|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 10, 2008
doi: 10.1242/10.1242/dev.026708


Institute of Molecular Plant Sciences, School of Biology, University of Edinburgh, Rutherford Building, Mayfield Road, Edinburgh EH9 3JH, UK.
Authors for correspondence (e-mails:
justin.goodrich{at}ed.ac.uk;
gwyneth.ingram{at}ed.ac.uk)
Accepted 4 September 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Endosperm, Embryo, Epidermis, Arabidopsis
| INTRODUCTION |
|---|
|
|
|---|
One potentially important role that the endosperm could play in
embryogenesis is in defining the continuous cuticular layer at the boundary
between the developing embryo and the endosperm. This structure is necessary
to prevent organ fusion after germination, and it may also prevent fusion of
the embryo surface with surrounding endosperm tissues during seed development,
thus allowing normal embryo growth. In addition, the presence of a watertight
cuticle surrounding the mature embryo is crucial in protecting it from
desiccation upon germination (reviewed by
Jeffree, 2006
). Although the
production of cuticle is generally considered to be a strictly epidermal
property, a cuticularized cell wall has been reported to surround the
unicellular zygote in Citrus, well before a defined protodermal cell
layer is formed (Bruck and Walker,
1985
). Interestingly, the expression of epidermal markers, such as
the transcription factors ATML1 and PDF2, which are required
for epidermal specification in Arabidopsis, is also detected well
before protoderm formation (Abe et al.,
2003
; Lu et al.,
1996
). Thus, the outer layer of embryonic cells display epidermal
characteristics, including the presence of cuticularized tissue, from an
extremely early stage in embryogenesis.
Several recent publications have supported a role for the endosperm in
embryonic cuticle production and the specification of embryonic epidermal
identity in Arabidopsis. A secreted subtilisin-like serine protease
ABNORMAL LEAF SHAPE1 (ALE1), which is expressed predominantly in the ESR
appears to be required for normal cuticle production in Arabidopsis
embryos (Tanaka et al., 2001
).
Plants that lack ALE1 produce embryos that adhere to the endosperm
during development. Moreover, germinating seedlings are extremely sensitive to
desiccation owing to abnormal cuticle production on their cotyledons. However,
if ale1 seedlings are grown in vitro in high humidity, and then
transferred to soil, they survive and their adult leaves have a normal cuticle
structure, consistent with their cuticle defects being derived from
abnormalities arising during embryogenesis. Mutations in either of two
embryonically expressed genes encoding RLKs, ACR4 or ALE2,
leads to a significant enhancement of the relatively mild ale1 phenotype. In
double mutants, epidermal specification (as judged by the expression of the
epidermal markers such as ATML1) is also partially lost
(Tanaka et al., 2007
;
Watanabe et al., 2004
).
Neither acr4 nor ale2 mutants show a marked seedling
phenotype, although both have cotyledon cuticle abnormalities, and the
synergistic interactions of these genes may indicate that ACR4 and ALE2 are
required to perceive a signal processed by ALE1. Such a function for ALE1
would also be consistent with the known role of several other subtilisin
proteases in processing ligand signals
(Berger and Altmann, 2000
;
Cui et al., 1998
;
Julius et al., 1984
;
Rose et al., 1996
). Two other
embryonically expressed receptor-like kinase encoding genes, GASSHO1
and GASSHO2, also act redundantly to allow normal embryonic cuticle
formation (Tsuwamoto et al.,
2008
), although how these genes interact genetically with
ALE1, ACR4 and ALE2 has yet to be determined.
In this paper, we show that the transcription factor encoded by the ZHOUPI (ZOU) (Chinese for `shrivelled') gene of Arabidopsis is a key player in controlling ESR-expressed genes involved in the development of the embryo surface, including ALE1. The ZOU gene is widely conserved and occurs in plant groups that lack endosperm (gymnosperms) or seeds (Lycophyta). We propose that ZOU plays a pivotal role in the crosstalk between the embryo and surrounding nutritive tissues. In angiosperms, this is necessary to promote both cuticle formation and the separation of embryo from the surrounding tissues, whereas in more primitive plants it may permit invasive growth of embryos into nutritive tissue of the female gametophyte.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The recessive, loss of function zou2-4 alleles were obtained from
the Nottingham Arabidopsis Stock Center. The zou2 allele (Ws
background) arose in the FLAG collection of T-DNA insertions
(Samson et al., 2002
) and
corresponded to FLAG 400A08. The zou-3 allele (Ws background) was
obtained from the University of Wisconsin collection of T DNA insertion lines
(Sussman et al., 2000
) and
corresponded to WiscDsLox465F5. The zou-4 (Col-0 background) allele
was obtained from the Gabi-Kat collection of T-DNA inserts
(Rosso et al., 2003
) and
corresponded to GABI_584D09. The position of the T-DNA inserts was confirmed
by PCR amplification and sequencing of genomic DNA flanking the inserts. The
ale2-1 and ale1-1 mutations were provided by Hirokazu Tanaka
(Tanaka et al., 2001
;
Tanaka et al., 2007
). The
acr4-2 mutation has been described previously
(Gifford et al., 2003
). The
ARF12 and ARF21 reporter lines were provided by Dolf
Weijers. The reporter line N9185 was obtained from the Haseloff collection of
enhancer trap lines
(http://www.plantsci.cam.ac.uk/Haseloff/construction/GAL4Frame.html).
The marker lines pATML1::GFP-ATML1 and pACR4::H2B-YFP have
been described previously (Gifford et al.,
2003
).
To propagate zou mutants, seeds were sterilized and germinated on sterile tissue culture medium comprising 0.5 MS salts (Duchefa), 0.3% sucrose, 1% agar. Seedlings were transferred to soil about 10 days after germination, when first leaves were easily visible.
Protein sequence alignments
Protein sequences similar to ZOU were retrieved using the BLASTP program
(http://www.ncbi.nlm.nih.gov/blast/Blast.cgi)
to search plant genome databases
(http://www.plantgdb.org/).
The Selaginella moellendorffi sequence was retrieved using the
TBLASTN program to query the Selaginella DNA sequence database
(http://selaginella.genomics.purdue.edu/cgi-bin/blast_tmpl_s.cgi).
We used the software NetGene2
(http://www.cbs.dtu.dk/services/NetGene2/)
(Brunak et al., 1991
;
Hebsgaard et al., 1996
) and
comparisons with the ZOU sequence to predict intron/exon boundaries in the
Selaginella sequence. The protein sequence alignments were generated
using the programs T-Coffee and ClusalW2 available at
http://www.ebi.ac.uk/t-coffee/.
Isolation of ZOU gene and transgene construction
Southern analysis showed that zou-1D plants carried a single
pSKI074 T DNA insertion (data not shown). The T DNA contained a selectable
marker (kanamycin resistance) that co-segregated with zou-1D (data
not shown), suggesting that the insertion was the cause of the mutation. The
sequences flanking the pSKI074 T-DNA insertion at zou-1D were
isolated using the plasmid rescue technique described previously
(Weigel et al., 2000
). We
confirmed the predicted intron-exon structure of ZOU by isolating a
cDNA from silique tissue and determining its sequence, which matched that in
databases (Swissprot Accession Number, NM 103864). Total RNA was extracted
using Trizol Reagent (Invitrogen) and RNeasy columns (Qiagen) according to
manufacturer's instructions. First-strand cDNA was prepared from 0.5 µg
total RNA primed with oligo-dT primer using ImProm-II reverse transcription
system (Promega) according to the manufacturer's instructions. The
ZOU cDNA was amplified by PCR using primers ZOU-F
5'-GGCTCTAGATGACTAATGCTCAAG and ZOU-R 5'-CAGGTCGACAACTCAAACCGAAGC.
The resulting product was cloned in the plasmid vector pGEM-T (Promega) to
generate clone pSY3.
To generate the 35S::ZOU construct, the ZOU cDNA was
excised from pSY3 by digestion with XbaI and SalI, and
subcloned into the binary vector pFP101 (generous gift from Francois Parcy)
under control of CaMV 35S promoter to generate clone pSY5. To generate the
ZOU::ZOU-GFP reporter, the Gateway modified primers ZOUGWF
(5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCTGACCATAACAACCTATATCTC) and ZOUWGR
(5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTAGAGATGAAAAATATAACACCAGTTC) were used
to amplify the ZOU genomic region from plant DNA (Col-0 ecotype) by
PCR with the hi-fidelity Phu DNA polymerase (NEB). The PCR product
was cloned into the Gateway entry vector pDONR207 by recombination with BP
enzyme mix (Invitrogen) to create clone pSY13. The clone pSY13 was then
recombined with the Gateway compatible binary vector pMDC111
(Curtis and Grossniklaus,
2003
) to create clone pSY14 encoding an in-frame fusion of GFP to
the C terminus of the ZOU protein. To create the ZOU::H2B-YFP
reporter, a 1.6 kb region upstream of the ZOU ATG codon was amplified
by PCR (as above) using primers ZOUSALIF (5'-GTCGACTGTGGTGGCATAATACGA)
and ZOUSALIR (5'-GTCGACTGCTCATTTTACCCTTTT). The resulting product was
subcloned into the vector pSC-B (Stratagene), excised by digestion with
SalI and cloned into the binary vector pMD4
(Gifford et al., 2003
)
containing the H2B-YFP fusion.
Analysis of gene expression
RT-PCR analysis of gene expression was performed as described previously
(Chanvivattana et al., 2004
)
using the following primers: ZOU ZOUD3F,
5'-GCTGACTATCTGTGGGAATG; ZOUD3R, 5'-AACTCGGATTTACCTGTGCT;
EiF4A EiF4AF, 5'-TTCGCTCTTCTCTTTGCTCTC; and EiF4A-R,
GAACTCATCTTGTCCCTCAAGTA. In situ hybridization analysis was as described
previously (Chanvivattana et al.,
2004
), with the exception that plant tissue was wax embedded using
an automated processor (Leica Tissue Processor TP1050) and embedding centre
(Leica EG 1160). The ZOU probes were made from plasmid pSY3. To make
the ALE1 probe, a region of ALE1 was amplified from silique cDNA
using primers ALE5-2 (5'-TGAAACTAATGACAACATACACTCCC) and ALE3-2
(5'-ACATATCACGATACTTCCAAAAACTGC). The resulting product was subcloned
into pGEM-T vector (Promega). Plasmids were linearized by digestion with
appropriate restriction enzyme, and RNA probes made using T7 or SP6 RNA
polymerase as described previously
(Chanvivattana et al.,
2004
).
For real-time PCR measurements, RNA was extracted from seedlings and siliques using Trizol Reagent (Invitrogen) and RNeasy columns (Qiagen) according to manufacturers instruction's. First-strand cDNA was prepared from 0.5 µg total RNA primed with oligo-dT primer using ImProm-II reverse transcription system (Promega) according to manufacturer's instructions. PCR reactions were performed in triplicate and the products quantified using a Rotor gene RG-3000 real-time PCR machine and associated software (Corbett Research) to assay SYBR green fluorescence. PCR reactions were made using SYBR green Jump-Start mix (Sigma). ZOU was amplified using primers ZOUD3F and ZOUD3R (above). ALE1 was amplified using primers ALE1F (5'-CTTCTCAGGCCAAGAAACTC) and ALE1R (5'-TTTGCCAGACTTGTTGAGGA). AtSUC5 was amplified using primers AtSUC5-F (5'-ATCGAAGAAACTTTACGACCAAGG) and AtSUC5-R (5'-TTAACGCTAAGACTCCACTAACC). Results were normalized using the EiF4A gene primers described above.
|
Genetic analysis
For double mutant construction, zou-4 mutants were crossed as
females to acr4-2, ale1-1 or ale2-1 homozygotes (all alleles
are in Colombia background, ale2-1 mutants are female sterile). In
all cases, zou-4 homozygotes were pre-selected in the resulting F2
generation by only germinating the shrivelled (zou) seeds. To confirm that
these plants were zou-4 homozygotes, we also tested that their F3
progeny was 100% resistant to sulphadiazine antibiotic (the T-DNA allele at
zou-4 confers resistance). The zou4 acr4-1 mutant was
identified from F2 plants whose immature F3 seeds were round (phenotype
maternally determined by acr4-1 mothers). The ale1-1 zou-4
double mutant was identified by a PCR-based genotyping assay using primers
ALE1GenoF (5'-CGTGCTAGAATAGACGAAGG), ALE1GenoR
(5'-CGTGGTGGAGATGGCAG) and ALE1Ds (5'-CCGTTTTGTATATCCCGTTTCCGT).
The ALE1+ allele produced a 388 bp fragment, whereas ale1-1
harbours a Ds transposon insertion and produces a 300 bp fragment
(Tanaka et al., 2001
). Because
ale2 mutants are sterile, we first identified zou-4/zou-4
ale2-1/+ F2 individuals using primers ALE2F
(5'-AGGAACGCTTGATTGGGATG) and ALE2R (5'-GAAGTCAGCAGAGTCTGGTA) (the
ale2-1 mutation introduces a novel XhoI site within the
amplified ALE2 fragment). These plants gave rise to F3 seeds that were
germinated in sterile tissue culture and segregated about one-quarter of
seedlings with severely defective cotyledons. We confirmed that these were
zou-4 ale2-1 double mutants by PCR-based genotyping.
| RESULTS |
|---|
|
|
|---|
The ZOU gene is predicted to encode a transcription factor of the
basic helix-loop-helix (bHLH) class, designated bHLH95 in previous analyses of
the Arabidopsis genome (Heim et
al., 2003
; Toledo-Ortiz et
al., 2003
). Genome database searches revealed that the ZOU protein
is widely conserved in plants (see Fig. S2 in the supplementary material):
homologues were found both in other dicotyledonous species, including grape
(Vitis vinifera) and barrel medic (Medicago truncatula) and
also in more distantly related angiosperms (e.g. rice, a monocot);
furthermore, ZOU homologues were also found outside flowering plants in the
gymnosperms [Sitka spruce (Picea sitchensis)] and club mosses
(Selaginella moellendorffii). Protein sequence alignments showed that
two regions of the ZOU protein were well conserved: the bHLH domain (residues
66-124) and a region of unknown function near the C terminus of the protein
(residues 215-301, see alignment in Fig. S2 in the supplementary material). It
is likely that these proteins are ZOU orthologues as each is more similar to
ZOU than to any other Arabidopsis protein. Using these criteria, no
clear ZOU orthologues were identified in the bryophyte Physcomitrella
patens or in the green alga Chlamydomonas reinhardtii. The
ZOU gene is therefore ancient and is likely to have arisen early in
vascular plant evolution. In addition, the Arabidopsis ZOU protein is
more similar to homologues in other plant species than to any of the other
Arabidopsis bHLH proteins [estimated to be between 132 and 146 in
number (Heim et al., 2003
;
Toledo-Ortiz et al., 2003
)],
suggesting that it is a unique gene in Arabidopsis.
Loss-of-function mutations show that ZOU normally functions during seed development
A previous study of Arabidopsis bHLH genes suggested that
ZOU (there termed bHLH95) expression was specific to flowers and/or
siliques (Heim et al., 2003
).
Quantitative RT-PCR (Fig. 1C)
confirmed and extended this: ZOU was not expressed in whole
seedlings, rosette leaves or unopened flower buds, but was detected at a low
level in opened flowers and more strongly in siliques, suggesting that it
normally functions in siliques or seed development. To determine the
loss-of-function phenotype, we obtained three independent alleles (zou-2,
zou-3 and zou-4) from collections of T-DNA insertion lines
(Fig. 1A). All three alleles
conferred very similar phenotypes, with zou-2 being most severe,
consistent with the location of the T-DNA insertion in the first exon. Plants
heterozygous for zou were normal; however, when self-pollinated about
one quarter of their seeds (see Table
1) were mis-shapen and shrivelled at maturity
(Fig. 2A,B). In zou-2
homozygotes, all seeds were shrivelled, but when they were crossed either as
male or female parent to wild type, the resulting seeds were normal
(Table 1). Together, these
observations indicated that zou-2-4 are recessive loss-of-function
mutations with normal transmission through male and female gametophytes and
that ZOU acts zygotically (rather than maternally) to control seed
development. The seed shrivelling phenotype co-segregated with antibiotic
resistance conferred by the T DNA insertion at zou-2 (data not shown)
and could be complemented by transformation with a genomic ZOU clone
(Fig. 2C;
Table 1), confirming that it
was caused by loss of ZOU function. We renamed the
At1g4977/bHLH95 gene ZHOUPI (Chinese for `shrivelled') in
reference to the seed phenotype.
|
The separation of embryo from endosperm during angiosperm embryogenesis
correlates with breakdown of the endosperm cells surrounding the developing
embryo (Briggs, 1993
). As this
separation does not occur efficiently in zou mutants, we examined
whether the endosperm is more persistent in zou seeds than in wild
type. After imbibition of mature wild-type seeds, the embryo could easily be
separated from the single layer of residual endosperm cells by extrusion. By
contrast, in zou mutant seeds, the embryo and endosperm adhered
strongly. Furthermore, the chalazal pole of the endosperm, which was not
invaded by the embryo, formed a sac-like structure. When the embryo was cut
away, a considerable quantity of abnormal paste-like tissue was extruded from
the endosperm cavity (see Fig. S3 in the supplementary material).
ZOU is needed for normal epidermal development in seedlings
The shrivelled zou seeds were viable and germinated to produce
seedlings that survived when grown in conditions of high humidity, but
desiccated and died when grown in low humidity. This phenotype is commonly
found in mutants with defects in cuticle or epidermis that impair water
retention. We therefore stained whole seedlings with Toluidine Blue, as this
has been shown to provide a rapid test for cuticle and/or epidermal defects
(Tanaka et al., 2004
). Whereas
wild-type plants were unstained, in zou mutants the hypocotyl and the
cotyledons, but not the leaves, stained strongly
(Fig. 3A,B). This suggested
that the defects in zou mutants were restricted to organs that
initiate during embryogenesis (i.e. hypocotyls and cotyledons, but not
leaves), consistent with the seed-specific expression of ZOU
(Fig. 1C;
Fig. 4). Furthermore, when
zou mutants were grown in tissue culture and transferred to soil
after the first leaves had initiated, the mutants recovered and gave rise to
normal plants, again suggesting that ZOU did not affect
post-embryonic organ development.
|
Genetic interactions of ZOU
We combined zou mutations with other mutations implicated in
epidermal development, including acr4, ale1 and ale2 (see
Materials and methods). The zou-4 mutation was epistatic to
ale1-1 in double mutants, suggesting that ZOU and
ALE1 might act in the same pathway (data not shown). The zou-4
acr4-2 seedlings had more severely defective cotyledons than either
single mutant, suggesting that ZOU and ACR4 may be involved
in a common developmental process (Fig.
3H). The zou-4 ale2-1 seedlings also had more severely
defective cotyledons than either single mutant
(Fig. 3I), consistent with
previous observations that ale1 mutations enhance ale2
(Tanaka et al., 2007
).
ZOU is expressed in the ESR of endosperm
To determine where ZOU was expressed, we localized ZOU
mRNA by in situ hybridization to sections of developing seeds. We detected
strong expression in the endosperm in the ESR in seeds containing embryos up
to the torpedo stage, after which expression declined
(Fig. 4A-C). No signal was
detected when sense control probes were hybridized, confirming that the signal
with antisense probes was specific for ZOU
(Fig. 4D). Strikingly, we did
not detect expression either in the embryo itself or in any of the maternal
tissues in the seeds or siliques. The effects of ZOU on the embryonic
epidermis are therefore non cell autonomous. To further characterize
ZOU expression, we made two reporter gene constructs: a gene fusion
in which the entire ZOU genomic region (i.e. upstream promoter and
intragenic sequences) was fused in frame to GFP (ZOU::ZOU-GFP); and a
fusion of the ZOU upstream promoter sequences to a HISTONE 2B-YFP
fusion protein (Boisnard-Lorig et al.,
2001
) (ZOU::H2B-YFP). Both constructs showed similar
expression patterns. The ZOU::ZOU-GFP construct complemented
zou-2 mutants (Fig. 2C
and Table 1), confirming that
the ZOU-GFP protein fusion retained ZOU+ activity and that the
construct was expressed correctly. The ZOU-GFP fusion protein was
nuclear-localized, consistent with the predicted function of ZOU as a
transcription factor, and was expressed in the ESR but not in the embryo
(Fig. 4E). The non
cell-autonomous effects of ZOU on the embryonic epidermis are therefore not
due to the ZOU protein moving from endosperm to embryo. The ZOU-GFP fusion
protein expressed from ZOU::ZOU-GFP was below the limits of detection
by confocal microscopy until the early heart stage, possibly owing to
post-transcriptional regulation. For this reason, we characterized the early
expression of ZOU using the ZOU::H2B-YFP construct.
ZOU was not expressed in the ovule prior to fertilization
(Fig. 4F) but was strongly
expressed in the central cell after fertilization
(Fig. 4G). This is consistent
with Q-PCR data which showed that ZOU expression was undetectable in
unopened flower buds, but was detectable in opened flowers shortly after the
point of fertilization (Fig.
1C). It was expressed uniformly throughout the endosperm during
the early stages of its development when it comprised two to eight nuclei
(Fig. 4H,I), but then became
expressed more strongly at the micropylar pole during the 12-16 nuclei stage
(Fig. 4J) and the 24-28 nuclei
stages (Fig. 4K); it was
largely restricted to the ESR by the 44-48 cell stage
[Fig. 4L, stages as defined
previously (Boisnard-Lorig et al.,
2001
)].
|
Because zou mutant seedlings had epidermal defects, we also introduced reporters for ACR4 and ATML1, which show epidermal-specific expression. Both reporters were expressed normally in zou-4 mutant embryos (Fig. 5G-J), consistent with the fact that protoderm specification appears largely normal in cleared and sectioned zou seeds.
ZOU is not sufficient to activate ALE1
The fact that ZOU is needed for ALE1 expression in seeds
raised the possibility that the curled leaves of zou-1D mutants could
be a result of ALE1 being activated by ZOU ectopically in
leaves. To test this, we analysed ALE1 and ZOU expression in
seedlings by quantitative RT-PCR. Consistent with our RT-PCR results
(Fig. 1B), ZOU
expression was not detectable in wild-type seedlings, whereas in
zou-1D/+ seedlings it was readily detectable at about six times the
level in wild-type siliques. No ALE1 expression was detectable in
wild-type or zou-1D seedlings (see Fig. S5 in the supplementary
material). Therefore, ZOU expression is not sufficient to activate
ALE1 outside of the seed and the effects of ZOU
mis-expression may be unrelated to the normal function of ZOU in
seeds.
|
| DISCUSSION |
|---|
|
|
|---|
The ESR of the angiosperm endosperm is distinct structurally, and also in
terms of gene expression, from the rest of the endosperm
(Berger, 2003
;
Olsen, 2004
). In both cereals
and Arabidopsis, where the first few divisions of the central cell
give rise to a free nuclear syncitium, cellularization is initiated in the
ESR. The ESR endosperm is also densely cytoplasmic and is closely associated
with the developing embryo at early stages. This association is probably key
for provision of nutrients to the young embryo, a supposition that is
supported by the ESR-specific expression of the sucrose transporter AtSUC5,
which is required for normal embryo growth in Arabidopsis
(Baud et al., 2005
). ZOU is the
first transcription factor to be identified with an ESR-specific expression
pattern, raising the possibility that it specifies the identity of the ESR
region of the endosperm. We feel that this is unlikely for three reasons:
first, the early morphology and development of zou endosperm,
including the ESR, is indistinguishable from that of wild type; second, the
expression of some ESR genes, such as AtSUC5, ARF12 and
ARF21, is not affected in zou mutants; finally, the
expression of ZOU does not become wholly restricted to the ESR until
the early heart stage. Therefore, rather than specifying the identity of the
ESR region, it seems more likely that ZOU has more specific roles in endosperm
and or embryo development.
|
In Arabidopsis and many other dicotyledonous plants, the
cellularized endosperm progressively degenerates as it is invaded by the
expanding embryo, so that only a single layer - the aleurone - remains at seed
maturity. By contrast, in mature zou seeds, much more endosperm
persists, including non-aleurone tissues. Therefore, a likely second role of
ZOU is to promote the expression of genes involved in degradation of
endosperm cells around the expanding embryo. The ZOU target
ALE1 encodes a subtilisin-like serine protease that has been proposed
to process ligands involved in epidermal specification/function
(Watanabe et al., 2004
).
However, it is also possible that ALE1 acts instead in the separation
of the developing endosperm from the embryonic epidermis; for example, by
promoting endosperm autolysis.
ZOU is therefore the first transcription factor to be identified that mediates two poorly understood processes in seed development - separation of the embryo from the endosperm and breakdown of the endosperm. Determining the targets of ZOU; for example, by transcriptional profiling of mutant seeds, should help identify the key factors that mediate these processes.
The ancestral role of ZOU
It is striking that ZOU is so widely conserved in plants. Within
angiosperms, it is likely that the role of ZOU in the ESR is
conserved as the rice ZOU homologue also shows seed-specific
expression (Li et al., 2006
).
However, ZOU is also found both in seed plants that lack an endosperm
(e.g. Picea sitchensis, a gymnosperm) and also in more basal vascular
plant groups, such as the club mosses, which lack seeds altogether. A common
feature of all these groups of land plants is that they have a specialized
epidermis with cuticle, and that their embryos enlarge by invading and
digesting surrounding maternal nutritive tissues (see Fig. S6 in the
supplementary material). In gymnosperms, the female gametophyte proliferates
to form a nutrient-rich tissue prior to fertilization, and the growth of the
embryo post-fertilization is invasive (see Fig. S6B in the supplementary
material). Although club mosses such as Selaginella lack a seed, the
embryo is similarly thrust into a nutrient-rich megagametophyte by a suspensor
(see Fig. S6C in the supplementary material). It is therefore possible that
the ancestral role of ZOU is to promote the separation of the embryo
from surrounding gametophytic tissues, and the breakdown of these tissues,
similar to its role in angiosperm endosperm. This would also be consistent
with the current consensus that the endosperm is evolutionarily homologous to
the gymnosperm female gametophyte [see Baroux et al.
(Baroux et al., 2002
) for
recent discussion]. To test this further, it will be necessary to determine
whether ZOU is also expressed in the ESR of the female gametophyte in
these groups.
Note added in proof
While this article was under review, Kondou et al.
(Kondou et al., 2008
)
published on RETARDED GROWTH OF EMBRYO1. The genes ZHOUPI and
RETARDED GROWTH OF EMBRYO1 both correspond to At1g49770.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/21/3501/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, M., Katsumata, H., Komeda, Y. and Takahashi, T.
(2003). Regulation of shoot epidermal cell differentiation by a
pair of homeodomain proteins in Arabidopsis.
Development. 130,635
-643.
Baroux, C., Spillane, C. and Grossniklaus, U.
(2002). Evolutionary origins of the endosperm in flowering
plants. Genome Biol. 3,
reviews 1026.
Baud, S., Wuilleme, S., Lemoine, R., Kronenberger, J., Caboche,
M., Lepiniec, L. and Rochat, C. (2005). The AtSUC5 sucrose
transporter specifically expressed in the endosperm is involved in early seed
development in Arabidopsis. Plant J.
43,824
-836.[CrossRef][Medline]
Berger, F. (2003). Endosperm: the crossroad of
seed development. Curr. Opin. Plant Biol.
6, 42-50.[CrossRef][Medline]
Berger, D. and Altmann, T. (2000). A
subtilisin-like serine protease involved in the regulation of stomatal density
and distribution in Arabidopsis thaliana. Genes Dev.
14,1119
-1131.
Berger, F., Grini, P. E. and Schnittger, A.
(2006). Endosperm: an integrator of seed growth and development.
Curr. Opin. Plant Biol.
9, 664-670.[CrossRef][Medline]
Boisnard-Lorig, C., Colon-Carmona, A., Bauch, M., Hodge, S.,
Doerner, P., Bancharel, E., Dumas, C., Haseloff, J. and Berger, F.
(2001). Dynamic analyses of the expression of the HISTONE::YFP
fusion protein in arabidopsis show that syncytial endosperm is divided in
mitotic domains. Plant Cell
13,495
-509.
Briggs, C. L. (1993). Endosperm development in
Solanum nigrum L. Formation of the zone of separation and secretion.
Ann. Bot. 72,303
-313.
Bruck, D. K. and Walker, D. B. (1985). Cell
determination during embryogenesis in Citrus jambhiri. I. Ontogeny of the
epidermis. Botanical Gazette
146,188
-195.
Brunak, S., Engelbrecht, J. and Knudsen, S.
(1991). Prediction of human mRNA donor and acceptor sites from
the DNA sequence. J. Mol. Biol.
220, 49-65.[CrossRef][Medline]
Chanvivattana, Y., Bishopp, A., Schubert, D., Stock, C., Moon,
Y. H., Sung, Z. R. and Goodrich, J. (2004). Interaction of
Polycomb-group proteins controlling flowering in Arabidopsis.
Development. 131,5263
-5276.
Cui, Y., Jean, F., Thomas, G. and Christian, J. L.
(1998). BMP-4 is proteolytically activated by furin and/or PC6
during vertebrate embryonic development. EMBO J.
17,4735
-4743.[CrossRef][Medline]
Curtis, M. D. and Grossniklaus, U. (2003). A
gateway cloning vector set for high-throughput functional analysis of genes in
planta. Plant Physiol.
133,462
-469.
Gifford, M. L., Dean, S. and Ingram, G. C.
(2003). The Arabidopsis ACR4 gene plays a role in cell layer
organisation during ovule integument and sepal margin development.
Development 130,4249
-4258.
Hebsgaard, S. M., Korning, P. G., Tolstrup, N., Engelbrecht, J.,
Rouze, P. and Brunak, S. (1996). Splice site prediction in
Arabidopsis thaliana pre-mRNA by combining local and global sequence
information. Nucleic Acids Res.
24,3439
-3452.
Heim, M. A., Jakoby, M., Werber, M., Martin, C., Weisshaar, B.
and Bailey, P. C. (2003). The basic helix-loop-helix
transcription factor family in plants: a genome-wide study of protein
structure and functional diversity. Mol. Biol. Evol.
20,735
-747.
Ingouff, M., Haseloff, J. and Berger, F.
(2005). Polycomb group genes control developmental timing of
endosperm. Plant J. 42,663
-674.[CrossRef][Medline]
Jeffree, C. E. (2006). The fine structure of
the plant cuticle. In The Biology of Plant Cuticle
(ed. Riederer, M. and Muller, C.), pp. 11-125.
Oxford, UK: Blackwell.
Julius, D., Brake, A., Blair, L., Kunisawa, R. and Thorner,
J. (1984). Isolation of the putative structural gene for the
lysine-arginine-cleaving endopeptidase required for processing of yeast
prepro-alpha-factor. Cell
37,1075
-1089.[CrossRef][Medline]
Kondou, Y., Nakazawa, M., Kawashima, M., Ichikawa, T.,
Yoshizumi, T., Suzuki, K., Ishikawa, A., Koshi, T., Matsui, R., Muto, S. and
Matsui, M. (2008). RETARDED GROWTH OF EMBRYO1, a new basic
helix-loop-helix protein, expresses in endosperm to control embryo growth.
Plant Physiol. 147,1924
-1935.
Li, X., Duan, X., Jiang, H., Sun, Y., Tang, Y., Yuan, Z., Guo,
J., Liang, W., Chen, L., Yin, J. et al. (2006). Genome-wide
analysis of basic/helix-loop-helix transcription factor family in rice and
Arabidopsis. Plant Physiol.
141,1167
-1184.
Lu, P., Porat, R., Nadeau, J. A. and O'Neill, S. D.
(1996). Identification of a meristem L1 layer-specific gene in
Arabidopsis that is expressed during embryonic pattern formation and defines a
new class of homeobox genes. Plant Cell
8,2155
-2168.[Abstract]
Magnard, J. L., Le Deunff, E., Domenech, J., Rogowsky, P. M.,
Testillano, P. S., Rougier, M., Risueno, M. C., Vergne, P. and Dumas, C.
(2000). Genes normally expressed in the endosperm are expressed
at early stages of microspore embryogenesis in maize. Plant Mol.
Biol. 44,559
-574.[CrossRef][Medline]
Massonneau, A., Coronado, M. J., Audran, A., Bagniewska, A.,
Mol, R., Testillano, P. S., Goralski, G., Dumas, C., Risueno, M. C. and
Matthys-Rochon, E. (2005). Multicellular structures
developing during maize microspore culture express endosperm and
embryo-specific genes and show different embryogenic potentialities.
Eur. J. Cell Biol. 84,663
-675.[CrossRef][Medline]
Nowack, M. K., Grini, P. E., Jakoby, M. J., Lafos, M., Koncz, C.
and Schnittger, A. (2006). A positive signal from the
fertilization of the egg cell sets off endosperm proliferation in angiosperm
embryogenesis. Nat. Genet.
38, 63-67.[Medline]
Olsen, O. A. (2004). Nuclear endosperm
development in cereals and Arabidopsis thaliana. Plant
Cell 16,S214
-S227.
Opsahl-Ferstad, H. G., Le Deunff, E., Dumas, C. and Rogowsky, P.
M. (1997). ZmEsr, a novel endosperm-specific gene expressed
in a restricted region around the maize embryo. Plant
J. 12,235
-246.[CrossRef][Medline]
Rose, C., Vargas, F., Facchinetti, P., Bourgeat, P., Bambal, R.
B., Bishop, P. B., Chan, S. M., Moore, A. N., Ganellin, C. R. and Schwartz, J.
C. (1996). Characterization and inhibition of a
cholecystokinin-inactivating serine peptidase. Nature
380,403
-409.[CrossRef][Medline]
Rosso, M. G., Li, Y., Strizhov, N., Reiss, B., Dekker, K. and
Weisshaar, B. (2003). An Arabidopsis thaliana T-DNA
mutagenized population (GABI-Kat) for flanking sequence tag-based reverse
genetics. Plant Mol. Biol.
53,247
-259.[CrossRef][Medline]
Samson, F., Brunaud, V., Balzergue, S., Dubreucq, B., Lepiniec,
L., Pelletier, G., Caboche, M. and Lecharny, A. (2002).
FLAGdb/FST: a database of mapped flanking insertion sites (FSTs) of
Arabidopsis thaliana T-DNA transformants. Nucleic Acids
Res. 30,94
-97.
Schubert, D., Primavesi, L., Bishopp, A., Roberts, G., Doonan,
J., Jenuwein, T. and Goodrich, J. (2006). Silencing by plant
Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine
27. EMBO J. 25,4638
-4649.[CrossRef][Medline]
Sharma, V. K., Ramirez, J. and Fletcher, J. C.
(2003). The Arabidopsis CLV3-like (CLE) genes are expressed in
diverse tissues and encode secreted proteins. Plant Mol.
Biol. 51,415
-425.[CrossRef][Medline]
Sussman, M. R., Amasino, R. M., Young, J. C., Krysan, P. J. and
Austin-Phillips, S. (2000). The Arabidopsis knockout facility
at the University of Wisconsin-Madison. Plant Physiol.
124,1465
-1467.
Tanaka, H., Onouchi, H., Kondo, M., Hara-Nishimura, I.,
Nishimura, M., Machida, C. and Machida, Y. (2001). A
subtilisin-like serine protease is required for epidermal surface formation in
Arabidopsis embryos and juvenile plants. Development
128,4681
-4689.
Tanaka, T., Tanaka, H., Machida, C., Watanabe, M. and Machida,
Y. (2004). A new method for rapid visualization of defects in
leaf cuticle reveals five intrinsic patterns of surface defects in
Arabidopsis. Plant J.
37,139
-146.[CrossRef][Medline]
Tanaka, H., Watanabe, M., Sasabe, M., Hiroe, T., Tanaka, T.,
Tsukaya, H., Ikezaki, M., Machida, C. and Machida, Y. (2007).
Novel receptor-like kinase ALE2 controls shoot development by specifying
epidermis in Arabidopsis. Development
134,1643
-1652.
Toledo-Ortiz, G., Huq, E. and Quail, P. H.
(2003). The Arabidopsis basic/helix-loop-helix transcription
factor family. Plant Cell
15,1749
-1770.
Tsuwamoto, R., Fukuoka, H. and Takahata, Y.
(2008). GASSHO1 and GASSHO2 encoding a putative leucine-rich
repeat transmembrane-type receptor kinase are essential for the normal
development of the epidermal surface in Arabidopsis embryos. Plant
J. 54,30
-42.[CrossRef][Medline]
van Hengel, A. J., Guzzo, F., van Kammen, A. and de Vries, S.
C. (1998). Expression pattern of the carrot EP3 endochitinase
genes in suspension cultures and in developing seeds. Plant
Physiol. 117,43
-53.
Watanabe, M., Tanaka, H., Watanabe, D., Machida, C. and Machida,
Y. (2004). The ACR4 receptor-like kinase is required for
surface formation of epidermis-related tissues in Arabidopsis thaliana.
Plant J. 39,298
-308.[CrossRef][Medline]
Weigel, D., Ahn, J. H., Blazquez, M. A., Borevitz, J. O.,
Christensen, S. K., Fankhauser, C., Ferrandiz, C., Kardailsky, I.,
Malancharuvil, E. J., Neff, M. M. et al. (2000). Activation
tagging in Arabidopsis. Plant Physiol.
122,1003
-1013.
Wiweger, M., Farbos, I., Ingouff, M., Lagercrantz, U. and von
Arnold, S. (2003). Expression of Chia4-Pa chitinase genes
during somatic and zygotic embryo development in Norway spruce (Picea
sitchensis): similarities and differences between gymnosperm and angiosperm
class IV chitinases. J. Exp. Bot.
54,2691
-2699.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||