|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 10, 2008
doi: 10.1242/10.1242/dev.022350
1 Division of Cardiovascular Medicine, Department of Medicine, Stanford
University, Stanford, CA 94305, USA.
2 Department of Pathology, Stanford University, Stanford, CA 94305, USA.
Authors for correspondence (e-mails:
chingpin{at}stanford.edu;
mcleary{at}stanford.edu)
Accepted 8 September 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Pbx, Hox, Pax3, Msx2, Heart development, Vascular patterning, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
), which occur in at least 1% of live births and lead to
significant morbidity and mortality. The high incidence of anomalies in part
reflects the fact that cardiac OFT formation is a complex developmental
process that requires several elaborate morphogenetic steps, including the
division of a common arterial trunk, alignment of the divided arteries to
their respective cardiac chambers, and the formation of valves for each
arterial channel (Harvey and Rosenthal,
1999). Development of the great arteries that supply the head,
neck and upper limbs is also a challenging task for developing embryos. This
process involves extensive vascular remodeling of five pairs of primitive
branchial arch arteries to form a distinctive arterial network. Perturbations
of branchial arch artery patterning in humans result in a variety of vascular
anomalies that often require surgical correction.
Development of the cardiac OFT and branchial arch arteries requires a
specific subpopulation of neural crest cells (NCCs), the cardiac NCCs, which
originate from rhombomeres 6, 7 and 8 in the hindbrain and migrate to the
branchial arches and heart to regulate patterning of the branchial arch
arteries and septation of the OFT, respectively
(Kirby et al., 1983). Ablation
of cardiac NCCs in the chick leads to characteristic cardiac and vascular
anomalies, including persistent truncus arteriosus (PTA) and aberrant
branchial artery patterning. Loss-of-function genetic experiments in mice have
provided several models that recapitulate all or part of the NCC ablation
phenotype in chick (reviewed by Kirby,
2007). Among a variety of signaling and transcriptional
regulators, these studies have demonstrated crucial roles for several
homeodomain transcription factors. Mice deficient for Hoxa3 have
defects in branchial arch arteries consistent with a NCC defect
(Chisaka and Capecchi, 1991;
Chisaka and Kameda, 2005;
Kameda et al., 2003).
Similarly, disrupted Hox expression in chick embryos is associated with
abnormal patterning of the great arteries, but not with cardiac OFT defects
(Kirby et al., 1997). With the
exception of Hoxa3, however, single Hox gene deficiencies in mice
have not been found to affect cardiovascular development, possibly reflecting
redundancy in their contributions. Conversely, mutation of the Pax3
gene, which encodes a paired-homeodomain transcription factor, results in
abnormal patterning of the branchial arch arteries and cardiac OFT
(Conway et al., 1997;
Epstein, 1996). Msx2,
a homeodomain transcription factor, is an obligate repressed target of Pax3 in
heart development (Kwang et al.,
2002) as loss-of-function of Msx2 rescues the cardiac
defects of Splotch (Pax3 mutant) mice.
Pbx1 is a TALE-class homeodomain transcription factor that forms
heterodimeric complexes with a subset of Hox homeodomain proteins that are
essential for regulating segmental identities during development
(Chang et al., 1996;
Chang et al., 1995;
Knoepfler and Kamps, 1995;
Peltenburg and Murre, 1996;
Phelan et al., 1995).
Interactions with Pbx1 confer a significant increase in the otherwise modest
DNA-binding specificities and affinities of Hox proteins in vitro
(Chang et al., 1996), and Pbx1
deficiency compromises Hox (Selleri et
al., 2001) and para-Hox (Kim
et al., 2002) protein functions in vivo. Pbx1 also partners with
Meis/Prep proteins, members of the TALE class of homeodomain transcription
factors (Abu-Shaar et al.,
1999; Chang et al.,
1997), which facilitate the formation of trimeric transcriptional
complexes with Hox proteins (Jacobs et
al., 1999). Consistent with the roles of Hox genes in specifying
rhombomere identities, both Pbx and Meis orthologs regulate hindbrain
development in zebrafish (Choe et al.,
2002; Waskiewicz et al.,
2001; Waskiewicz et al.,
2002). However, as the cardiac OFT in zebrafish does not normally
divide into separate circulations, these previous studies did not address
whether Pbx1 is required for the contribution of rhombomere-derived cardiac
NCCs to OFT septation or branchial arch artery patterning.
|
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Li et al.,
2000; Selleri et al.,
2001). Pbx1+/- mice were maintained in a
C57BL/6 background. Phenotypes of Pbx1-null mice were typically
analyzed in embryos (E10.5-15.5) resulting from intercrossed parental mice
that had been backcrossed to the C57BL/6 strain background for at least eight
generations. Gestational age was determined by the date of observing a vaginal
plug [set at embryonic day (E) 0.5], as confirmed by ultrasonography
(Chang et al., 2003).
Angiography and vascular casting
Chest walls of mouse embryos were opened under microscopic visualization. A
33-gauge needle (Hamilton) mounted on a 1 ml tuberculin syringe was used to
inject an acrylic resin (Batson no. 17) containing blue dye (Methyl
Methacrylate Casting Kit, Polyscience) into the right ventricle. The dynamic
flow of the blue dye filling the right ventricle, main pulmonary artery,
ductus arteriosus, aortic arch and ascending aorta was carefully observed.
Following angiography, embryos were held at 4°C for 2-6 hours to allow the
resin to polymerize and cast the vasculature. Soft tissues of the embryos were
subsequently dissolved in potassium hydroxide (Maceration Solution,
Polysciences) at 55°C for 1-3 hours to expose the vascular casts, which
were then cleaned and photographed under a dissecting microscope. For India
ink-based angiography, embryos were harvested at E10.5 or E11.5 and fixed
overnight in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS).
India ink (undiluted, water-insoluble form) was injected into the ventricles
using a fine glass micropipette while the embryos rested in PBS. For E11.5
embryos, the branchial arches and surrounding tissues were carefully dissected
to expose the branchial arch arteries prior to imaging.
Histology
Paraffin sections of mouse embryos were prepared as described previously
(Stankunas et al., 2008a).
Consecutive sections of 5-7 µm through the chest cavity were collected and
stained with Hematoxylin and Eosin.
RNA in situ hybridization and β-galactosidase staining
These procedures were performed as described previously
(Stankunas et al., 2008a). The
plexin A2, Pax3 and Msx2 antisense probes were as described
previously (Brown et al., 2001;
Kwang et al., 2002).
Immunostaining
Fluorescent immunostaining and immunohistochemistry on paraffin tissue
sections (7 µm) were performed as previously described
(Chang et al., 2004). The
anti-Pbx1b monoclonal antibody (clone 41.1)
(Chang et al., 1997) and
anti-Pax3 monoclonal antibody (concentrate, Developmental Studies Hybridoma
Bank) were used at 1:300 and 1:500 dilution, respectively, for
immunostaining.
Electrophoretic mobility shift assay (EMSA)
EMSA was performed as described previously
(Chang et al., 1995;
Wu et al., 2007). Proteins
(Pbx1a, Pbx2, Pbx3, Meis1, HoxB2, HoxB4 and HoxB7) were prepared using a TnT
Quick Coupled Transcription/Translation System (Promega) following the
manufacturer's instructions. Oligonucleotides probes corresponding to
sequences from the Pax3 promoter were (5' to 3'): Site A,
CTCTACATCAAAACTGTCAAAGGCTCT; Site B, CTCTCCTTTTGATTGATTAAGCTCT.
Luciferase reporter assays
The 1.6 kb promoter region of the Pax3 gene was amplified from
mouse genomic DNA and cloned into the pGL3-basic vector (Promega). Expression
plasmids for Pbx1b, Meis1 and HoxB4 were described previously
(Chang et al., 1997;
Chang et al., 1995). PC12 cells
were co-transfected with expression plasmids, a Pax3 luciferase
reporter construct and a constitutively expressing Renilla luciferase
construct for normalization of transfection efficiency using Fugene 6
Transfection Reagent (Roche). Luciferase activities were analyzed using a Dual
Luciferase Reporter Assay System (Promega). Fold activation was calculated
relative to reporter baseline activities, and data presented as mean ±
one s.d. P-values were determined using Student's
t-test.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
The PTA in Pbx1-/- embryos displayed dual features of the aorta and main pulmonary artery in that it gave rise to coronary, pulmonary and systemic arteries. The right and left coronary arteries arose anteriorly, whereas a short stump of the main pulmonary artery arose posteriorly from the truncus (Fig. 1C). This short main pulmonary artery divided into the right and left pulmonary arteries (Fig. 1C), which were of similar size to wild-type pulmonary arteries (Fig. 1, compare A with C). After the coronary and pulmonary artery branching points, the truncus continued as the ascending aorta and generally arched to the left to form the descending aorta (Fig. 1B). These data demonstrate a requirement for Pbx1 in septation of the cardiac OFT.
|
The great arteries, which supply the head, neck and upper limbs, were aberrantly patterned in Pbx1-/- embryos (n=17). The left common carotid artery (CCA), which normally arises from the aortic arch, and the right CCA, which branches off the brachiocephalic artery (BCA), were generally absent in Pbx1-/- embryos (Fig. 2C,D). In the absence of the CCA, the external carotid artery (ECA) and internal carotid artery (ICA) arose directly from the aortic arch (Fig. 2D). Occasionally, a residual stump of CCA was present, connecting the ECA and ICA to the aortic arch (Fig. 2D and data not shown). The identity of the ECA was confirmed by its branching into facial and superficial temporal arteries (not shown); the ICA identity by its continued course into the cranium. The right subclavian artery (RSA), which normally arises from the BCA (Fig. 2C), originated instead from the descending aorta distal to the origin of the left subclavian artery (LSA) in Pbx1-/- embryos (Fig. 2E). The LSA, instead of arising from the aortic arch, arose from the descending aorta in Pbx1-/- embryos (Fig. 2C,E). The identities of the RSA and LSA were confirmed by their branching into internal vertebral (IVA), internal mammary (IMA) and axillary arteries (AA) (Fig. 2E), and by their destination in the right and left forelimbs, respectively.
Pbx1 is required for caudal branchial arch development
To examine whether the abnormal great-artery patterning seen at E14.5 in
Pbx1-/- embryos reflected aberrant remodeling or a failure
to establish the initial complement of branchial arches, India ink injections
were used to mark the arterial systems of E10.5 and E11.5 embryos, prior to
branchial arch artery regression. Instead of possessing three branchial arch
arteries on each side (Fig.
2G), Pbx1-/- embryos (n=5) had only
one or two patent branchial arch arteries (on both left and right sides)
(Fig. 2H). When two arch
arteries were present, the caudal-most artery was always narrow. The anatomic
position of the aortic arches relative to the branchial arches was consistent
with a failure to establish the sixth, and frequently the fourth, branchial
arch arteries.
The arch arteries are derived from mesodermal cells of the branchial
arches, and Pbx1-/- embryos have abnormalities in the
development of the pharyngeal pouches of the caudal branchial arches
(Manley et al., 2004). We
therefore examined whether the branchial arches formed normally in the absence
of Pbx1 by using Msx2 whole-mount in situ hybridization to
mark mesenchymal cells of the arches
(MacKenzie et al., 1992). At
E10.5, the pharyngeal groove separating arch 3 and 4 was absent in
Pbx1-/- embryos (Fig.
2, J versus I), and the fourth branchial arch was smaller than
normal and showed reduced Msx2 staining. Therefore, the great-artery
patterning defects in Pbx1-/- embryos are at least in part
due to a failure to develop a full set of branchial arches, which might also
underlie the absence or reduction of organs derived from the caudal pharyngeal
region (Manley et al.,
2004).
|
),
suggesting a possible role in these processes. Alternatively, the OFT defects
could represent a failure of secondary heart field (SHF)-derived cells to
populate the OFT or aberrations in endocardial cushion development. The
presence of Pbx1b, the major isoform of Pbx1 during development
(Schnabel et al., 2001), was
examined by immunostaining in each of these relevant tissues. At E8.75, Pbx1b
was present in all cells of the hindbrain, including the premigratory NCCs at
the extreme dorsal tip of the neural tube (the neuroectodermal junction)
(Fig. 3A). By E9.5, Pbx1b was
found in many, but not all, cells of the neural tube, including the
premigratory NCCs. Pbx1b was also detected in many paraxial mesoderm cells
flanking the neural tube at both E8.75 and E9.5
(Fig. 3A,B). In the septating
OFT at E11.0, Pbx1b was abundant in vascular smooth muscle cells
(Fig. 3C). Pbx1b was also
present throughout the mesenchyme of the endocardial cushion, most likely in
cells derived from both endocardial cells (by an epithelial-to-mesenchymal
transformation) and NCCs (Fig.
3C). Whereas Pbx1b was decreased in cardiomyocytes of the OFT, it
remained present at low levels in cushion endocardial cells
(Fig. 3C). An
immunofluorescence based-staining method for Pbx1b demonstrated its broad, but
not ubiquitous, presence in E9.5 embryos
(Fig. 3D-F). A higher
magnification view of the region encompassing the E9.5 aortic sac and OFT
revealed abundant Pbx1b in SHF cells entering the OFT and in the ectoderm,
with lower Pbx1b levels in endocardial cells
(Fig. 3G). Pbx1b was also found
in many, but not all, endoderm-derived cells of the pharyngeal pouches and in
mesenchymal cells throughout the embryo, including in the branchial arches
(Fig. 3H). Pbx1b was present
only in the endocardium (at low levels), among cells of the atria and left
ventricle (Fig. 3I). Our
staining results are consistent with other studies
(Manley et al., 2004;
Schnabel et al., 2001;
Selleri et al., 2001;
Stankunas et al., 2008b) and
indicate many possible sites of action for Pbx1b in branchial arch artery and
OFT development, including cardiac NCCs.
Pbx1 is not required for migration of cardiac NCCs into the outflow tract
NCC migration was assessed by whole-mount RNA in situ hybridization with a
plexin A2 probe that stains post-migratory NCCs
(Brown et al., 2001). In
Pbx1-/- embryos, plexin A2 staining highlighted two
streams of NCCs migrating into the cardiac OFT, as seen in wild-type embryos
(Fig. 4A,B). The absence of a
generalized NCC migration defect in Pbx1-/- embryos was
confirmed by plexin A2 staining of the dorsal root ganglia and sympathetic
chains (Fig. 4C,D). Cell fate
mapping, using Wnt1 promoter-driven Cre activity and the
Rosa26RlacZ line to mark NCCs and their derivatives
(Jiang et al., 2000), showed
that NCCs migrated into the cardiac OFT of both wild-type and
Pbx1-null embryos (Fig.
4E,F). Thus, although Pbx1 is normally present in cardiac NCCs and
their derivatives, its absence does not detectably affect their migration and
appropriate localization to the cardiac OFT.
Pbx1 is required for Pax3 promoter activity in rhombomeres where cardiac NCCs originate
To further assess the impact of Pbx1 deficiency on NCCs, fate
mapping studies were performed using Pax3Cre transgenic mice, which
express Cre under the control of the Pax3 1.6 kb proximal promoter
(Li et al., 2000). Like
Wnt1Cre, Pax3Cre targets Cre activity to cardiac NCCs at their
rhombomeric origins, prior to delamination from the neural tube
(Li et al., 2000). In marked
contrast to wild-type embryos, Pax3 promoter-driven Cre activity was
not detected in the cardiac OFT of Pbx1-/- embryos at
E12.5 (Fig. 4G,H), even though
cardiac NCCs successfully migrated into the OFT
(Fig. 4B,F). To determine
whether the absence of Pax3Cre-marked cells in the cardiac OFT
results from inactivity of the Pax3 promoter in premigratory cardiac
NCCs, we examined the expression of β-galactosidase (lacZ) in
the rhombomeres of E10.5
Pax3Cre;R26RlacZ;Pbx1-/- mice. In
Pbx1+/+ embryos, Pax3Cre drove lacZ
expression in rhombomere (R) 2, 4 and 6, and in the streams of NCCs migrating
from these regions (Fig. 4K).
By contrast, Pax3Cre activity in Pbx1-/- embryos
was selectively absent from R6 (Fig.
4L). Conversely, similar studies using the
Wnt1Cre;R26RlacZ combination showed that Wnt1
promoter activity was maintained in cardiac NCCs from R6, R7 and R8 in
Pbx1-/- embryos (Fig.
4I,J). The absence of Pax3Cre and preservation of
Wnt1Cre activity at the dorsal end of R6 was confirmed by histology
of consecutive transverse sections in which R6 was marked by the caudal end of
the otic vesicle (Fig. 4M-P).
The difference between Wnt1Cre and Pax3Cre promoter activity
in Pbx1-/- embryos does not reflect earlier activity of
the Pax3 promoter because, if any difference is present,
Wnt1Cre activity initiated prior to that of Pax3Cre (see
Fig. S1 in the supplementary material). Similarly, the Wnt1Cre domain
in R6 through R8 appeared to entirely overlap with the missing R6 expression
normally driven by the Pax3 promoter. Therefore, the absence of
Pax3Cre-marked cells in the OFT of Pbx1-/-
embryos is not due to the loss of a subpopulation of Pax3-positive
Wnt1-negative cardiac NCCs, but rather suggests a failure to activate
the Pax3 promoter in premigratory cardiac NCCs.
|
). However, using whole-mount in situ hybridization
for Pax3 transcripts, we found no clear change in Pax3 in
the neural tube of E9.5 Pbx1-/- embryos
(Fig. 5A). This surprising
result led us to examine the presence of Pax3 in more detail using
immunostaining of paraffin sections of wild-type and Pbx1-null
embryos. In an 18-somite wild-type embryo (equivalent to E8.75), Pax3 appeared
in a broad dorsal pattern that was overlaid with considerably more abundant
Pax3 in a subset of cells at the extreme dorsal end of the neural tube of R6
(Fig. 5B). Interestingly, this
cluster of cells that strongly expresses Pax3, which corresponds to
the premigratory neural crest, was absent in a littermate
Pbx1-/- embryo (Fig.
5C). However, Pax3 was still found in migrating NCCs in the
absence of Pbx1 (Fig.
5C). We examined the presence of Pax3 in the dorsal neural tube of
the hindbrain from E8.0 through E9.5. Pax3 was detected in a broad dorsal band
in the neural tube of a zero-somite (E8.0) embryo
(Fig. 5D), a pattern that was
retained throughout the developmental stages examined
(Fig. 5E-G). By contrast, the
robust Pbx1-dependent presence of Pax3 in premigratory NCCs was found
only transiently, between E8.5 and E9.0
(Fig. 5B,E,F). At E9.5, Pax3
was retained in a broad band of cells of the R6 dorsal neural tube, whereas
the premigratory NCCs had relatively low levels of Pax3 protein
(Fig. 5G). Taken together,
these results show that Pbx1 is required specifically for a transient
burst of Pax3 expression in premigratory NCCs of R6 prior to their
delamination from the neural tube.
|
|
) (Fig.
6A). Electrophoretic mobility shift assays (EMSA)
(Chang et al., 2004;
Chang et al., 1995) confirmed
that Site A, which contains a consensus Pbx1/Meis1 binding sequence
(5'-TGACAGTT-3') (Chang et al.,
1997), supported robust cooperative binding by Pbx1 and Meis1, but
not binding by either protein alone (Fig.
6B). By contrast, Pbx1 did not form binding complexes with several
representative Hox proteins (HoxB2, HoxB4 or HoxB7) on Site A
(Fig. 6B and data not shown).
Site B, which is located 1.1 kb upstream of the Pax3 transcriptional
start site, was bound robustly by HoxB4 or Meis1 in the presence of Pbx1
(Fig. 6C). DNA binding by HoxB2
and HoxB7 on Site B was also dependent on Pbx1 (data not shown).
Pbx1-Meis1-Hox trimeric complexes did not form on either isolated Site A or
Site B (Fig. 6B,C). The
requirement for Pbx1 in regulating Pax3 promoter activity was
assessed using a reporter gene containing the 1.6 kb Pax3 promoter
fragment (Li et al., 2000) in
PC12 pheochromocytoma cells, which are derivatives of NCCs
(Greene and Tischler, 1976).
Whereas HoxB4 alone produced a modest increase in Pax3 promoter
activity, co-transfection of Pbx1 and HoxB4 strongly activated transcription
(Fig. 6D). Consistent with the
binding studies, adding Meis1 to the transfection mixture did not further
enhance the Pax3 transcriptional response
(Fig. 6D). Thus, Pbx1 partners
with Meis and Hox proteins to directly activate expression of Pax3
through its proximal promoter elements. Taken together, our results show that
Pbx1 is essential for Pax3 proximal promoter activity and for
transient premigratory cardiac NCC expression of Pax3. We propose that
activity of the Pax3 1.6 kb proximal promoter in vivo partially
reflects Pbx1-dependent Pax3 expression in premigratory cardiac NCCs.
The broader and sustained dorsal neural tube expression of Pax3 is
likely to require additional regulatory elements outside the 1.6 kb region
that are not under Pbx1 control.
Pax3 misexpression contributes to outflow tract defects in Pbx1-/- embryos
Cardiac OFT defects in Pax3 mutant embryos arise from derepression
of its downstream target gene Msx2, as demonstrated by rescue of the
PTA in Pax3-/-;Msx2-/- embryos
(Kwang et al., 2002). Since
Msx2 is repressed by Pax3, the activation of which requires Pbx1, we
examined Pbx1-/- embryos for misexpression of
Msx2. By whole-mount RNA in situ hybridization, Msx2
transcripts were detected in the neural tube of E9.5 wild-type embryos
(Kwang et al., 2002), with
high levels in R5 and lower levels in the cardiac NCC-originating R6-R8
(Fig. 6E). By contrast,
considerably higher levels of Msx2 transcripts were detected in R6
through R8 of littermate Pbx1-/- embryos
(Fig. 6F). RNA in situ
hybridization of tissue sections at the R6 level confirmed enhanced expression
of Msx2 transcripts in the dorsal neural tube in
Pbx1-/- embryos (Fig.
6G,H). These results, which mirror those reported in
Pax3-/- embryos, suggest that decreased Pax3
expression in Pbx1-/- embryos results in derepression of
Msx2, which then causes the observed OFT septation defects.
|
The potential recovery of NCC contributions to OFT septation in
Pbx1-/- embryos lacking Msx2 was assessed by
examining consecutive histologic sections through the cardiac OFT. This
revealed significant rescue of septation of the distal (truncal) portion of
the OFT in Pbx1-/-;Msx2+/- embryos
(Fig. 7H,K) (4/6 embryos; mean
length of septation, 75.8 µm) and
Pbx1-/-;Msx2-/- embryos (data not shown) (3/4;
mean, 47.5 µm), as compared with littermate Pbx1-/-
embryos (0/3; mean, 6.7 µm) (P<0.015). Since rescue did not
extend to the proximal (conal) region of the OFT
(Fig. 7I,J,L,M), these
Pbx1-/-;Msx2+/- embryos had a milder form of
PTA, arising from the right ventricle with an associated ventricular septal
defect. By comparison, Msx2-/- embryos had no defects in
OFT septation (Fig. 7E-G).
Septation of the distal truncal region of the OFT is provided by the
NCC-derived aorticopulmonary septal complex
(Hutson and Kirby, 2007).
Thus, Pbx1-/- embryos deficient for one or both
Msx2 alleles had significant recovery of NCC function, with septation
of the truncal, but not conal, region. These results demonstrate that
dysfunction of the Pax3-Msx2 transcriptional hierarchy contributes to
septation defects in Pbx1-/- embryos, although it does not
entirely account for the role of Pbx1, suggesting that Pbx1 impacts additional
pathways to regulate cardiac NCCs or other tissues contributing to OFT
development.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; DiMartino et al.,
2001; Manley et al.,
2004; Schnabel et al.,
2003a; Schnabel et al.,
2003b; Zhang et al.,
2006). However, the specific subordinate pathways that mediate its
developmental contributions have not been extensively characterized. Our
current studies extend the roles of Pbx1 to major morphogenetic events
underlying the patterning of branchial arch arteries and formation of the
cardiac OFT (Fig. 8). Vascular
abnormalities in Pbx1-/- embryos include cervical aortic
arch, right-sided aortic arch, and retroesophageal vascular ring, each of
which is frequently encountered in human patients
(De la Cruz and Markwald,
1998; Sandler,
2004). The absence of cardiac OFT septation in
Pbx1-/- embryos, resulting in PTA, is partially accounted
for by loss of Pax3 expression in premigratory NCCs, culminating in a
failure of aorticopulmonary septation. Interestingly, the cardiovascular
defects in Pbx1-/- embryos, combined with craniofacial
abnormalities (Selleri et al.,
2001) and hypoplastic thymus, thyroid and parathyroid glands
(Manley et al., 2004),
resemble the anomalies observed in patients with DiGeorge syndrome
(Epstein, 2001), which results
from a deletion of chromosome 22q11 that includes TBX1, CRKL and
other genes (Merscher et al.,
2001; Moon et al.,
2006). These features underscore the contributions of Pbx1 to the
development of the caudal branchial arches and their derived organs, in
addition to the cardiac OFT.
|
). The
anomalous aortic arch derived from the third arch artery lies at the position
where the ICA and ECA normally branch from the CCA, resulting in all four
carotid arteries emerging from the aortic arch. The change in position of the
RSA to an origin off the descending aorta is likewise explained by the absence
of the right fourth arch artery, which normally connects the RSA to the BCA.
The LSA appears more caudal in origin because the heart has moved rostrally to
a cervical location in Pbx1-/- embryos.
Misregulation of Hox activity, which depends on Pbx function, might
contribute to the arch artery defects in Pbx1-/- embryos
as Hox genes are known to regulate branchial arch artery patterning.
Hoxa3-null mice exhibit regression of the third arch artery
(Kameda et al., 2003), and
antisense targeted to Hox transcripts causes aberrant arch arteries in chick
embryos (Kirby et al., 1997).
Despite the evidence for a role of Pbx/Hox genes in branchial artery
development, chemical targeting of Hox mRNAs in the chick was not accompanied
by cardiac OFT defects (Kirby et al.,
1997). Nor have studies of Hox-deficient mice shown cardiac
malformations, as seen in Pbx1-deficient embryos. This is likely to
reflect redundancy in the contributions of Hox genes, which is circumvented by
the broader Hox compromise induced by Pbx1 deficiency. Further
studies of Pbx1-deficient mice are likely to yield novel insights
into the contributions of Pbx1 and Hox genes to various regulatory
pathways in cardiac development that might not be apparent from studies of
Hox-deficient mice.
Our studies showing the requirement of a Pbx1-Pax3-Msx2 pathway in cardiac
development provide an additional example that Pbx and Pax genes act together
to regulate organ development. Pbx proteins are known to regulate the
expression of Pax6 during pancreatic development
(Zhang et al., 2006). Here, we
demonstrate that Pbx1 regulates Pax3 expression to control
development of the cardiac OFT and involving the function of NCCs. Besides OFT
defects, Splotch mice, which are deficient for Pax3, exhibit
defects in thymus, thyroid, parathyroid and branchial arch artery development,
resembling the malformations observed in Pbx1-/- embryos
and chicks ablated for NCCs (Conway et
al., 1997; Epstein,
1996; Franz, 1989;
Kirby et al., 1983;
Kwang et al., 2002;
Li et al., 1999). Similarities
in these NCC-derived organ defects between Splotch and
Pbx1-/- mice suggest that Pax3 misregulation
might underlie the phenotypes observed in Pbx1-/- embryos,
including branchial arch artery defects. The arch artery defects, however, do
not involve Msx2 because Msx2-/- mutations fail to rescue
the great-artery malformations of the Pbx1-/- embryos,
despite the rescue of cardiac OFT development.
Cardiac OFT defects seen in Pax3 mutants arise from derepression
of its downstream target gene, Msx2, in rhombomeres where cardiac
NCCs originate. This was demonstrated by rescue of PTA in
Pax3-/-;Msx2-/- embryos
(Kwang et al., 2002). In
Pbx1-/- embryos, we observed a significant reduction of
Pax3 and enhancement of Msx2 gene expression in rhombomeres
contributing to cardiac NCCs. These observations, together with DNA-binding,
cellular transactivation and transgenic reporter assays, indicate that
Pax3 is a direct in vivo transcriptional target of Pbx1, and
establish a Pbx1-Pax3-Msx2 transcriptional cascade in heart development.
Genetic support for this conclusion is provided by a significant rescue of
aorticopulmonary septation in 70% of embryos containing both Pbx1 and
Msx2 mutations (n=10), as evidenced by reduction of the PTA
to milder conal defects, which we have never observed in
Pbx1-/- embryos (n=28). Given that Pax3 and Msx2
function cell-autonomously in NCCs to regulate cardiac OFT development
(Kwang et al., 2002;
Li et al., 1999), our rescue
experiments suggest that misregulation of the Pbx1-Pax3-Msx2 pathway in NCCs
contributes to cardiac defects in Pbx1-/- embryos.
Although the partial rescue of PTA in Pbx1-/- embryos
by Msx2 deficiency points to Pax3 misexpression within
premigratory NCCs as underlying the truncal septation defects, we did not
observe a widespread change in Pax3 expression within the neural tube. Rather,
Pbx1-null embryos lack a transient `burst' of Pax3 in premigratory
NCCs prior to their delamination. By contrast, the newly emigrated NCCs retain
normal Pax3 levels in the absence of Pbx1. This is consistent with a lack of
NCC emigration defects from the neural tube in both Pbx1- and
Pax3-null embryos (Conway et al.,
1997; Epstein et al.,
2000). We propose that the Pbx1-dependent Pax3 expression
in premigratory NCCs confers a cellular identity to R6-derived cardiac NCCs
that does not affect their migration, but specifies their ability to
participate in OFT septation. BMP and FGF signaling pathways might cooperate
with Pbx1 to induce the transient expression of Pax3 in premigratory
NCCs, given their roles in regulating Pax3 expression in the dorsal
neural tube of Xenopus embryos
(Monsoro-Burq et al., 2005;
Sato et al., 2005). It will be
of interest to test these possibilities by early-targeted deletion of
Pbx1 and Pax3 in NCCs prior to their emigration from the
neural tube.
The rescue of truncal, but not conal, septation in
Pbx1-/-;Msx2+/- embryos indicates that Pbx1
might regulate other, unidentified genes in NCCs independent of the Pax3-Msx2
pathway (Fig. 7).
Alternatively, Pbx1 might be required in other cell types that regulate OFT
development and in which it is expressed, including SHF cells that provide the
smooth muscle, endocardium and myocardium of the cardiac OFT
(Kelly et al., 2001;
Mjaatvedt et al., 2001;
Verzi et al., 2005;
Waldo et al., 2005). An
additional possibility is the pharyngeal endoderm, where both Fgf8 and Tbx1,
the null phenotypes of which resemble that of Pbx1-/-
embryos (Abu-Issa et al., 2002;
Frank et al., 2002;
Jerome and Papaioannou, 2001;
Lindsay et al., 2001;
Merscher et al., 2001), have
been proposed to be required for OFT septation
(Arnold et al., 2006;
Brown et al., 2004;
Park et al., 2006;
Zhang et al., 2005). These
potential non-NCC functions of Pbx1 require further investigations that will
involve its tissue-specific deletion in the mesoderm, endoderm or SHF cells
that express Pbx1 and contribute to the development of the cardiac
OFT.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/21/3577/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Abu-Issa, R., Smyth, G., Smoak, I., Yamamura, K. and Meyers, E.
N. (2002). Fgf8 is required for pharyngeal arch and
cardiovascular development in the mouse. Development
129,4613
-4625.
Abu-Shaar, M., Ryoo, H. D. and Mann, R. S.
(1999). Control of the nuclear localization of Extradenticle by
competing nuclear import and export signals. Genes
Dev. 13,935
-945.
Arnold, J. S., Werling, U., Braunstein, E. M., Liao, J.,
Nowotschin, S., Edelmann, W., Hebert, J. M. and Morrow, B. E.
(2006). Inactivation of Tbx1 in the pharyngeal endoderm results
in 22q11DS malformations. Development
133,977
-987.
Brendolan, A., Ferretti, E., Salsi, V., Moses, K., Quaggin, S.,
Blasi, F., Cleary, M. L. and Selleri, L. (2005). A
Pbx1-dependent genetic and transcriptional network regulates spleen ontogeny.
Development 132,3113
-3126.
Brown, C. B., Feiner, L., Lu, M. M., Li, J., Ma, X., Webber, A.
L., Jia, L., Raper, J. A. and Epstein, J. A. (2001). PlexinA2
and semaphorin signaling during cardiac neural crest development.
Development 128,3071
-3080.
Brown, C. B., Wenning, J. M., Lu, M. M., Epstein, D. J., Meyers,
E. N. and Epstein, J. A. (2004). Cre-mediated excision of
Fgf8 in the Tbx1 expression domain reveals a critical role for Fgf8 in
cardiovascular development in the mouse. Dev. Biol.
267,190
-202.[CrossRef][Medline]
Chang, C. P., Shen, W. F., Rozenfeld, S., Lawrence, H. J.,
Largman, C. and Cleary, M. L. (1995). Pbx proteins display
hexapeptide-dependent cooperative DNA binding with a subset of Hox proteins.
Genes Dev. 9,663
-674.
Chang, C. P., Brocchieri, L., Shen, W. F., Largman, C. and
Cleary, M. L. (1996). Pbx modulation of Hox homeodomain
amino-terminal arms establishes different DNA-binding specificities across the
Hox locus. Mol. Cell. Biol.
16,1734
-1745.[Abstract]
Chang, C. P., Jacobs, Y., Nakamura, T., Jenkins, N. A.,
Copeland, N. G. and Cleary, M. L. (1997). Meis proteins are
major in vivo DNA binding partners for wild-type but not chimeric Pbx
proteins. Mol. Cell. Biol.
17,5679
-5687.[Abstract]
Chang, C. P., Chen, L. and Crabtree, G. R.
(2003). Sonographic staging of the developmental status of mouse
embryos in utero. Genesis
36, 7-11.[CrossRef][Medline]
Chang, C. P., Neilson, J. R., Bayle, J. H., Gestwicki, J. E.,
Kuo, A., Stankunas, K., Graef, I. A. and Crabtree, G. R.
(2004). A field of myocardial-endocardial NFAT signaling
underlies heart valve morphogenesis. Cell
118,649
-663.[CrossRef][Medline]
Chisaka, O. and Capecchi, M. R. (1991).
Regionally restricted developmental defects resulting from targeted disruption
of the mouse homeobox gene hox-1.5. Nature
350,473
-479.[CrossRef][Medline]
Chisaka, O. and Kameda, Y. (2005). Hoxa3
regulates the proliferation and differentiation of the third pharyngeal arch
mesenchyme in mice. Cell Tissue Res.
320, 77-89.[CrossRef][Medline]
Choe, S. K., Vlachakis, N. and Sagerstrom, C. G.
(2002). Meis family proteins are required for hindbrain
development in the zebrafish. Development
129,585
-595.
Conway, S. J., Henderson, D. J., Kirby, M. L., Anderson, R. H.
and Copp, A. J. (1997). Development of a lethal congenital
heart defect in the splotch (Pax3) mutant mouse. Cardiovasc.
Res. 36,163
-173.
De la Cruz, M. and Markwald, R. R. (1998).
Living Morphogenesis of the Heart. Boston, MA:
Birkhauser.
DiMartino, J. F., Selleri, L., Traver, D., Firpo, M. T., Rhee,
J., Warnke, R., O'Gorman, S., Weissman, I. L. and Cleary, M. L.
(2001). The Hox cofactor and proto-oncogene Pbx1 is required for
maintenance of definitive hematopoiesis in the fetal liver.
Blood 98,618
-626.
Epstein, J. (1996). Pax3, neural crest and
cardiovascular development. Trends Cardiovasc. Med.
6, 255-261.[CrossRef]
Epstein, J. A. (2001). Developing models of
DiGeorge syndrome. Trends Genet.
17,S13
-S17.[CrossRef][Medline]
Epstein, J. A., Li, J., Lang, D., Chen, F., Brown, C. B., Jin,
F., Lu, M. M., Thomas, M., Liu, E., Wessels, A. et al.
(2000). Migration of cardiac neural crest cells in Splotch
embryos. Development
127,1869
-1878.[Abstract]
Frank, D. U., Fotheringham, L. K., Brewer, J. A., Muglia, L. J.,
Tristani-Firouzi, M., Capecchi, M. R. and Moon, A. M. (2002).
An Fgf8 mouse mutant phenocopies human 22q11 deletion syndrome.
Development 129,4591
-4603.
Franz, T. (1989). Persistent truncus arteriosus
in the Splotch mutant mouse. Anat. Embryol.
180,457
-464.[CrossRef][Medline]
Greene, L. A. and Tischler, A. S. (1976).
Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma
cells which respond to nerve growth factor. Proc. Natl. Acad. Sci.
USA 73,2424
-2428.
Harvey, R. P. and Rosenthal, N. (1999).
Heart Development. New York, NY: Academic
Press.
Hutson, M. R. and Kirby, M. L. (2007). Model
systems for the study of heart development and disease. Cardiac neural crest
and conotruncal malformations. Semin. Cell Dev. Biol.
18,101
-110.[CrossRef][Medline]
Jacobs, Y., Schnabel, C. and Cleary, M. (1999).
Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2
hindbrain enhancer activity. Mol. Cell. Biol.
19,5134
-5142.
Jerome, L. A. and Papaioannou, V. E. (2001).
DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1.
Nat. Genet. 27,286
-291.[CrossRef][Medline]
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and
Sucov, H. M. (2000). Fate of the mammalian cardiac neural
crest. Development 127,1607
-1616.[Abstract]
Kameda, Y., Watari-Goshima, N., Nishimaki, T. and Chisaka,
O. (2003). Disruption of the Hoxa3 homeobox gene results in
anomalies of the carotid artery system and the arterial baroreceptors.
Cell Tissue Res. 311,343
-352.[Medline]
Kelly, R. G., Brown, N. A. and Buckingham, M. E.
(2001). The arterial pole of the mouse heart forms from
Fgf10-expressing cells in pharyngeal mesoderm. Dev.
Cell 1,435
-440.[CrossRef][Medline]
Kim, S. K., Selleri, L., Lee, J. S., Zhang, A. Y., Gu, X.,
Jacobs, Y. and Cleary, M. L. (2002). Pbx1 inactivation
disrupts pancreas development and in Ipf1-deficient mice promotes diabetes
mellitus. Nat. Genet.
30,430
-435.[CrossRef][Medline]
Kirby, M. L. (2007). Cardiac
Development. New York, NY: Oxford University Press.
Kirby, M. L., Gale, T. F. and Stewart, D. E.
(1983). Neural crest cells contribute to normal aorticopulmonary
septation. Science 220,1059
-1061.
Kirby, M. L., Hunt, P., Wallis, K. and Thorogood, P.
(1997). Abnormal patterning of the aortic arch arteries does not
evoke cardiac malformations. Dev. Dyn.
208, 34-47.[CrossRef][Medline]
Knoepfler, P. S. and Kamps, M. P. (1995). The
pentapeptide motif of Hox proteins is required for cooperative DNA binding
with Pbx1, physically contacts Pbx1, and enhances DNA binding by Pbx1.
Mol. Cell. Biol. 15,5811
-5819.[Abstract]
Kwang, S. J., Brugger, S. M., Lazik, A., Merrill, A. E., Wu, L.
Y., Liu, Y. H., Ishii, M., Sangiorgi, F. O., Rauchman, M., Sucov, H. M. et
al. (2002). Msx2 is an immediate downstream effector of Pax3
in the development of the murine cardiac neural crest.
Development 129,527
-538.[Medline]
Li, J., Liu, K. C., Jin, F., Lu, M. M. and Epstein, J. A.
(1999). Transgenic rescue of congenital heart disease and spina
bifida in Splotch mice. Development
126,2495
-2503.[Abstract]
Li, J., Chen, F. and Epstein, J. A. (2000).
Neural crest expression of Cre recombinase directed by the proximal Pax3
promoter in transgenic mice. Genesis
26,162
-164.[CrossRef][Medline]
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T.,
Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et
al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome
region causes aortic arch defects in mice. Nature
410,97
-101.[CrossRef][Medline]
MacKenzie, A., Ferguson, M. W. and Sharpe, P. T.
(1992). Expression patterns of the homeobox gene, Hox-8, in the
mouse embryo suggest a role in specifying tooth initiation and shape.
Development 115,403
-420.[Abstract]
Manley, N. R., Selleri, L., Brendolan, A., Gordon, J. and
Cleary, M. L. (2004). Abnormalities of caudal pharyngeal
pouch development in Pbx1 knockout mice mimic loss of Hox3 paralogs.
Dev. Biol. 276,301
-312.[CrossRef][Medline]
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A.,
Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al.
(2001). TBX1 is responsible for cardiovascular defects in
velo-cardio-facial/DiGeorge syndrome. Cell
104,619
-629.[CrossRef][Medline]
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R.
A., Kern, M. J., Eisenberg, C. A., Turner, D. and Markwald, R. R.
(2001). The outflow tract of the heart is recruited from a novel
heart-forming field. Dev. Biol.
238,97
-109.[CrossRef][Medline]
Monsoro-Burq, A. H., Wang, E. and Harland, R.
(2005). Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals
during Xenopus neural crest induction. Dev. Cell
8, 167-178.[CrossRef][Medline]
Moon, A. M., Guris, D. L., Seo, J. H., Li, L., Hammond, J.,
Talbot, A. and Imamoto, A. (2006). Crkl deficiency disrupts
Fgf8 signaling in a mouse model of 22q11 deletion syndromes. Dev.
Cell 10,71
-80.[CrossRef][Medline]
Park, E. J., Ogden, L. A., Talbot, A., Evans, S., Cai, C. L.,
Black, B. L., Frank, D. U. and Moon, A. M. (2006). Required,
tissue-specific roles for Fgf8 in outflow tract formation and remodeling.
Development 133,2419
-2433.
Peltenburg, L. T. and Murre, C. (1996).
Engrailed and Hox homeodomain proteins contain a related Pbx interaction motif
that recognizes a common structure present in Pbx. EMBO
J. 15,3385
-3393.[Medline]
Phelan, M. L., Rambaldi, I. and Featherstone, M. S.
(1995). Cooperative interactions between HOX and PBX proteins
mediated by a conserved peptide motif. Mol. Cell.
Biol. 15,3989
-3997.[Abstract]
Pruitt, S. C., Bussman, A., Maslov, A. Y., Natoli, T. A. and
Heinaman, R. (2004). Hox/Pbx and Brn binding sites mediate
Pax3 expression in vitro and in vivo. Gene Expr.
Patterns. 4,671
-685.[CrossRef][Medline]
Sandler, T. (2004). Langman's
Medical Embryology. Philadelphia, PA: Lippincott Williams &
Wilkins.
Sato, T., Sasai, N. and Sasai, Y. (2005).
Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus
ectoderm. Development
132,2355
-2363.
Schnabel, C. A., Selleri, L., Jacobs, Y., Warnke, R. and Cleary,
M. L. (2001). Expression of Pbx1b during mammalian
organogenesis. Mech. Dev.
100,131
-135.[CrossRef][Medline]
Schnabel, C. A., Godin, R. E. and Cleary, M. L.
(2003a). Pbx1 regulates nephrogenesis and ureteric branching in
the developing kidney. Dev. Biol.
254,262
-276.[CrossRef][Medline]
Schnabel, C. A., Selleri, L. and Cleary, M. L.
(2003b). Pbx1 is essential for adrenal development and urogenital
differentiation. Genesis
37,123
-130.[CrossRef][Medline]
Selleri, L., Depew, M. J., Jacobs, Y., Chanda, S. K., Tsang, K.
Y., Cheah, K. S., Rubenstein, J. L., O'Gorman, S. and Cleary, M. L.
(2001). Requirement for Pbx1 in skeletal patterning and
programming chondrocyte proliferation and differentiation.
Development 128,3543
-3557.
Stankunas, K., Hang, C. T., Tsun, Z. Y., Chen, H., Lee, N. V.,
Wu, J. I., Shang, C., Bayle, J. H., Shou, W., Iruela-Arispe, M. L. et al.
(2008a). Endocardial Brg1 represses ADAMTS1 to maintain the
microenvironment for myocardial morphogenesis. Dev.
Cell 14,298
-311.[CrossRef][Medline]
Stankunas, K., Shang, C., Twu, K. Y., Kao, S. C., Jenkins, N.
A., Copeland, N. G., Sanyal, M., Selleri, L., Cleary, M. L. and Chang, C.
P. (2008b). Pbx/Meis deficiencies demonstrate multigenetic
origins of congenital heart disease. Circ. Res.
103,702
-709.
Verzi, M. P., McCulley, D. J., De Val, S., Dodou, E. and Black,
B. L. (2005). The right ventricle, outflow tract, and
ventricular septum comprise a restricted expression domain within the
secondary/anterior heart field. Dev. Biol.
287,134
-145.[CrossRef][Medline]
Waldo, K. L., Hutson, M. R., Ward, C. C., Zdanowicz, M., Stadt,
H. A., Kumiski, D., Abu-Issa, R. and Kirby, M. L. (2005).
Secondary heart field contributes myocardium and smooth muscle to the arterial
pole of the developing heart. Dev. Biol.
281, 78-90.[CrossRef][Medline]
Waskiewicz, A. J., Rikhof, H. A., Hernandez, R. E. and Moens, C.
B. (2001). Zebrafish Meis functions to stabilize Pbx proteins
and regulate hindbrain patterning. Development
128,4139
-4151.
Waskiewicz, A. J., Rikhof, H. A. and Moens, C. B.
(2002). Eliminating zebrafish pbx proteins reveals a hindbrain
ground state. Dev. Cell
3, 723-733.[CrossRef][Medline]
Wu, H., Kao, S. C., Barrientos, T., Baldwin, S. H., Olson, E.
N., Crabtree, G. R., Zhou, B. and Chang, C. P. (2007). Down
syndrome critical region-1 is a transcriptional target of nuclear factor of
activated T cells-c1 within the endocardium during heart development.
J. Biol. Chem. 282,30673
-30679.
Yashiro, K., Shiratori, H. and Hamada, H.
(2007). Haemodynamics determined by a genetic programme govern
asymmetric development of the aortic arch. Nature
450,285
-288.[CrossRef][Medline]
Zhang, X., Rowan, S., Yue, Y., Heaney, S., Pan, Y., Brendolan,
A., Selleri, L. and Maas, R. L. (2006). Pax6 is regulated by
Meis and Pbx homeoproteins during pancreatic development. Dev.
Biol. 300,748
-757.[CrossRef][Medline]
Zhang, Z., Cerrato, F., Xu, H., Vitelli, F., Morishima, M.,
Vincentz, J., Furuta, Y., Ma, L., Martin, J. F., Baldini, A. et al.
(2005). Tbx1 expression in pharyngeal epithelia is necessary for
pharyngeal arch artery development. Development
132,5307
-5315.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
