full Text]

Bisgrove, B. W., Raible, D. W., Walter, V., Eisen, J. S. and Grunwald, D. J. (1997). Expression of c-ret in the zebrafish embryo: potential roles in motoneuronal development. J. Neurobiol. 33,749 -768.[CrossRef][Medline]

Bollig, F., Mehringer, R., Perner, B., Hartung, C., Schafer, M., Schartl, M., Volff, J. N., Winkler, C. and Englert, C. (2006). Identification and comparative expression analysis of a second wt1 gene in zebrafish. Dev. Dyn. 235,554 -561.[CrossRef][Medline]

Bouchard, M., Souabni, A., Mandler, M., Neubuser, A. and Busslinger, M. (2002). Nephric lineage specification by Pax2 and Pax8. Genes Dev. 16,2958 -2970.[Abstract/Free Full Text]

Brown, L. A., Rodaway, A. R., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90,237 -252.[CrossRef][Medline]

Caprioli, A., Minko, K., Drevon, C., Eichmann, A., Dieterlen-Lievre, F. and Jaffredo, T. (2001). Hemangioblast commitment in the avian allantois: cellular and molecular aspects. Dev. Biol. 238,64 -78.[CrossRef][Medline]

Chen, J. N. and Fishman, M. C. (1996). Zebrafish tinman homolog demarcates the heart field and initiates myocardial differentiation. Development 122,3809 -3816.[Abstract]

Chi, C. L., Martinez, S., Wurst, W. and Martin, G. R. (2003). The isthmic organizer signal FGF8 is required for cell survival in the prospective midbrain and cerebellum. Development 130,2633 -2644.[Abstract/Free Full Text]

Crosier, P. S., Kalev-Zylinska, M. L., Hall, C. J., Flores, M. V., Horsfield, J. A. and Crosier, K. E. (2002). Pathways in blood and vessel development revealed through zebrafish genetics. Int. J. Dev. Biol. 46,493 -502.[Medline]

Davidson, A. J. and Zon, L. I. (2004). The `definitive' (and `primitive') guide to zebrafish hematopoiesis. Oncogene 23,7233 -7246.[CrossRef][Medline]

Debacker, C., Catala, M. and Labastie, M. C. (1999). Embryonic expression of the human GATA-3 gene. Mech. Dev. 85,183 -187.[CrossRef][Medline]

Detrich, H. W., 3rd, Kieran, M. W., Chan, F. Y., Barone, L. M., Yee, K., Rundstadler, J. A., Pratt, S., Ransom, D. and Zon, L. I. (1995). Intraembryonic hematopoietic cell migration during vertebrate development. Proc. Natl. Acad. Sci. USA 92,10713 -10717.[Abstract/Free Full Text]

Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A. F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M. (2000). Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo. Development 127,343 -354.[Abstract]

Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N., Aanstad, P., Clark, M., Strahle, U. and Rosa, F. (2001). A crucial component of the endoderm formation pathway, CASANOVA, is encoded by a novel sox-related gene. Genes Dev. 15,1487 -1492.[Abstract/Free Full Text]

Dooley, K. A., Davidson, A. J. and Zon, L. I. (2005). Zebrafish scl functions independently in hematopoietic and endothelial development. Dev. Biol. 277,522 -536.[CrossRef][Medline]

Drummond, I. A., Majumdar, A., Hentschel, H., Elger, M., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Stemple, D. L., Zwartkruis, F., Rangini, Z. et al. (1998). Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function. Development 125,4655 -4667.[Abstract]

Elizondo, M. R., Arduini, B. L., Paulsen, J., MacDonald, E. L., Sabel, J. L., Henion, P. D., Cornell, R. A. and Parichy, D. M. (2005). Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr. Biol. 15,667 -671.[CrossRef][Medline]

Fujimoto, T., Ogawa, M., Minegishi, N., Yoshida, H., Yokomizo, T., Yamamoto, M. and Nishikawa, S. (2001). Step-wise divergence of primitive and definitive haematopoietic and endothelial cell lineages during embryonic stem cell differentiation. Genes Cells 6,1113 -1127.[Abstract]

Funayama, N., Sato, Y., Matsumoto, K., Ogura, T. and Takahashi, Y. (1999). Coelom formation: binary decision of the lateral plate mesoderm is controlled by the ectoderm. Development 126,4129 -4138.[Abstract]

Gering, M., Rodaway, A. R., Gottgens, B., Patient, R. K. and Green, A. R. (1998). The SCL gene specifies haemangioblast development from early mesoderm. EMBO J. 17,4029 -4045.[CrossRef][Medline]

Gering, M., Yamada, Y., Rabbitts, T. H. and Patient, R. K. (2003). Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts which differentiate into endothelial cells in the absence of Gata1. Development 130,6187 -6199.[Abstract/Free Full Text]

Grieshammer, U., Agarwal, P. and Martin, G. R. (2008). A Cre transgene active in developing endodermal organs, heart, limb, and extra-ocular muscle. Genesis 46, 69-73.[CrossRef][Medline]

Grote, D., Souabni, A., Busslinger, M. and Bouchard, M. (2006). Pax 2/8-regulated Gata 3 expression is necessary for morphogenesis and guidance of the nephric duct in the developing kidney. Development 133,53 -61.[Abstract/Free Full Text]

Gupta, S., Zhu, H., Zon, L. I. and Evans, T. (2006). BMP signaling restricts hemato-vascular development from lateral mesoderm during somitogenesis. Development 133,2177 -2187.[Abstract/Free Full Text]

Habeck, H., Odenthal, J., Walderich, B., Maischein, H. and Schulte-Merker, S. (2002). Analysis of a zebrafish VEGF receptor mutant reveals specific disruption of angiogenesis. Curr. Biol. 12,1405 -1412.[CrossRef][Medline]

Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van Eeden, F. J., Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P., Heisenberg, C. P. et al. (1996). dino and mercedes, two genes regulating dorsal development in the zebrafish embryo. Development 123,95 -102.[Abstract]

Hans, S., Liu, D. and Westerfield, M. (2004). Pax8 and Pax2a function synergistically in otic specification, downstream of the Foxi1 and Dlx3b transcription factors. Development 131,5091 -5102.[Abstract/Free Full Text]

Hild, M., Dick, A., Rauch, G. J., Meier, A., Bouwmeester, T., Haffter, P. and Hammerschmidt, M. (1999). The smad5 mutation somitabun blocks Bmp2b signaling during early dorsoventral patterning of the zebrafish embryo. Development 126,2149 -2159.[Abstract]

Humphrey, C. D. and Pittman, F. E. (1974). A simple methylene blue-azure II-basic fuchsin stain for epoxy-embedded tissue sections. Stain Technol. 49, 9-14.[Medline]

Iraha, F., Saito, Y., Yoshida, K., Kawakami, M., Izutsu, Y., Daar, I. O. and Maeno, M. (2002). Common and distinct signals specify the distribution of blood and vascular cell lineages in Xenopus laevis embryos. Dev. Growth Differ. 44,395 -407.[CrossRef][Medline]

James, R. G. and Schultheiss, T. M. (2005). Bmp signaling promotes intermediate mesoderm gene expression in a dose-dependent, cell-autonomous and translation-dependent manner. Dev. Biol. 288,113 -125.[CrossRef][Medline]

James, R. G., Kamei, C. N., Wang, Q., Jiang, R. and Schultheiss, T. M. (2006). Odd-skipped related 1 is required for development of the metanephric kidney and regulates formation and differentiation of kidney precursor cells. Development 133,2995 -3004.[Abstract/Free Full Text]

Jin, S. W., Beis, D., Mitchell, T., Chen, J. N. and Stainier, D. Y. (2005). Cellular and molecular analyses of vascular tube and lumen formation in zebrafish. Development 132,5199 -5209.[Abstract/Free Full Text]

Julich, D., Hwee Lim, C., Round, J., Nicolaije, C., Schroeder, J., Davies, A., Geisler, R., Lewis, J., Jiang, Y. J. and Holley, S. A. (2005). beamter/deltaC and the role of Notch ligands in the zebrafish somite segmentation, hindbrain neurogenesis and hypochord differentiation. Dev. Biol. 286,391 -404.[CrossRef][Medline]

Kikuchi, Y., Trinh, L. A., Reiter, J. F., Alexander, J., Yelon, D. and Stainier, D. Y. (2000). The zebrafish bonnie and clyde gene encodes a Mix family homeodomain protein that regulates the generation of endodermal precursors. Genes Dev. 14,1279 -1289.[Abstract/Free Full Text]

Kimelman, D. (2006). Mesoderm induction: from caps to chips. Nat. Rev. Genet. 7, 360-372.[CrossRef][Medline]

Kimelman, D. and Griffin, K. J. (2000). Vertebrate mesendoderm induction and patterning. Curr. Opin. Genet. Dev. 10,350 -356.[CrossRef][Medline]

Kimmel, C. B., Warga, R. M. and Schilling, T. F. (1990). Origin and organization of the zebrafish fate map. Development 108,581 -594.[Abstract/Free Full Text]

Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and Schulte-Merker, S. (1997). The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124,4457 -4466.[Abstract]

Kramer-Zucker, A. G., Wiessner, S., Jensen, A. M. and Drummond, I. A. (2005). Organization of the pronephric filtration apparatus in zebrafish requires Nephrin, Podocin and the FERM domain protein Mosaic eyes. Dev. Biol. 285,316 -329.[CrossRef][Medline]

Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression of the zebrafish paired box gene pax[zf-b] during early neurogenesis. Development 113,1193 -1206.[Abstract]

Lane, M. C. and Sheets, M. D. (2006). Heading in a new direction: implications of the revised fate map for understanding Xenopus laevis development. Dev. Biol. 296, 12-28.[CrossRef][Medline]

Leung, A. Y., Mendenhall, E. M., Kwan, T. T., Liang, R., Eckfeldt, C., Chen, E., Hammerschmidt, M., Grindley, S., Ekker, S. C. and Verfaillie, C. M. (2005). Characterization of expanded intermediate cell mass in zebrafish chordin morphant embryos. Dev. Biol. 277,235 -254.[CrossRef][Medline]

Liao, W., Bisgrove, B. W., Sawyer, H., Hug, B., Bell, B., Peters, K., Grunwald, D. J. and Stainier, D. Y. (1997). The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development 124,381 -389.[Abstract]

Lieschke, G. J., Oates, A. C., Paw, B. H., Thompson, M. A., Hall, N. E., Ward, A. C., Ho, R. K., Zon, L. I. and Layton, J. E. (2002). Zebrafish SPI-1 (PU.1) marks a site of myeloid development independent of primitive erythropoiesis: implications for axial patterning. Dev. Biol. 246,274 -295.[CrossRef][Medline]

Liu, Y., Pathak, N., Kramer-Zucker, A. and Drummond, I. A. (2007). Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros. Development 134,1111 -1122.[Abstract/Free Full Text]

Majumdar, A. and Drummond, I. A. (1999). Podocyte differentiation in the absence of endothelial cells as revealed in the zebrafish avascular mutant, cloche. Dev. Genet. 24,220 -229.[CrossRef][Medline]

Majumdar, A., Lun, K., Brand, M. and Drummond, I. A. (2000). Zebrafish no isthmus reveals a role for pax2.1 in tubule differentiation and patterning events in the pronephric primordia. Development 127,2089 -2098.[Abstract]

Marcos-Gutierrez, C. V., Wilson, S. W., Holder, N. and Pachnis, V. (1997). The zebrafish homologue of the ret receptor and its pattern of expression during embryogenesis. Oncogene 14,879 -889.[CrossRef][Medline]

Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M. and Lassar, A. B. (2001). Inhibition of Wnt activity induces heart formation from posterior mesoderm. Genes Dev. 15,316 -327.[Abstract/Free Full Text]

Miller-Bertoglio, V., Carmany-Rampey, A., Furthauer, M., Gonzalez, E. M., Thisse, C., Thisse, B., Halpern, M. E. and Solnica-Krezel, L. (1999). Maternal and zygotic activity of the zebrafish ogon locus antagonizes BMP signaling. Dev. Biol. 214, 72-86.[CrossRef][Medline]

Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M. and Mullins, M. C. (1998). Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev. Biol. 199,93 -110.[CrossRef][Medline]

Perner, B., Englert, C. and Bollig, F. (2007). The Wilms tumor genes wt1a and wt1b control different steps during formation of the zebrafish pronephros. Dev. Biol. 309, 87-96.[CrossRef][Medline]

Poulain, M., Furthauer, M., Thisse, B., Thisse, C. and Lepage, T. (2006). Zebrafish endoderm formation is regulated by combinatorial Nodal, FGF and BMP signalling. Development 133,2189 -2200.[Abstract/Free Full Text]

Pyati, U. J., Webb, A. E. and Kimelman, D. (2005). Transgenic zebrafish reveal stage-specific roles for Bmp signaling in ventral and posterior mesoderm development. Development 132,2333 -2343.[Abstract/Free Full Text]

Reiter, J. F., Alexander, J., Rodaway, A., Yelon, D., Patient, R., Holder, N. and Stainier, D. Y. (1999). Gata5 is required for the development of the heart and endoderm in zebrafish. Genes Dev. 13,2983 -2995.[Abstract/Free Full Text]

Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., Smith, J. C., Patient, R. and Holder, N. (1999). Induction of the mesendoderm in the zebrafish germ ring by yolk cell-derived TGF-beta family signals and discrimination of mesoderm and endoderm by FGF. Development 126,3067 -3078.[Abstract]

Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in zebrafish. Annu. Rev. Genet. 39,561 -613.[CrossRef][Medline]

Schmid, B., Furthauer, M., Connors, S. A., Trout, J., Thisse, B., Thisse, C. and Mullins, M. C. (2000). Equivalent genetic roles for bmp7/snailhouse and bmp2b/swirl in dorsoventral pattern formation. Development 127,957 -967.[Abstract]

Schneider, V. A. and Mercola, M. (2001). Wnt antagonism initiates cardiogenesis in Xenopus laevis. Genes Dev. 15,304 -315.[Abstract/Free Full Text]

Serluca, F. C. and Fishman, M. C. (2001). Pre-pattern in the pronephric kidney field of zebrafish. Development 128,2233 -2241.[Abstract/Free Full Text]

Shmukler, B. E., Kurschat, C. E., Ackermann, G. E., Jiang, L., Zhou, Y., Barut, B., Stuart-Tilley, A. K., Zhao, J., Zon, L. I., Drummond, I. A. et al. (2005). Zebrafish slc4a2/ae2 anion exchanger: cDNA cloning, mapping, functional characterization, and localization. Am. J. Physiol. Renal Physiol. 289,F835 -F849.[Abstract/Free Full Text]

So, P. L. and Danielian, P. S. (1999). Cloning and expression analysis of a mouse gene related to Drosophila odd-skipped. Mech. Dev. 84,157 -160.[CrossRef][Medline]

Stickney, H. L., Imai, Y., Draper, B., Moens, C. and Talbot, W. S. (2007). Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates. Dev. Biol. 310, 71-84.[CrossRef][Medline]

Sumanas, S. and Lin, S. (2006). Ets1-related protein is a key regulator of vasculogenesis in zebrafish. PLoS Biol. 4,e10 .[CrossRef][Medline]

Szeto, D. P. and Kimelman, D. (2004). Combinatorial gene regulation by Bmp and Wnt in zebrafish posterior mesoderm formation. Development 131,3751 -3760.[Abstract/Free Full Text]

Tena, J. J., Neto, A., de la Calle-Mustienes, E., Bras-Pereira, C., Casares, F. and Gomez-Skarmeta, J. L. (2007). Odd-skipped genes encode repressors that control kidney development. Dev. Biol. 301,518 -531.[CrossRef][Medline]

Thisse, B., Heyer, V., Lux, A., Alunni, V., Degrave, A., Seiliez, I., Kirchner, J., Parkhill, J. P. and Thisse, C. (2004). Spatial and temporal expression of the zebrafish genome by large-scale in situ hybridization screening. Methods Cell Biol. 77,505 -519.[Medline]

Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., 3rd, Vail, B., Huber, T. L., Paw, B., Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197,248 -269.[CrossRef][Medline]

Toyama, R. and Dawid, I. B. (1997). lim6, a novel LIM homeobox gene in the zebrafish: comparison of its expression pattern with lim1. Dev. Dyn. 209,406 -417.[CrossRef][Medline]

Trinh, L. A. and Stainier, D. Y. (2004). Fibronectin regulates epithelial organization during myocardial migration in zebrafish. Dev. Cell 6,371 -382.[CrossRef][Medline]

Urban, A. E., Zhou, X., Ungos, J. M., Raible, D. W., Altmann, C. R. and Vize, P. D. (2006). FGF is essential for both condensation and mesenchymal-epithelial transition stages of pronephric kidney tubule development. Dev. Biol. 297,103 -117.[CrossRef][Medline]

Vogeli, K. M., Jin, S. W., Martin, G. R. and Stainier, D. Y. (2006). A common progenitor for haematopoietic and endothelial lineages in the zebrafish gastrula. Nature 443,337 -339.[CrossRef][Medline]

Vokes, S. A., Yatskievych, T. A., Heimark, R. L., McMahon, J., McMahon, A. P., Antin, P. B. and Krieg, P. A. (2004). Hedgehog signaling is essential for endothelial tube formation during vasculogenesis. Development 131,4371 -4380.[Abstract/Free Full Text]

Walmsley, M., Ciau-Uitz, A. and Patient, R. (2002). Adult and embryonic blood and endothelium derive from distinct precursor populations which are differentially programmed by BMP in Xenopus. Development 129,5683 -5695.[CrossRef][Medline]

Wang, Q., Lan, Y., Cho, E. S., Maltby, K. M. and Jiang, R. (2005). Odd-skipped related 1 (Odd 1) is an essential regulator of heart and urogenital development. Dev. Biol. 288,582 -594.[CrossRef][Medline]

Westerfield, M. (1995). The Zebrafish Book. Eugene, OR: University of Oregon Press.

Wingert, R. A., Selleck, R., Yu, J., Song, H. D., Chen, Z., Song, A., Zhou, Y., Thisse, B., Thisse, C., McMahon, A. P. et al. (2007). The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros. PLoS Genet. 3,1922 -1938.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S.-W. Jin and C. Patterson
The Opening Act: Vasculogenesis and the Origins of Circulation
Arterioscler. Thromb. Vasc. Biol., May 1, 2009; 29(5): 623 - 629.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.022830v1
135/20/3355    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mudumana, S. P.
Right arrow Articles by Drummond, I. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mudumana, S. P.
Right arrow Articles by Drummond, I. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?