|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 11 September 2008
doi: 10.1242/dev.022830
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Nephrology Division, Massachusetts General Hospital, Charlestown, MA 02129,
USA.
2 Renal Division, Brigham and Women's Hospital, Boston, MA 02115, USA.
* Author for correspondence (e-mail: idrummon{at}receptor.mgh.harvard.edu)
Accepted 26 August 2008
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Odd-skipped related, Endoderm, Pronephros, Vasculature, Glomerulus, Kidney development, Zebrafish
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Kimelman, 2006;
Kimmel et al., 1990;
Walmsley et al., 2002). Soon
after gastrulation is complete, zebrafish kidney progenitors, which are marked
by the expression of transcriptional regulators such as pax2a
(Krauss et al., 1991;
Majumdar et al., 2000) and
lim1 (Toyama and Dawid,
1997), and blood/vascular progenitors, which are marked by
expression of scl (Gering et al.,
1998) and gata1
(Detrich et al., 1995), are
found in adjacent stripes of mesoderm lateral to the somites. These tissues,
referred to as intermediate mesoderm (IM) in nephric development and lateral
plate mesoderm (LPM) in blood vascular development, serve as the source of all
pronephric cells, the posterior blood islands, and the main vessels of the
trunk, the dorsal aorta and the cardinal vein. Analysis of mesoderm patterning
in frog embryos has demonstrated overlapping expression of the vascular marker
fli1 and the kidney marker lim1 in intermediate mesoderm
(Walmsley et al., 2002),
suggesting that, prior to cell differentiation, kidney and blood/vascular
cells may share a common progenitor cell population. The close association of
kidney and vascular progenitor cells during development is ultimately
manifested as a functional relationship in the mature organs, where arterial
blood is filtered by the kidney glomerulus and metabolites recovered by kidney
tubules are delivered directly back to the venous blood supply. This
relationship between kidney and vascular tissues raises the idea that the
specification of kidney and vascular progenitor cells in early embryos may be
influenced by common developmental regulatory factors.
Both kidney and vascular patterning is strongly influenced by bone
morphogenetic proteins (BMPs) during gastrulation
(Kimelman, 2006;
Kimelman and Griffin, 2000;
Pyati et al., 2005;
Stickney et al., 2007;
Szeto and Kimelman, 2004).
Zebrafish mutants defective in BMP signaling, such as swirl/bmp2b
(Kishimoto et al., 1997;
Nguyen et al., 1998),
snailhouse/bmp7 (Dick et al.,
2000; Schmid et al.,
2000) and somitabun/smad5
(Hild et al., 1999), show a
reduced number of both kidney and blood cell progenitors, and an expansion of
dorsal somites. However, ventralized/posteriorized mutants that lack BMP
inhibitors such as chordino/chordin and the tolloid antagonist
ogon/sizzled show an enlargement of kidney and blood precursor cell
populations and a loss of anterior somites
(Hammerschmidt et al., 1996;
Leung et al., 2005;
Miller-Bertoglio et al.,
1999). Signaling events occurring later in development may also
affect kidney versus blood/vascular fates. Post-gastrulation expression of a
dominant-negative BMP receptor expands the gata1-positive blood
progenitor cell population and reduces the number of pax2a-positive
kidney progenitor cells in the ventroposterior mesoderm
(Gupta et al., 2006).
Mutations in BMP4 affect ventrolateral mesoderm at post-gastrulation stages,
favoring blood and kidney development at the expense of vascular development
(Stickney et al., 2007).
Evidence has also been presented that blood/vascular and kidney fates may be
mutually exclusive in the mesoderm. Ectopic overexpression of the
blood/vascular transcriptional regulators scl and lmo2
during early development results in expansion of the blood/vascular progenitor
cell population at the expense of kidney progenitors, indicating that
intermediate mesoderm can be transfated to blood/vasculature mesoderm
(Gering et al., 2003). These
findings suggest that the differentiation of the blood/vascular and kidney
lineages are linked at multiple stages of development. It is likely that, in
addition to BMP signaling, other morphogens and transcriptional circuitry is
required to ultimately define lateral mesoderm cell lineages.
The zinc-finger transcription factor odd-skipped related 1
(osr1) is initially expressed in the mesendoderm in gastrulating
zebrafish embryos and, later, in a broad domain of lateral plate/intermediate
mesoderm that encompasses both kidney and vascular mesoderm in chick, mouse
and zebrafish embryos (James et al.,
2006; Tena et al.,
2007; Wang et al.,
2005). Mouse embryos lacking a functional Osr1 gene show
cardiac defects and kidney agenesis (James
et al., 2006; Wang et al.,
2005). Knockdown experiments in zebrafish have also revealed a
role for osr1 in pronephric development
(Tena et al., 2007). We
present here evidence that osr1 is not only required for zebrafish
kidney development but that it also controls the commitment of mesoderm to the
angioblast cell fate. Surprisingly, we find that the function of osr1
in post-gastrulation mesoderm differentiation is linked to an early role in
regulating mesoderm versus endoderm differentiation during gastrulation. Our
findings reveal a novel role for endoderm in determining the balance of kidney
versus angioblast cell differentiation during somitogenesis.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Zebrafish embryos
Wild-type zebrafish were maintained according to established protocols
(Westerfield, 1995). The
embryos for experiments were collected from crosses of wild-type Tü/AB
adults, grown at 28°C and fixed at the indicated developmental stages.
bonnie and clyde homozygous mutant embryos were obtained from an
incross of bonm425/+ heterozygotes.
Morpholino antisense oligonucleotides
Morpholino oligonucleotides were designed to either target the translation
start site or the splice donor site of target mRNAs. The following morpholino
oligonucleotides were used: osr1 ex2d (osr1MO),
ATCTCATCCTTACCTGTGGTCTCTC; osr1 ATG, GGAGCGTCTTACTACCCATGACTAA;
osr1CoMO, AATCAGTACCCATCATTCTGCGAGG; scl ATG,
GCTCGGATTTCAGTTTTTCCATCAT (Sumanas and
Lin, 2006); pax2a E2, TATGTGCTTTTTCTTACCTTCCGAG;
pax8 E5, TTTCTGCACTCACTGTCATCGTGTC
(Hans et al., 2004);
pax8 E9, ACCGGCGGCAGCTCACCTGATACCA
(Hans et al., 2004);
sox32 ATG,CAGGGAGCATCCGGTCGAGATACAT
(Dickmeis et al., 2001).
Microinjections and molecular analysis
Morpholino oligonucleotides were diluted in 100 mM KCl and 10 mM HEPES and
injections were performed using a nanoliter2000 microinjector (World Precision
Instruments). Injection concentrations ranged from 0.05 mM to 0.2 mM and
injection volume was set at 4.6 nl/embryo (1.4-7.4 ng/embryo). Efficiency of
morpholino splicing was confirmed by RT-PCR. Total RNA from single embryos at
different stages was isolated using Trizol according to the manufacturer's
instructions. RT followed by nested PCR was performed with gene-specific
nested forward and reverse primers, and purified for sequencing. Full-length
mRNAs were injected into one- to two-cell embryos and grown at 28°C for
further analysis.
Whole-mount in situ hybridization and immunohistochemistry
Whole-mount in situ hybridization on embryos of different stages was
performed using antisense RNA probes labeled with digoxigenin or fluorescein
(Boehringer Mannheim, Germany) as described previously
(Thisse et al., 2004). Stained
embryos were fixed, cleared with dimethylformamide, transferred into
PBS:Glycerol (1:1) and photographed on a Leitz MZ12 or Nikon E800 microscope
equipped with Spot Image digital camera. Whole-mount immunohistochemistry for
NaK ATPase (alpha6F monoclonal) was performed as described by Drummond et al.
(Drummond et al., 1998).
Whole-mount double fluorescent in situ hybridization was performed as
described previously [S. Holley, Yale University, CT, personal communication
(Julich et al., 2005;
Liu et al., 2007)]. Stained
embryos were dehydrated in methanol, cleared with 2:1 benzyl benzoate:benzyl
alcohol, and examined with a Zeiss LSM5 Pascal-confocal microscope. For in
situ hybridization of sections, embryos were sectioned in JB-4 to a thickness
of 10 µm and examined using a Nikon E800 microscope.
Histochemistry
Embryos for histological analysis were fixed with 4% paraformaldehyde (PFA)
in PBS overnight, followed by dehydration and embedding in JB-4 (Polysciences)
and sectioned at 5-7 µm. Slides were stained in Methylene Blue/Azure II
(Humphrey and Pittman,
1974).
Acridine Orange and TUNEL staining
Apoptosis in the embryos was assessed by Acridine Orange and TUNEL
(terminal transferase mediated dUTP nick end-labeling). Live embryos were used
for apoptotic cell staining with the vital dye Acridine Orange as described
(Barrallo-Gimeno et al., 2004).
Embryos were incubated in the dark in a 5 µg/ml Acridine Orange solution
(diluted from a 5 mg/ml stock) for 30 minutes, washed with egg water and
analyzed under a fluorescent Nikon E800 microscope. TUNEL staining was
performed on embryos fixed with 4% PFA-PBS overnight at 4°C as described
(Chi et al., 2003). The fixed
embryos were dechorionated, washed and transferred through a graded series of
methanol:PBT to 100% methanol. The embryos were rehydrated and permeabilized
by proteinase K, re-fixed in 4% PFA-PBS, washed with PBT and incubated in
blocking solution (3% H2O2 in methanol) for 1 hour at
room temperature. The embryos were then washed in PBT and incubated in
permeabilization solution (0.1% Triton X-100 in 0.1% sodium citrate) for 5
minutes on ice. The permeabilized embryos were then incubated for 1-3 hours
with terminal transferase (Roche) and fluorescein-labeled ddUTP at 37°C.
The embryos were washed with PBT several times, incubated in converter POD for
30 minutes at 37°C and detected using DAB.
Microangiography and vascular cell counts
48 hpf embryos were anaesthetized with Tricaine (16 mg/100 ml egg water),
mounted in 3% methylcellulose and injected with a 5% solution of 2,000,000
Dalton Rhodamine dextran in Hank's buffer into the sinus venosus. After 5
minutes, the injected embryos were imaged on a Zeiss LSM5 Pascal confocal
microscope. To quantify vascular cell number, nuclei were visualized in 15
µm plastic sections by DAPI staining. Endothelial cell nuclei were
identified by tissue morphology using DIC optics to identify the cardinal vein
and aorta in trunk cross-sections.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and, at
75% epiboly, in cells dispersed over the yolk in a pattern similar to endoderm
progenitors (Kikuchi et al.,
2000). Two-color in situ hybridization using osr1 and
no tail (ntl) probes revealed that osr1 expression
is restricted to vegetal tiers of mesendodermal cells closest to the margin
and is not present in more-animal cells that express ntl. osr1
expression overlapped with sox32 expression in the most vegetal tiers
of germ ring mesendoderm but not in cells of the yolk syncytial layer (YSL)
(Fig. 1E,F). To discern whether
osr1 was expressed in both mesoderm and endoderm progenitors, we used
double-fluorescent in situ hybridization and confocal microscopy.
Double-fluorescent in situ with osr1 and ntl probes reveal
that osr1 and ntl expression overlapped in a subset of cells
at 60% epiboly, whereas other more dispersed cells were positive for
osr1 but not for ntl
(Fig. 1G-I). To determine
whether these cells were endodermal progenitors, we assayed expression of the
endodermal markers sox17 and sox32. Double-fluorescent in
situ revealed that dispersed osr1-expressing cells also expressed
sox17 (Fig. 1J-L) and
sox32 (Fig. 1M-O). The
data indicate that osr1 is expressed in mesendoderm closest to the
YSL at 30% epiboly; later, as epiboly progresses, osr1 is expressed
in endoderm progenitors as well as in mesodermal cells that express
ntl.
|
). To discern the osr1 expression pattern at
higher resolution, we assayed its expression relative to known IM/LPM markers
using single and two-color in situ hybridization. At the tailbud stage (10
hpf), lim1 is expressed in bilateral stripes of IM adjacent to
presomitic mesoderm and in adaxial cells
(Fig. 2A,B). By contrast,
osr1 was expressed in cells displaced laterally and ventrally from
the lim1 expression domain (Fig.
2C,D). During somitogenesis, this pattern persisted and
osr1 was detected in bands of cells that superficially appear to be
the intermediate mesoderm; however, histological sections of 18 hpf embryos
show that these osr1-expressing cells lie ventral and lateral to the
pronephros, and are excluded from the forming pronephros
(Fig. 2E,F). This is also clear
at 24 hpf (Fig. 2G,H) where
sections of the trunk show osr1 expression in ventrolateral tissues,
but not in the pronephros. Sections of 18 and 24 hpf embryos also revealed
that osr1 was expressed in the endoderm at the midline. Endoderm
expression was confirmed by examining older embryos where osr1 was
shown to be expressed in the liver and gut at 48 hpf (see Fig. S1 in the
supplementary material). Two color in situs revealed that
osr1-expressing cells were lateral to pax2a
(Fig. 2I,J), scl
(Fig. 2L-M) and etsrp1
(Fig. 2O-Q) expressing cells.
Sections of embryos double-stained for pax2a and osr1
confirmed that osr1 is expressed ventrally and laterally to the
forming kidney (Fig. 2K). We
conclude that osr1 is not expressed in the IM during somitogenesis,
as previously reported. The lateral and ventral position of
osr1-positive cells and the early expression osr1 in both
mesoderm and endoderm suggests that this tissue is likely to be the zebrafish
equivalent of the splanchnopleure
(Funayama et al., 1999). In
light of previous reports on osr1 function in nephrogenesis and our
results that osr1 is not expressed in kidney tissue, we re-examined
the osr1 loss-of-function phenotype.
osr1 is specifically required for proximal pronephric nephron development
Previous studies suggested that osr1 loss of function resulted in
the complete absence of kidney tissue and gross edema
(Tena et al., 2007). By
contrast, we found that osr1 loss of function by morpholino knockdown
(Fig. 3A,B) resulted in a
segment-specific defect in the proximal nephron, whereas the distal nephron
was relatively unaffected (Fig.
3C-F). The chloride-bicarbonate exchanger ae2 is
expressed highly in the proximal nephron and at a lower level in the distal
nephron at 24 hpf (Fig. 3C)
(Shmukler et al., 2005). In
osr1 morphants, ae2 expression is specifically missing in
the proximal nephron, whereas expression in the distal nephron is unchanged
(Fig. 3D; 90% of injected
embryos; n=10). Expression of the NaK ATPase 
subunit marks
the full length of the nephron at 72 hpf
(Drummond et al., 1998)
(Fig. 3E). In confocal images
of osr1 morphants, NaK ATPase-positive tubules were truncated, with
proximal tubule segments missing (100% of injected embryos, n=15;
Fig. 3F). Both NaK ATPase
staining and ae2 in situ often revealed an asymmetric loss of the
proximal nephron (Fig. 3D). In
one experiment, nine out of 17 embryos showed asymmetric loss of the proximal
nephron, while the remaining eight showed a symmetric loss (as shown in
Fig. 4H). Similar proximal
segment-specific loss was observed using in situ probes for lim1, pax8,
osr2 and nbc1 (data not shown). Expression of more distal
nephron segment markers trpM7
(Elizondo et al., 2005;
Liu et al., 2007;
Wingert et al., 2007) and
ret1 (Bisgrove et al.,
1997; Marcos-Gutierrez et al.,
1997) were unaffected by osr1 loss of function (see Fig.
S2 in the supplementary material). Similar results were obtained with both an
osr1 ATG initiation codon blocking morpholino and the exon 2 splice
donor morpholino; all subsequent experiments were performed with the exon 2
donor morpholino as we could more rigorously determine the efficacy of
osr1 knockdown using RT-PCR. Apoptosis assays also revealed that loss
of the proximal nephron was not due to cell death (see Fig. S3 in the
supplementary material). These results indicate that kidney defects in
osr1 morphants are specific to the proximal nephron and also that
osr1 loss of function does not result in a general re-patterning of
nephron segments.
|
;
Drummond et al., 1998;
Majumdar and Drummond, 1999;
Perner et al., 2007;
Serluca and Fishman, 2001). In
wild-type embryos, wt1a is expressed in anterior lateral mesoderm
(Serluca and Fishman, 2001)
and strongly in prospective pronephric podocytes at 24 hpf
(Fig. 4A,C). At 48 hpf,
wt1a-positive podocytes surround a compact glomerular vascular tuft
derived from the aorta (Fig.
4E) (Drummond et al.,
1998; Majumdar and Drummond,
1999). In osr1 morphants, wt1a was expressed at
26 hpf, although in a somewhat more dispersed pattern
(Fig. 4B). Histological
sections showed bilateral groups of podocyte progenitors ventral to the
somites in all osr1 morphant embryos
(Fig. 4D). However, these
progenitors failed to coalesce into a compact structure at the midline, and a
mature vascularized glomerulus is never formed. nephrin is an
essential component of the pronephric glomerulus and is expressed in podocytes
in wild-type embryos (Fig. 4G)
(Kramer-Zucker et al., 2005).
osr1 loss of function eliminated nephrin expression in
podocytes (91% of injected embryos, n=12;
Fig. 4H). Similarly, expression
of podocin, another podocyte-specific marker, was absent from the
glomerulus in osr1 morphants (data not shown). The data suggest that
osr1 is not required for podocyte specification but rather functions
at a later step in glomerular maturation associated with integration of blood
vessels with podoctyes and the expression of the podocyte cell adhesion
molecules nephrin and podocin.
osr1 loss of function expands the angioblast cell lineage
As derivatives of the IM/LPM also include the vasculature, blood and the
heart, we analyzed the expression of vascular and blood markers in wild-type
and osr1 morphant embryos. The transcription factor scl is
expressed in both vascular and hematopoietic progenitor cells
(Gering et al., 1998). In
zebrafish, scl is first expressed during somitogenesis in cells that
occupy bilateral stripes in the trunk IM/LPM
(Gering et al., 1998)
(Fig. 5A,C). Strikingly, the
number of scl-expressing cells in the IM/LPM was significantly
expanded in osr1 morphants at the 12-somite stage (89% of injected
embryos, n=19; arrows, Fig.
5B). This expansion was most obvious in the anterior IM/LPM
adjacent to somites 1-8 and to the domain of proximal nephron pax2a
expression in wild-type embryos (Fig.
5A). Embryo staging was confirmed by double color in situ with
myoD and scl (see Fig. S4 in the supplementary material).
Expanded scl expression could also be seen in the posterior IM at 12
somites (Fig. 5D) and was
evident in the region of the forming venous plexus at 26 hpf (100% of injected
embryos, n=17; Fig.
5G,H). As scl-expressing cells could represent
progenitors of either vascular or hematopoietic lineages
(Gering et al., 1998), we next
asked whether a specific lineage was affected by loss of osr1. flk1,
the endothelial cell-specific receptor for VEGF is initially expressed in
hemangioblasts and subsequently maintained in endothelial cells during vessel
formation (Habeck et al.,
2002; Liao et al.,
1997; Thompson et al.,
1998). Similar to scl, flk1 is expressed during early
somitogenesis in bilateral stripes of IM/LPM cells
(Liao et al., 1997)
(Fig. 5C) that subsequently
contribute to the main trunk vessels (Liao
et al., 1997). In 12-somite osr1 morphants, expression of
flk1 is significantly upregulated in the anterior trunk, similar to
what we observed for scl expression (86% of injected embryos,
n=35; arrows, Fig.
5D). etsrp1 is the earliest expressed transcription
factor that controls vascular development without affecting hematopoietic
development (Sumanas and Lin,
2006). Similar to scl and flk1, etsrp1 is
expressed in bilateral stripes in the head and trunk of wild-type embryos
during somitogenesis (Sumanas and Lin,
2006) (Fig. 5E). In
12-somite osr1 morphants, etsrp1e-epressing cells are
significantly expanded in the anterior trunk IM/LPM (90% of injected embryos,
n=11; arrows, Fig.
5F).
|
|
) and
gata1 for the erythropoietic lineage
(Detrich et al., 1995). In
wild-type embryos, pu.1-positive myeloid progenitors are expressed in
both the rostral blood island and the posterior intermediate mesoderm or
caudal blood island (Fig. 5I).
Contrary to what we observe for scl, flk and etsrp, in
osr1 morphants, pu.1 expression was not expanded and in fact
was reduced in the anterior IM/LPM (87% of injected embryos, n=16;
Fig. 5J). We also found that
migration of pu.1-expressing ALM macrophages appears advanced
compared with controls (Fig.
5J). Similarly, expression of gata1-positive erythrocyte
progenitors (Fig. 4K) was not
expanded (arrow, Fig. 5L) and
in fact was reduced in the anterior IM/LPM (74% of injected embryos,
n=35). Analysis of the cardiac-specific homeobox gene nkx2.5
(Chen and Fishman, 1996) showed
normal expression in osr1 morphants, indicating that osr1
does not affect the specification of cardiac progenitors (data not shown).
These results indicate that osr1 is not only required for proximal
nephron development but also acts to limit angioblast cell differentiation,
most notably in the anterior IM/LPM.
|
|
osr1 is required for pronephric epithelial differentiation and to limit the size of the axial vein
To assess whether a re-specification of mesoderm occurs in osr1
morphants, we sectioned control (Fig.
7A) and osr1 morphants
(Fig. 7B) at 52 hpf, prior to
the development of gross edema, to examine the morphology of the glomerulus,
pronephric ducts and vasculature. At the level of pectoral fin in control
embryos (Fig. 7C, inset), the
glomerulus was visible ventral to the aorta as a compact structure (arrowhead,
Fig. 7C). However, in
osr1 morphants, all sectioned embryos lacked a vascularized
glomerulus and pronephric tubules at the level of the pectoral fin
(Fig. 7D, inset; n=4).
Instead, all sectioned embryos showed prominent profiles of the cardinal veins
(Fig. 7D, n=4), which
in serial sections, could be distinguished from the pronephros by the presence
of red blood cells in the lumen. In more posterior sections of wild-type
embryos (Fig. 7E), the
pronephros was visible as bilateral epithelial tubules (arrowhead,
Fig. 7E) that flank the medial
aorta and vein, here filled with nucleated red blood cells. In osr1
morphants, the pronephric tubules in the trunk were present but appeared
smaller (arrowhead, Fig. 7F)
compared with controls. Strikingly, the size of the medial vein was
significantly enlarged in osr1 morphants (v in
Fig. 7F) at all the A-P levels
examined (v in Fig.
7D,F). To determine whether the increase in vein lumen size was
associated with a corresponding increase in vein endothelial cell number and
to rule out the possibility that vein expansion was secondary to edema, we
counted DAPI stained endothelial cell nuclei in 15 µm sections (from the
trunk region, as in Fig. 7E,F)
of 36 hpf osr1 morphants that showed no pericardial expansion or
other evidence of edema. osr1 morphants showed a significant increase
in the number of vein endothelial cell nuclei [5.11±0.19/section
(s.e.m.), n=26 compared with 3.04±0.09/section, n=25
in control]. Arterial size and endothelial cell number were not affected
(2.6±0.1, n=25 in control versus 2.8±0.14,
n=26 in morphants) in osr1 morphants. To further analyze the
enlargement of veins in osr1 morphants, we performed microangiography
on control and osr1 morphants at 48 hpf. Control embryos and
osr1 morphants showed normal circulation in the dorsal aorta and
intersomitic vessels. However, the venous plexus region distal to the yolk
extension was dramatically expanded in all osr1 morphants examined
(v in Fig. 7H;
n=5) when compared with the control embryos (v in
Fig. 7G). Taken together, the
histology, cell counting and microangiography data strongly suggest that the
venous cell fate is expanded in osr1 morphants.
|
). In zebrafish, pax2a is specifically required for
proximal tubule cell differentiation in the pronephros
(Majumdar et al., 2000). We
therefore tested whether ectopic expression of pax2a in osr1
morphants would be sufficient to bypass a requirement for osr1 and
revert the osr1 morphant phenotype to wild-type patterning of kidney
and vascular tissues. We used the expression of ae2 as a measure of
the proximal nephron length in control and experimental embryos. The length of
ae2-positive proximal tubules in control embryos ranged from 300-500
µm (mean of 378 µm; 14/14, 100%)
(Fig. 8A,G). In osr1
morphants, ae2 segment length was reduced
(Fig. 8B) with 42% of embryos
(11/26) in the 100-200 µm range, 50% of embryos in the 200-300 µm range
and only 8% of the embryos (2/26) exhibiting wild-type segment length
(Fig. 8G). The overall mean
ae2-positive tubule length for osr1 morphants was 214 µm
compared with 378 µm for controls. Injection of pax2a mRNA into
osr1 morphants restored 60% of the embryos (18/28) to the wild-type
proximal tubule length of 300-500 µm (mean of 331 µm)
(Fig. 8C). In a complementary
fashion, pax2a expression reverted the expanded domain of
scl expression (compare Fig.
8D with
8E) to a wild-type pattern
(Fig. 8F). The data indicate
that in the absence of osr1 function, ectopic expression of
pax2a is sufficient to specify proximal pronephric tubule
differentiation. In addition, ectopic expression of pax2a is
sufficient to limit angioblast differentiation in the intermediate
mesoderm.
osr1 effects on mesoderm patterning are mediated by the endoderm
The simplest interpretation of our results so far would be that
osr1 functions early in the IM/LPM upstream of pax2a and
scl to drive kidney development while repressing angioblast
differentiation. However, several inconsistencies with this model were evident
in our data. First, our finding that the anterior IM/LPM was preferentially
affected in osr1 morphants was not consistent with the broad
posterior expression of osr1 in the IM that extended to the tailbud
(Fig. 2C, inset). We were also
surprised to find that the re-patterning of the IM/LPM by osr1 loss
of function occurred progressively during somitogenesis and was not evident at
the earliest stages of pax2a and scl expression. The early
expression pattern of pax2a at the 5-somite stage in osr1
morphants (Fig. 9B) was, in
fact, similar to the wild-type pattern
(Fig. 9A). However the anterior
IM pax2a expression domain at the 14-somite stage
(Fig. 9C) was reduced in
osr1 morphants (89% of injected embryos, n=37;
Fig. 9D) and, by 24 hpf,
completely absent (96% of injected embryos, n=53) (compare Fig.
9E with
9F). Similarly, scl
expression was normal at the 8-somite stage in osr1 morphants
(Fig. 9G,H) and only later, at
the 14-somite stage, was found to be expanded in osr1 morphants (89%
of injected embryos, n=19) (Fig.
9I,J). We could also rule out that the intermediate mesoderm was
patterned by an antagonistic relationship between genes downstream of
osr1 (pax2a and scl) as loss of function in these
genes alone, or in combination with osr1 loss of function, did not
result in expansion of the opposing lineage (see Fig. S5 in the supplementary
material). These results, together with our finding that ectopic expression of
osr1 only affected cell differentiation within the anterior IM/LPM,
suggested that osr1 might act indirectly to pattern the mesoderm.
|
|
). We
examined whether osr1 might function in mesendoderm patterning by
assessing expression of the endoderm-specific markers, foxa2 and
sox17. Strikingly, we found that endoderm differentiation was
strongly enhanced in osr1 morphants. The number of
sox17-positive cells at the shield stage
(Fig. 10A-C) was significantly
increased in osr1 morphants (100% of injected embryos, n=14;
Fig. 10D-F). Similarly, the
number of foxa2-positive cells
(Fig. 10G-I) was increased in
osr1 morphants (71% of injected embryos, n=21;
Fig. 10J-L). Intensified
expression of foxa2 at the 18-somite stage (86% of injected embryos,
n=15; Fig. 10M,N)
confirmed that development of the pharyngeal endoderm was enhanced by
osr1 loss of function. sox32/casanova is a
transcription factor that is required for all endodermal development
(Alexander et al., 1999). As
previously reported (Dickmeis et al.,
2001), knockdown of sox32 using an antisense morpholino
(Dickmeis et al., 2001)
specifically eliminated foxa2-expressing endoderm (93% of injected
embryos, n=15) but did not affect foxa2 expression in axial
mesoderm (Fig. 10O).
|
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Davidson and Zon, 2004;
Fujimoto et al., 2001;
Iraha et al., 2002;
Kimelman, 2006;
Kimelman and Griffin, 2000;
Kimmel et al., 1990;
Lane and Sheets, 2006;
Vogeli et al., 2006;
Walmsley et al., 2002)
prompted us to examine whether genes acting during early development might
affect the fate of both tissues. osr1 has been reported to be
expressed in the intermediate mesoderm and required for mouse and zebrafish
kidney development (James et al.,
2006; So and Danielian,
1999; Wang et al.,
2005). Our data indicate that osr1 is not simply required
for kidney development but rather it acts early in development to pattern the
mesendoderm that, in turn, has broader effects on development. Our results
also show that in zebrafish, osr1 is not expressed in typical
intermediate mesoderm but rather in more lateral and ventral cells that may
represent the zebrafish splanchnopleure
(Funayama et al., 1999). We
find that osr1 expression in lateral cells (splanchnopleure) is not
required for normal expression of pax2a as combined
sox32/osr1 loss of function results in normal pax2a
expression. Unexpectedly, the primary mechanism underlying osr1
loss-of-function phenotypes appears to be an increase in endoderm development
that later acts to inhibit kidney and favor vascular cell differentiation in
mesoderm.
A role for osr1 in mesendoderm patterning
Mesoderm and endoderm are derived from a mixed population of cells, the
mesendoderm, that constitutes the germ ring in zebrafish embryos. Our results
suggest that expression of osr1 in the germ ring plays an important
role in mesendoderm patterning by acting as a repressor of endoderm formation.
Both endoderm and mesoderm are induced by the Nodal-related factors
cyclops and squint in zebrafish
(Schier and Talbot, 2005).
High levels of Nodal signals induce endoderm in the most marginal blastomeres,
whereas in cells closer to the animal pole, induction of Tbox factors and FGF
promote mesoderm development and antagonize endoderm development
(Schier and Talbot, 2005).
Ventral expression of BMPs has also been shown to antagonize endoderm
development (Poulain et al.,
2006). osr1 expression is known to respond to BMP
signaling in chick embryo mesoderm (James
and Schultheiss, 2005) and we have confirmed that early expression
of osr1 in zebrafish requires the activity of a functional
bmp2b gene (data not shown). One model of osr1 activity
would be that after induction by bmp2b signaling, osr1 acts
as a transcriptional repressor in mesendoderm cells
(Tena et al., 2007),
antagonizing transcriptional responses downstream of Nodal signaling
(Schier and Talbot, 2005).
However, the expression pattern of osr1 throughout the germ ring
suggests that, in addition to BMP signaling, osr1 might also be
responsive to FGF or nodal signaling
(Rodaway et al., 1999).
Further experiments examining signals upstream of osr1 expression
will be required to better define osr1 function in the context of
mesendoderm patterning.
Does altered mesendoderm patterning account for osr1 phenotypes?
In mouse embryos, disruption of the Osr1 gene causes severe
defects in urogenital development (Wang et
al., 2005). Mutant mice show no evidence of ureteric bud or
metanephric kidney development and cellular defects in the Wolffian duct are
evident at a very early stage (E8.5)
(James et al., 2006;
Wang et al., 2005). The
nephrogenic mesenchyme shows reduced expression of Wt1
(Wang et al., 2005) and also
fails to express many other genes that define this tissue
(James et al., 2006). The
absence of properly specified nephrogenic mesenchyme in the mouse
Osr1 mutants, taken together with our results in the zebrafish raise
the possibility that Osr1 in the mouse may play additional roles
outside of the nephrogenic mesoderm to ensure proper patterning of the
intermediate mesoderm. Although Osr1 expression in endoderm has not
been detected in the mouse by in situ hybridization, recent analysis of a
mouse Osr1 (Osr1) bac transgenic shows that the
Osr1 gene contains regulatory elements that drive reporter expression
(Cre) in endodermal organs (Grieshammer et
al., 2008). Although suggestive of a function for osr1 in
endoderm, further experiments will be required to critically assess this
possibility.
Our results differ from a previous study of osr1 expression and
function in zebrafish kidney development
(Tena et al., 2007) where it
was concluded that `knockdown of osr1 and osr2 results in
the loss of all pronephric structures including the glomerulus'. We find that
osr1 morphant kidney defects are restricted to the proximal nephron,
and that glomerular morphogenesis is arrested in a stage-specific fashion,
subsequent to podocyte wt1a expression. Our results are not due to a
partial osr1 loss of function as we demonstrate that no wild-type
osr1 mRNA can be detected by RT-PCR in osr1 morphants at 24
hpf. These discrepancies are most probably due to the fact that Tena et al.
did not examine osr1 morphants with markers of the distal pronephros
or the specification of glomerular podocytes by wt1a expression. In
addition, in contrast to Tena et al., we show that zebrafish osr1 is
not expressed in pax2a-positive pronephric kidney cells during
somitogenesis, nor in mature glomeruli. We observe osr1 expression in
cells adjacent to the forming pronephros at the 18-somite stage, which could
have been easily mis-identified as the pronephros by Tena et al. In addition,
we observe strong osr1 expression in the liver, next to the
glomerulus, at 48 hpf, which at low magnification may have been mistaken for
glomerular expression by Tena et al. Our results agree with expression studies
in the chick showing that Osr1 is not expressed in differentiated
kidney cells. Ectopic expression studies in the chick also support the idea
that osr1 expression may actually impede kidney epithelial
differentiation (James et al.,
2006).
Given the previous work on osr1 and its broad early expression in
the intermediate mesoderm, the segment-specific loss of kidney tissue and the
selective expansion of vascular tissue in the anterior trunk of osr1
morphants that we observed was unexpected. In addition, the fact that
patterning defects in pax2a-positive kidney progenitors and
scl-positive angioblasts were observed relatively late in
development, during somitogenesis, argues that osr1 plays a role in
maintenance, but not in specification, of mesodermal lineages. The simplest
interpretation of our results is that signals that repress kidney and enhance
angioblast development emanate from anterior endoderm and thus most strongly
affect the anterior intermediate/lateral plate mesoderm. A central role for
endoderm in the context of osr1 loss of function may also help
explain other phenotypes of osr1 mutants/morphants. Both mouse and
zebrafish embryos lacking osr1 often show asymmetric loss of the
Wolffian duct/pronephric duct on the left side
(Wang et al., 2005) (our
results), which has been interpreted to suggest the existence of a latent
left-right asymmetry in the normally bilaterally symmetric kidney. Our results
raise the alternative possibility that asymmetric loss of kidney tissue could
be due to underlying asymmetries in endodermal tissues that negatively affect
Wolffian/pronephric duct formation. Asymmetric defects in Wolffian duct
development have also been reported in Gata3 knockout mice
(Grote et al., 2006), which
might be due to cell-autonomous effects of Gata3 loss of function in
the Wolffian ducts. Interestingly, however, Gata3 is also expressed
in endodermal tissues (Caprioli et al.,
2001; Debacker et al.,
1999), which may indirectly affect kidney development.
Although we observed an increase in vascular tissue in osr1
morphants, we did not observe a corresponding increase in blood cell
development. This could be due to the fact that the most strongly affected
tissue in osr1 morphants, the anterior intermediate mesoderm, is
known to be enriched for flk-and scl-positive angioblasts in
zebrafish, whereas more posterior mesoderm contains both angioblasts and
hematopoietic precursors that express gata1
(Dooley et al., 2005).
Alternatively, signals from expanded endoderm in osr1 morphants may
selectively favor angioblast development over erythropoiesis.
The role of the endoderm in mesodermal organogenesis
Our findings suggest that the effects of osr1 loss of function on
kidney and vascular patterning are mediated by signals from the endoderm. The
endoderm is known to regulate the development of other mesodermal derivatives
such as the heart (Alexander et al.,
1999; Dickmeis et al.,
2001; Kikuchi et al.,
2000; Reiter et al.,
1999). In chick and frog, the anterior endoderm induces
cardiogenesis by secreting a combination of BMPs and soluble inhibitors of Wnt
signaling such as Crescent and Dkk-1
(Marvin et al., 2001;
Schneider and Mercola, 2001).
In addition to its potential role as an inducer of heart tissue, endoderm
provides a matrix upon which cardiac progenitors and angioblasts migrate to
form a fused heart tube (Jin et al.,
2005; Trinh and Stainier,
2004). Interestingly, lack of endoderm in the one eyed
pinhead zebrafish mutant has been associated with a specific loss of
vein, but not of aorta, development (Brown
et al., 2000), which would be consistent with our results that an
early expansion of endoderm expands vein but not aorta development. In the
chick and mouse, sonic hedgehog signaling from endoderm is important for
vasculogenesis (Vokes et al.,
2004); however, this is apparently not essential in zebrafish
(Jin et al., 2005). A
candidate signal for the effect of endoderm on kidney development might be
sonic hedgehog, as it is expressed in the endoderm and when expressed
ectopically, hedgehog proteins can inhibit nephrogenesis
(Urban et al., 2006). However,
we found that cyclopamine treatment did not reverse the effects of
osr1 knockdown on kidney cell differentiation (Y.L. and I.D.,
unpublished), making it unlikely that hedgehog is the endoderm-derived signal.
Thus, although these studies demonstrate that the endoderm is a rich source of
soluble signaling molecules, it remains to be seen whether endoderm-derived
soluble factors pattern kidney tissue in the IM.
In summary, our studies have uncovered a new role for osr1 in patterning mesendoderm. osr1 acts to inhibit endoderm differentiation during gastrulation. Our work has also uncovered a previously unknown role for endoderm in maintaining cell fate decisions in the intermediate mesoderm. Enhanced endoderm development favors the angioblast cell fate over kidney cell fate - presumably by non-cell-autonomous signals. Further identification of osr1 primary target genes and the signals emanating from endoderm are likely to reveal important aspects of kidney and vascular progenitor cell differentiation.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/20/3355/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D. Y. (1999). casanova plays an early and essential role in endoderm formation in zebrafish. Dev. Biol. 215,343 -357.[CrossRef][Medline]
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Bisgrove, B. W., Raible, D. W., Walter, V., Eisen, J. S. and Grunwald, D. J. (1997). Expression of c-ret in the zebrafish embryo: potential roles in motoneuronal development. J. Neurobiol. 33,749 -768.[CrossRef][Medline]
Bollig, F., Mehringer, R., Perner, B., Hartung, C., Schafer, M., Schartl, M., Volff, J. N., Winkler, C. and Englert, C. (2006). Identification and comparative expression analysis of a second wt1 gene in zebrafish. Dev. Dyn. 235,554 -561.[CrossRef][Medline]
Bouchard, M., Souabni, A., Mandler, M., Neubuser, A. and
Busslinger, M. (2002). Nephric lineage specification by Pax2
and Pax8. Genes Dev. 16,2958
-2970.
Brown, L. A., Rodaway, A. R., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90,237 -252.[CrossRef][Medline]
Caprioli, A., Minko, K., Drevon, C., Eichmann, A., Dieterlen-Lievre, F. and Jaffredo, T. (2001). Hemangioblast commitment in the avian allantois: cellular and molecular aspects. Dev. Biol. 238,64 -78.[CrossRef][Medline]
Chen, J. N. and Fishman, M. C. (1996). Zebrafish tinman homolog demarcates the heart field and initiates myocardial differentiation. Development 122,3809 -3816.[Abstract]
Chi, C. L., Martinez, S., Wurst, W. and Martin, G. R.
(2003). The isthmic organizer signal FGF8 is required for cell
survival in the prospective midbrain and cerebellum.
Development 130,2633
-2644.
Crosier, P. S., Kalev-Zylinska, M. L., Hall, C. J., Flores, M. V., Horsfield, J. A. and Crosier, K. E. (2002). Pathways in blood and vessel development revealed through zebrafish genetics. Int. J. Dev. Biol. 46,493 -502.[Medline]
Davidson, A. J. and Zon, L. I. (2004). The `definitive' (and `primitive') guide to zebrafish hematopoiesis. Oncogene 23,7233 -7246.[CrossRef][Medline]
Debacker, C., Catala, M. and Labastie, M. C. (1999). Embryonic expression of the human GATA-3 gene. Mech. Dev. 85,183 -187.[CrossRef][Medline]
Detrich, H. W., 3rd, Kieran, M. W., Chan, F. Y., Barone, L. M.,
Yee, K., Rundstadler, J. A., Pratt, S., Ransom, D. and Zon, L. I.
(1995). Intraembryonic hematopoietic cell migration during
vertebrate development. Proc. Natl. Acad. Sci. USA
92,10713
-10717.
Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A. F., Talbot, W. S., Bouwmeester, T. and Hammerschmidt, M. (2000). Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo. Development 127,343 -354.[Abstract]
Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N.,
Aanstad, P., Clark, M., Strahle, U. and Rosa, F. (2001). A
crucial component of the endoderm formation pathway, CASANOVA, is encoded by a
novel sox-related gene. Genes Dev.
15,1487
-1492.
Dooley, K. A., Davidson, A. J. and Zon, L. I. (2005). Zebrafish scl functions independently in hematopoietic and endothelial development. Dev. Biol. 277,522 -536.[CrossRef][Medline]
Drummond, I. A., Majumdar, A., Hentschel, H., Elger, M., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Stemple, D. L., Zwartkruis, F., Rangini, Z. et al. (1998). Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function. Development 125,4655 -4667.[Abstract]
Elizondo, M. R., Arduini, B. L., Paulsen, J., MacDonald, E. L., Sabel, J. L., Henion, P. D., Cornell, R. A. and Parichy, D. M. (2005). Defective skeletogenesis with kidney stone formation in dwarf zebrafish mutant for trpm7. Curr. Biol. 15,667 -671.[CrossRef][Medline]
Fujimoto, T., Ogawa, M., Minegishi, N., Yoshida, H., Yokomizo, T., Yamamoto, M. and Nishikawa, S. (2001). Step-wise divergence of primitive and definitive haematopoietic and endothelial cell lineages during embryonic stem cell differentiation. Genes Cells 6,1113 -1127.[Abstract]
Funayama, N., Sato, Y., Matsumoto, K., Ogura, T. and Takahashi, Y. (1999). Coelom formation: binary decision of the lateral plate mesoderm is controlled by the ectoderm. Development 126,4129 -4138.[Abstract]
Gering, M., Rodaway, A. R., Gottgens, B., Patient, R. K. and Green, A. R. (1998). The SCL gene specifies haemangioblast development from early mesoderm. EMBO J. 17,4029 -4045.[CrossRef][Medline]
Gering, M., Yamada, Y., Rabbitts, T. H. and Patient, R. K.
(2003). Lmo2 and Scl/Tal1 convert non-axial mesoderm into
haemangioblasts which differentiate into endothelial cells in the absence of
Gata1. Development 130,6187
-6199.
Grieshammer, U., Agarwal, P. and Martin, G. R. (2008). A Cre transgene active in developing endodermal organs, heart, limb, and extra-ocular muscle. Genesis 46, 69-73.[CrossRef][Medline]
Grote, D., Souabni, A., Busslinger, M. and Bouchard, M.
(2006). Pax 2/8-regulated Gata 3 expression is necessary for
morphogenesis and guidance of the nephric duct in the developing kidney.
Development 133,53
-61.
Gupta, S., Zhu, H., Zon, L. I. and Evans, T.
(2006). BMP signaling restricts hemato-vascular development from
lateral mesoderm during somitogenesis. Development
133,2177
-2187.
Habeck, H., Odenthal, J., Walderich, B., Maischein, H. and Schulte-Merker, S. (2002). Analysis of a zebrafish VEGF receptor mutant reveals specific disruption of angiogenesis. Curr. Biol. 12,1405 -1412.[CrossRef][Medline]
Hammerschmidt, M., Pelegri, F., Mullins, M. C., Kane, D. A., van Eeden, F. J., Granato, M., Brand, M., Furutani-Seiki, M., Haffter, P., Heisenberg, C. P. et al. (1996). dino and mercedes, two genes regulating dorsal development in the zebrafish embryo. Development 123,95 -102.[Abstract]
Hans, S., Liu, D. and Westerfield, M. (2004).
Pax8 and Pax2a function synergistically in otic specification, downstream of
the Foxi1 and Dlx3b transcription factors. Development
131,5091
-5102.
Hild, M., Dick, A., Rauch, G. J., Meier, A., Bouwmeester, T., Haffter, P. and Hammerschmidt, M. (1999). The smad5 mutation somitabun blocks Bmp2b signaling during early dorsoventral patterning of the zebrafish embryo. Development 126,2149 -2159.[Abstract]
Humphrey, C. D. and Pittman, F. E. (1974). A simple methylene blue-azure II-basic fuchsin stain for epoxy-embedded tissue sections. Stain Technol. 49, 9-14.[Medline]
Iraha, F., Saito, Y., Yoshida, K., Kawakami, M., Izutsu, Y., Daar, I. O. and Maeno, M. (2002). Common and distinct signals specify the distribution of blood and vascular cell lineages in Xenopus laevis embryos. Dev. Growth Differ. 44,395 -407.[CrossRef][Medline]
James, R. G. and Schultheiss, T. M. (2005). Bmp signaling promotes intermediate mesoderm gene expression in a dose-dependent, cell-autonomous and translation-dependent manner. Dev. Biol. 288,113 -125.[CrossRef][Medline]
James, R. G., Kamei, C. N., Wang, Q., Jiang, R. and Schultheiss,
T. M. (2006). Odd-skipped related 1 is required for
development of the metanephric kidney and regulates formation and
differentiation of kidney precursor cells. Development
133,2995
-3004.
Jin, S. W., Beis, D., Mitchell, T., Chen, J. N. and Stainier, D.
Y. (2005). Cellular and molecular analyses of vascular tube
and lumen formation in zebrafish. Development
132,5199
-5209.
Julich, D., Hwee Lim, C., Round, J., Nicolaije, C., Schroeder, J., Davies, A., Geisler, R., Lewis, J., Jiang, Y. J. and Holley, S. A. (2005). beamter/deltaC and the role of Notch ligands in the zebrafish somite segmentation, hindbrain neurogenesis and hypochord differentiation. Dev. Biol. 286,391 -404.[CrossRef][Medline]
Kikuchi, Y., Trinh, L. A., Reiter, J. F., Alexander, J., Yelon,
D. and Stainier, D. Y. (2000). The zebrafish bonnie and clyde
gene encodes a Mix family homeodomain protein that regulates the generation of
endodermal precursors. Genes Dev.
14,1279
-1289.
Kimelman, D. (2006). Mesoderm induction: from caps to chips. Nat. Rev. Genet. 7, 360-372.[CrossRef][Medline]
Kimelman, D. and Griffin, K. J. (2000). Vertebrate mesendoderm induction and patterning. Curr. Opin. Genet. Dev. 10,350 -356.[CrossRef][Medline]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Kishimoto, Y., Lee, K. H., Zon, L., Hammerschmidt, M. and Schulte-Merker, S. (1997). The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124,4457 -4466.[Abstract]
Kramer-Zucker, A. G., Wiessner, S., Jensen, A. M. and Drummond, I. A. (2005). Organization of the pronephric filtration apparatus in zebrafish requires Nephrin, Podocin and the FERM domain protein Mosaic eyes. Dev. Biol. 285,316 -329.[CrossRef][Medline]
Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression of the zebrafish paired box gene pax[zf-b] during early neurogenesis. Development 113,1193 -1206.[Abstract]
Lane, M. C. and Sheets, M. D. (2006). Heading in a new direction: implications of the revised fate map for understanding Xenopus laevis development. Dev. Biol. 296, 12-28.[CrossRef][Medline]
Leung, A. Y., Mendenhall, E. M., Kwan, T. T., Liang, R., Eckfeldt, C., Chen, E., Hammerschmidt, M., Grindley, S., Ekker, S. C. and Verfaillie, C. M. (2005). Characterization of expanded intermediate cell mass in zebrafish chordin morphant embryos. Dev. Biol. 277,235 -254.[CrossRef][Medline]
Liao, W., Bisgrove, B. W., Sawyer, H., Hug, B., Bell, B., Peters, K., Grunwald, D. J. and Stainier, D. Y. (1997). The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation. Development 124,381 -389.[Abstract]
Lieschke, G. J., Oates, A. C., Paw, B. H., Thompson, M. A., Hall, N. E., Ward, A. C., Ho, R. K., Zon, L. I. and Layton, J. E. (2002). Zebrafish SPI-1 (PU.1) marks a site of myeloid development independent of primitive erythropoiesis: implications for axial patterning. Dev. Biol. 246,274 -295.[CrossRef][Medline]
Liu, Y., Pathak, N., Kramer-Zucker, A. and Drummond, I. A.
(2007). Notch signaling controls the differentiation of
transporting epithelia and multiciliated cells in the zebrafish pronephros.
Development 134,1111
-1122.
Majumdar, A. and Drummond, I. A. (1999). Podocyte differentiation in the absence of endothelial cells as revealed in the zebrafish avascular mutant, cloche. Dev. Genet. 24,220 -229.[CrossRef][Medline]
Majumdar, A., Lun, K., Brand, M. and Drummond, I. A. (2000). Zebrafish no isthmus reveals a role for pax2.1 in tubule differentiation and patterning events in the pronephric primordia. Development 127,2089 -2098.[Abstract]
Marcos-Gutierrez, C. V., Wilson, S. W., Holder, N. and Pachnis, V. (1997). The zebrafish homologue of the ret receptor and its pattern of expression during embryogenesis. Oncogene 14,879 -889.[CrossRef][Medline]
Marvin, M. J., Di Rocco, G., Gardiner, A., Bush, S. M. and
Lassar, A. B. (2001). Inhibition of Wnt activity induces
heart formation from posterior mesoderm. Genes Dev.
15,316
-327.
Miller-Bertoglio, V., Carmany-Rampey, A., Furthauer, M., Gonzalez, E. M., Thisse, C., Thisse, B., Halpern, M. E. and Solnica-Krezel, L. (1999). Maternal and zygotic activity of the zebrafish ogon locus antagonizes BMP signaling. Dev. Biol. 214, 72-86.[CrossRef][Medline]
Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M. and Mullins, M. C. (1998). Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev. Biol. 199,93 -110.[CrossRef][Medline]
Perner, B., Englert, C. and Bollig, F. (2007). The Wilms tumor genes wt1a and wt1b control different steps during formation of the zebrafish pronephros. Dev. Biol. 309, 87-96.[CrossRef][Medline]
Poulain, M., Furthauer, M., Thisse, B., Thisse, C. and Lepage,
T. (2006). Zebrafish endoderm formation is regulated by
combinatorial Nodal, FGF and BMP signalling.
Development 133,2189
-2200.
Pyati, U. J., Webb, A. E. and Kimelman, D.
(2005). Transgenic zebrafish reveal stage-specific roles for Bmp
signaling in ventral and posterior mesoderm development.
Development 132,2333
-2343.
Reiter, J. F., Alexander, J., Rodaway, A., Yelon, D., Patient,
R., Holder, N. and Stainier, D. Y. (1999). Gata5 is required
for the development of the heart and endoderm in zebrafish. Genes
Dev. 13,2983
-2995.
Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., Smith, J. C., Patient, R. and Holder, N. (1999). Induction of the mesendoderm in the zebrafish germ ring by yolk cell-derived TGF-beta family signals and discrimination of mesoderm and endoderm by FGF. Development 126,3067 -3078.[Abstract]
Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in zebrafish. Annu. Rev. Genet. 39,561 -613.[CrossRef][Medline]
Schmid, B., Furthauer, M., Connors, S. A., Trout, J., Thisse, B., Thisse, C. and Mullins, M. C. (2000). Equivalent genetic roles for bmp7/snailhouse and bmp2b/swirl in dorsoventral pattern formation. Development 127,957 -967.[Abstract]
Schneider, V. A. and Mercola, M. (2001). Wnt
antagonism initiates cardiogenesis in Xenopus laevis. Genes
Dev. 15,304
-315.
Serluca, F. C. and Fishman, M. C. (2001).
Pre-pattern in the pronephric kidney field of zebrafish.
Development 128,2233
-2241.
Shmukler, B. E., Kurschat, C. E., Ackermann, G. E., Jiang, L.,
Zhou, Y., Barut, B., Stuart-Tilley, A. K., Zhao, J., Zon, L. I., Drummond, I.
A. et al. (2005). Zebrafish slc4a2/ae2 anion exchanger: cDNA
cloning, mapping, functional characterization, and localization.
Am. J. Physiol. Renal Physiol.
289,F835
-F849.
So, P. L. and Danielian, P. S. (1999). Cloning and expression analysis of a mouse gene related to Drosophila odd-skipped. Mech. Dev. 84,157 -160.[CrossRef][Medline]
Stickney, H. L., Imai, Y., Draper, B., Moens, C. and Talbot, W. S. (2007). Zebrafish bmp4 functions during late gastrulation to specify ventroposterior cell fates. Dev. Biol. 310, 71-84.[CrossRef][Medline]
Sumanas, S. and Lin, S. (2006). Ets1-related protein is a key regulator of vasculogenesis in zebrafish. PLoS Biol. 4,e10 .[CrossRef][Medline]
Szeto, D. P. and Kimelman, D. (2004).
Combinatorial gene regulation by Bmp and Wnt in zebrafish posterior mesoderm
formation. Development
131,3751
-3760.
Tena, J. J., Neto, A., de la Calle-Mustienes, E., Bras-Pereira, C., Casares, F. and Gomez-Skarmeta, J. L. (2007). Odd-skipped genes encode repressors that control kidney development. Dev. Biol. 301,518 -531.[CrossRef][Medline]
Thisse, B., Heyer, V., Lux, A., Alunni, V., Degrave, A., Seiliez, I., Kirchner, J., Parkhill, J. P. and Thisse, C. (2004). Spatial and temporal expression of the zebrafish genome by large-scale in situ hybridization screening. Methods Cell Biol. 77,505 -519.[Medline]
Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., 3rd, Vail, B., Huber, T. L., Paw, B., Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197,248 -269.[CrossRef][Medline]
Toyama, R. and Dawid, I. B. (1997). lim6, a novel LIM homeobox gene in the zebrafish: comparison of its expression pattern with lim1. Dev. Dyn. 209,406 -417.[CrossRef][Medline]
Trinh, L. A. and Stainier, D. Y. (2004). Fibronectin regulates epithelial organization during myocardial migration in zebrafish. Dev. Cell 6,371 -382.[CrossRef][Medline]
Urban, A. E., Zhou, X., Ungos, J. M., Raible, D. W., Altmann, C. R. and Vize, P. D. (2006). FGF is essential for both condensation and mesenchymal-epithelial transition stages of pronephric kidney tubule development. Dev. Biol. 297,103 -117.[CrossRef][Medline]
Vogeli, K. M., Jin, S. W., Martin, G. R. and Stainier, D. Y. (2006). A common progenitor for haematopoietic and endothelial lineages in the zebrafish gastrula. Nature 443,337 -339.[CrossRef][Medline]
Vokes, S. A., Yatskievych, T. A., Heimark, R. L., McMahon, J.,
McMahon, A. P., Antin, P. B. and Krieg, P. A. (2004).
Hedgehog signaling is essential for endothelial tube formation during
vasculogenesis. Development
131,4371
-4380.
Walmsley, M., Ciau-Uitz, A. and Patient, R. (2002). Adult and embryonic blood and endothelium derive from distinct precursor populations which are differentially programmed by BMP in Xenopus. Development 129,5683 -5695.[CrossRef][Medline]
Wang, Q., Lan, Y., Cho, E. S., Maltby, K. M. and Jiang, R. (2005). Odd-skipped related 1 (Odd 1) is an essential regulator of heart and urogenital development. Dev. Biol. 288,582 -594.[CrossRef][Medline]
Westerfield, M. (1995). The Zebrafish Book. Eugene, OR: University of Oregon Press.
Wingert, R. A., Selleck, R., Yu, J., Song, H. D., Chen, Z., Song, A., Zhou, Y., Thisse, B., Thisse, C., McMahon, A. P. et al. (2007). The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros. PLoS Genet. 3,1922 -1938.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  S.-W. Jin and C. Patterson The Opening Act: Vasculogenesis and the Origins of Circulation Arterioscler. Thromb. Vasc. Biol., May 1, 2009; 29(5): 623 - 629. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
