|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 October 2008
doi: 10.1242/dev.027284
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Molecular Embryology, German Cancer Research Center, Im
Neuenheimer Feld 581, D-69120 Heidelberg, Germany.
2 Division of Vascular Oncology and Metastasis, Medical Faculty Mannheim,
University of Heidelberg, and German Cancer Research Center, Im Neuenheimer
Feld 581, D-69120 Heidelberg, Germany.
3 Department of Biological Sciences and Biotechnology, Tsinghua University,
100084 Beijing, P. R. China.
Author for correspondence (e-mail:
niehrs{at}dkfz-heidelberg.de)
Accepted 8 September 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: R-spondin, VEGF, Placenta, Vasculogenesis, Wnt, Xenopus, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Vasculogenesis proceeds in close association with
hematopoiesis, and in mouse these processes occur both extra-embryonically, in
the yolk sac, the allantois and the placenta, as well as intra-embryonically,
in the aortic primordia (Moore and
Metcalf, 1970; Gekas et al.,
2005; Ottersbach and Dzierzak,
2005; Zeigler et al.,
2006). The homologous compartments in the Xenopus embryo
are the mesoderm of the dorsal lateral plate near the pronephros and
pronephric ducts (intra-embryonic equivalent) and the ventral blood islands
(extra-embryonic equivalent) (Cleaver et
al., 1997; Cleaver and Krieg,
1998; Ciau-Uitz et al.,
2000; Walmsley et al.,
2002).
The close association of hematopoietic and angioblastic cell development is
probably due to the fact that both cell types derive from a mesodermal
hemangioblast precursor, for which there is good evidence in zebrafish,
Xenopus, chick, mouse and humans
(Eichmann et al., 1997;
Kennedy et al., 1997;
Choi et al., 1998;
Jaffredo et al., 1998;
Nishikawa et al., 1998;
Jaffredo et al., 2000;
Walmsley et al., 2002;
Huber et al., 2004;
Ferguson et al., 2005;
Vogeli et al., 2006;
Kennedy et al., 2007)
(reviewed by Red-Horse et al.,
2007; Xiong, 2008)
[but see Ueno and Weissman (Ueno and
Weissman, 2006)].
Little is known about the growth factors that control the cell fate
decision between hematopoietic cells and angioblasts, with exception of
vascular endothelial growth factor (VEGF). VEGF plays a central role in many
aspects of vascular development and embryonic angiogenesis
(Carmeliet et al., 1996;
Ferrara et al., 1996;
Coultas et al., 2005)
(reviewed by Ferrara, 1999;
Tammela et al., 2005;
Olsson et al., 2006). In
particular, VEGF signaling is necessary and sufficient for promoting early
endothelial differentiation in vertebrates
(Carmeliet et al., 1996;
Ferrara et al., 1996;
Eichmann et al., 1997;
Shalaby et al., 1997;
Koibuchi et al., 2006).
Unlike for angioblast specification, a plethora of growth factors are known
to regulate angiogenesis, including (but not limited to) VEGF, angiopoietin,
PDGF, ephrin, Delta-Notch, BMPs, FGF and EGF (reviewed by
Rossant and Howard, 2002).
More recently, Wnt/Frizzled signaling has been added to this list. Wnts are
glycoproteins that can activate multiple receptors and pathways, the best
characterized of which is the Wnt/β-catenin pathway, which involves
Frizzled (Fz) and LRP5/6 receptors (Logan
and Nusse, 2004). Gain- and loss-of-function experiments have
implicated Wnt signaling in promoting growth and differentiation of
endothelial cells in vitro as well as angiogenesis in vivo (reviewed by
Zerlin et al., 2008). However,
the role of Wnt/β-catenin signaling in angioblast specification and
vasculogenesis is unclear. R-spondins (Rspo1-Rspo4) encode a novel family of
secreted proteins in vertebrates, which activate Wnt/β-catenin signaling
and interact with LRP6 (Kazanskaya et al.,
2004; Nam et al.,
2006; Wei et al.,
2007; Kim et al.,
2008). R-spondins are involved in embryonic patterning and
differentiation in frogs, mice and humans
(Kazanskaya et al., 2004;
Kim et al., 2005;
Aoki et al., 2006;
Blaydon et al., 2006;
Parma et al., 2006;
Aoki et al., 2008;
Bell et al., 2008).
Here, we have focused on Rspo3, which we found to be prominently expressed in hematopoietic organs. Analysis of Rspo3 by gain- and loss-of-function experiments in both mouse and Xenopus reveals that this novel growth factor plays an essential role during vertebrate vasculogenesis and angiogenesis. In Xenopus embryos, Rspo3 regulates the balance between hematopoietic and endothelial differentiation by promoting angioblast specification and inhibiting blood cell specification. We go on to show that Rspo3 mouse mutants die of angiogenesis defects in yolk sac and placenta. To determine whether these effects represent a direct action on endothelial cells, we demonstrate that recombinant R-spondin promotes proliferation and angiogenesis in endothelial cell lines in vitro. Finally, we show that Rspo3 triggers Wnt/β-catenin signaling to activate the immediate early target gene Vegf, which mediates the effects of Rspo3. The results shed light on the poorly understood growth factor regulation of early angioblast specification and vascular development.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Prospective ventral blood islands were dissected from
stage 13, 16 or 20 embryos by cutting the ventral of the embryo from the
posterior limit of the cement gland to the anus. In situ hybridization on
cryosections was performed according to Yang et al.
(Yang et al., 1999).
O-dianisidine staining was carried out without fixation as described
(Huber et al., 1998). VEGFR
inhibitors were used at 1 µM KRN633
[N-(2-Chloro-4-((6,7-dimethoxy-4-quinazolinyl)oxy)
phenyl)-N'-propylurea, Calbiochem] and 2 µM MAZ51
[3-(4-Dimethylamino-naphthalen-1-ylmethylene)-1,3-dihydroindol-2-one,
Calbiochem], respectively. For bead implantations, Affigel beads (BioRad) were
rinsed in PBS and incubated with affinity-purified recombinant xRspo2 or VEGF
(Promocell) at 1 µg/µl overnight at 4°C. Beads soaked in BSA were
used as controls. BSA-, Rspo2- or VEGF-soaked beads were transplanted into the
prospective ventral blood islands of neurulae (stage 15) and embryos fixed for
analysis at tadpole stage (stage 25). The antisense morpholino oligonucleotide
targeting X. tropicalis Rspo3 (gi: 114149217) and X.
tropicalis VEGFA (gi: 77626411) were 5'atgcaattgcgactgctttctctgt
and 5'cggtgaggctacagtgtaacagtgt.
RT-PCR
RT-PCR assays were carried out with primers described previously (see
Dosch et al., 1997;
Glinka et al,. 1997);
additional primers were XSCL (forward, actcaccctccagacaagaa; reverse,
atttaatcaccgctgcccac), X
-globin (forward,
tccctcagaccaaaacctac; reverse, cccctcaattttatgctggac), Xmsr (forward,
aacttcgctctcgctcctccatac; reverse, gccagcagatagcaaacaccac), XVEGF A
(forward, aggcgagggagaccataaac; reverse, tctgctgcattcacactgac) and
m-globin (forward, actttgatgtaagccacggc; reverse,
tagccaaggtcaccagcag).
qPCR assays were performed using an LC480 light cycler (Roche). Details of PCR primers used for amplification of mouse transcripts can be provided on request.
Targeted disruption and analysis of mouse embryos
Mice carrying a targeted disruption of Rspo3 (gi:94388197) were
obtained commercially from Artemis (Cologne). In brief, targeted mutagenesis
of murine Rspo3 was carried out in mouse embryonic stem cells
following standard procedures, using the targeting vector shown in Fig. S3A in
the supplementary material. Transgenic mice were generated on a C57Bl/6
background via standard diploid injection. Homozygous mutant embryos were
generated by heterozygote intercrosses. C57Bl/6 heterozygotes were then
backcrossed to CD1 females for at least six generations. No significant
phenotypic differences were detected between homozygous embryos in C57BL/6 and
CD1 background. Mouse tail tips or portions of yolk sacs or embryos were used
for genotyping by PCR. Genotyping was performed by PCR analysis using three
primers: 5'ATGCTTTGAGGCTTGTGACC; 5'TGCACC GACTCCAGTACTGG; and
5'TACATTCTGGTTTCTCATCTGG.
Mice were mated overnight and the morning of vaginal plug detection was
defined as embryonic day (E) 0.5. For routine histological analysis, tissues
were fixed in 4% paraformaldehyde overnight and embedded in paraffin wax for
sectioning. Sections (4 µm) were stained with Hematoxylin/Eosin. For
whole-mount in situ hybridization, the embryos were fixed and processed as
described previously (del Barco Barrantes
et al., 2003).
BrdU-incorporation assay
BrdU labeling of embryos was performed in vitro to avoid the effects of
placental-embryo deficiency. Whole concepti (E8.5 and E9.5) were dissected
from the decidua and incubated at 37°C with 100 µM BrdU for 4 hours.
Embryos and extra-embryonic tissues were fixed in paraformaldehyde and
embedded in paraffin. Immunochemistry for BrdU was performed as previously
described (Schorpp-Kistner et al.,
1999). The percentage of BrdU incorporating cells was counted for
three independent groups of siblings, using three wild-type and three mutant
samples (allantois and chorionic plate) each.
Analysis of β-galactosidase and β-catenin in mouse embryos
BATGAL+/-/Rspo3-/- and
BATGAL+/-/Rspo3+/+ mice were fixed at
different stages and stained for β-galactosidase activity using a
standard protocol. Then, allantois and chorionic plates were removed, embedded
in Mowiol, photographed and the number of stained cells within a fixed area
was counted. The number of β-galactosidase positive cells was counted for
three independent groups of siblings, using three wild-type and three mutant
samples (allantois and chorionic plate) each.
For quantification of nuclear β-catenin staining, embryos were photographed in a Zeiss confocal microscope (LSM510). The average intensity of Hoechst staining and background β-catenin staining in the cytoplasm of cells was determined using ImageJ (http://rsb.info.nih.gov/ij) in brightness-normalized images. The intensity of β-catenin staining in the nuclei was measured, background staining was subtracted, and the staining ratio between nuclear β-catenin and nuclear Hoechst was calculated for each nucleus.
Preparation of Rspo2 conditioned medium
Transfection of HEK293T cells with X. laevis Rspo2 (gi:54145367)
and harvest of conditioned medium were as described
(Kazanskaya et al., 2004).
Anti-FLAG M2-Agarose beads (Sigma) were incubated overnight with X.
laevis Rspo2-conditioned medium or control medium from untransfected HEK
293T cells. After washing, xRspo2FLAG recombinant protein was eluted from
beads using FLAG peptide (Sigma).
Endothelial proliferation assay
Human umbilical vein endothelial cells (HUVEC; PromoCell) were cultured in
endothelial cell growth medium (Promocell) supplemented with 10% fetal bovine
serum (FBS). For proliferation studies, cells were plated at 50% confluence in
a 96-well plate; the next day they were supplemented with VEGF and X.
laevis Rspo2 proteins for 48 hours, after which BrdU (10 µM) was added
to each well for 4 hours. BrdU analysis of cell proliferation was carried out
using Cell Proliferation ELISA BrdU chemiluminescent from Roche Applied
Science.
Chorioallantoic membrane (CAM) assay
For chicken chorioallantoic membrane (CAM) assay, chicken eggs were
incubated at 37°C in a humidified chamber. On day 3 of development, a
window was made in the outer shell and on 6 day of development a 20 ml of
xRspo2-FLAG or control beads or filter disk carrying recombinant VEGF
(Sigma-Aldrich,100 ng/filter) was placed onto the surface of the CAM. The
beads (anti-FLAG M2-Agarose, Sigma) were incubated overnight with X.
laevis Rspo2 conditioned medium or control medium from untransfected HEK
293T cells and washed three times in PBS. After 5 days of incubation, the
filter disks and the attached CAM were excised, washed with PBS and processed
for histology using Hematoxylin/Eosin staining.
Spheroid-based angiogenesis assay
Endothelial cell spheroids of defined cell number were generated as
described previously (Korff and Augustin,
1998). In brief, 12 hours after transfection, HUVEC were suspended
in culture medium containing 0.2% (w/v) carboxymethylcellulose (Sigma) and
seeded in nonadherent round-bottom 96-well plates (Greiner). Under these
conditions, all suspended cells contribute to the formation of a single
spheroid per well of defined size and cell number (400 cells/spheroid).
Spheroids were generated overnight, after which they were embedded into
collagen gels. The spheroid containing gel was rapidly transferred into
prewarmed 24-well plates and allowed to polymerize (30 minutes), then 100
µl endothelial basal medium with or without the indicated growth factors
was added on top of the gel. After 24 hours, in vitro capillary sprouting was
quantified by measuring the cumulative length using a digital imaging software
(Axioplan, Zeiss). In order to obtain a measure of the cumulative sprout
length per spheroid, every sprout from 10-15 spheroids was assessed, and from
these data the mean cumulative sprout length per spheroid was calculated.
|
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
), we
wished to extend our analysis to other Rspo family members. We
specifically focused on Rspo3, because it showed an early embryonic
expression, suggesting an essential role during early patterning. The
expression pattern of mouse Rspo3 was meanwhile reported
(Aoki et al., 2006) and we
confirm that expression of the gene shows a complex pattern: the brain, neural
tube, tail, heart, somites and limbs (see Fig. S1A-C in the supplementary
material; data not shown). In addition, we found that mouse Rspo3 was
prominently expressed in sites of vasculogenesis and angiogenesis. Already in
E8.0 embryos, Rspo3 is expressed in the posterior primitive streak
(Huber et al., 2004) and the
allantois, which are prominent sources of hematopoietic cells
(Fig. 1A). Rspo3
expression persists in the allantois at later stages
(Fig. 1B) and also becomes
expressed in the chorionic plate of the placenta at E9.0
(Fig. 1B,C; see Fig. S1D,F in
the supplementary material), and in heart and umbilical cord starting from
E9.5 (see Fig. S1A-C in the supplementary material). Rspo3 is also
expressed in the blood vessels of the embryo proper
(Fig. 1D).
Similar to mouse, Xenopus Rspo3 is expressed in the CNS, and in a
variety of precursors of the vasculature, such as dorsal lateral plate and
ventral blood islands (Fig.
1E-K), which give rise to adult and embryonic blood, respectively.
In particular, Rspo3 shows prominent co-expression with or nearby the
angioblast marker Msr (Devic et
al., 1996) in the vitelline vein precursors in the periphery of
the vbi, surrounding and partially overlapping the more centrally expressed
Scl, an early marker of blood forming cells
(Mead et al., 1998)
(Fig. 1I-K; see Fig. S2 in the
supplementary material). Rspo3 is also co-expressed with
Vegf in the hypochord (Fig.
1G,H), a tissue that is important for formation of the dorsal
aorta (Cleaver et al., 2000).
We conclude that Rspo3 is prominently expressed in or close by
endothelial cells, and their precursors in Xenopus and mouse.
Rspo3 regulates hematopoietic cell fate in Xenopus
To investigate a possible role in Xenopus development, we
inhibited Rspo3 by injection of antisense morpholino
oligonucleotides. The resulting tadpoles displayed ventral edema, as they are
characteristically seen following vascular defects
(Fig. 2A,B). Staining of
erythrocytes with o-dianisidine confirmed that the experimental embryos
develop fewer vessels and accumulate erythrocytes in the ventral side
(Fig. 2C,D). Molecular marker
analysis revealed an expansion of the hematopoietic markers -globin and
Scl in the ventral blood islands (vbi). By contrast, Msr
expression was reduced, which was most pronounced in the lateral plate region,
where vbi-derived angioblasts normally develop into the vitelline network
(Fig. 2E-L). Rescue experiments
carried out in ventral marginal zone explants (VMZ), which contain the
vitelline vein and vbi precursors, validated the specificity of the
morpholino: -globin expression was expanded in Rspo3
morpholino-injected VMZs, whereas expression was blocked by co-injection of
morpholino and Rspo2 mRNA (Fig.
2M-O). These results suggest a requirement of Rspo3 in promoting
angioblast fate at the expense of the hematopoietic lineage in the vbi.
To confirm this conclusion, we misexpressed Rspo2 (which is better produced
than Rspo3). To rule out the possibility that early embryonic misexpression of
Rspo2 may act indirectly by affecting early patterning rather than by directly
regulating hemangiogenic fates, we implanted beads soaked with recombinant
Rspo2 or VEGF into the vbi precursors of late neurulae. We thereby avoided
global overexpression, and targeted R-spondin signaling to the hematopoietic
lineage. Rspo2 and VEGF beads both repressed -globin, and instead
induced patches of Msr expression
(Fig. 2P-U). Furthermore, Rspo2
induced robust Vegf expression around the bead
(Fig. 2V,W). This confirms that
R-spondin signaling regulates the decision between blood and endothelial cell
fates in the vbi and suggests that its effects are mediated by VEGF.
|
-globin,
Msr and Vegf are expressed in VMZ
(Fig. 3A-D). Rspo3
morpholino injection upregulated the expression of Scl and
-globin at the expense of Msr as well as of Vegf
(Fig. 3A). Conversely,
Rspo2 and Rspo3 mRNA injection, which generally behave
indistinguishably in overexpression, induced Msr and Vegf,
and blocked expression of Scl and -globin
(Fig. 3A,B). The effects of
Rspo3 gain- and loss-of-function were phenocopied by up- and
downregulation of Wnt ligand, following microinjection of wild-type or
dominant-negative Wnt8 (Hoppler
et al., 1996), respectively
(Fig. 3A). Similar to
dnWnt8, mRNA microinjection of Dkk1, a specific inhibitor of
the Wnt receptor LRP5/6 (Glinka et al.,
1998), upregulated Scl and downregulated angioblast
markers (Fig. 3B). Furthermore
Dkk1 blocked the ability of Rspo3 to upregulate Msr
and Vegf (Fig. 3B,
lanes 7-8). These results confirm that during vasculogenesis Rspo3 acts as
promoting Wnt/β-catenin signaling.
As VEGF is known to control cell fate decision between hematopoietic cells
and angioblast in chick (Eichmann et al.,
1997), we tested two pharmacological VEGF receptor inhibitors (MAZ
51 and KRN 633) (Kirkin et al.,
2001; Nakamura et al.,
2004). Treatment of VMZs with both drugs at low µM
concentration mildly phenocopied the effects of Rspo3 inhibition
(Fig. 3B, lanes 5-6) and
partially inhibited the effect of Rspo3 mRNA overexpression
(Fig. 3B, lanes 10-11). As an
alternative to VEGF receptor inhibitors, we used Vegf Morpholino
injection, which, like Rspo3 Mo, upregulated Scl expression
(Fig. 3C). These results
indicate that VEGF promotes endothelial at the expense of blood cell
differentiation in Xenopus. To corroborate the VMZ explant data, we
used explanted prospective vbi from different embryonic stages for marker gene
analysis (Fig. 3D). This
confirmed Vegf expression in the vbi by qPCR, which was reduced by
Rspo3 Mo. This was accompanied by downregulation of Msr and
upregulation of Scl.
In gain-of-function, Vegf mRNA injection upregulated Msr
and blocked Scl expression (Fig.
4A, lane 3), similar to Rspo2/3 mRNAs. Importantly, Vegf
overexpression rescued Msr expression in Rspo3-depleted
embryos (Fig. 4A, lane 5).
Conversely, Vegf morpholino injection blocked the ability of
Rspo2-soaked beads to inhibit -globin expression
(Fig. 4B), confirming the
effects seen with VEGF receptor inhibitors. This indicates that R-spondin
signaling is mediated by VEGF.
|
). We conclude that: (1) Rspo3 regulates the balance between hematopoietic and angioblast cell fate in the vbi; (2) it does so by promoting Wnt/β-catenin signaling, which (3) is required for expression of Vegf, that (4) acts as distal regulator of both cell fates in this cascade, promoting angioblast and inhibiting hematopoietic cell fate.
Rspo3 is required for mouse vascular development
To extend the analysis to mammals, we generated Rspo3 mutant mice
by targeted gene disruption (see Fig. S3 in the supplementary material).
Homozygous Rspo3 mutant embryos have been previously described
(Aoki et al., 2006). The mice
were reported to arrest development around E10 because of placental defects,
the nature of which remained unknown. We confirmed that Rspo3 mutant
embryos arrest development at around day 10 and show placental defects (see
below). In addition, we found that mutant mice show hemorrhages and have pale
yolk sacs and placentas (Fig.
5A-C). These are characteristic features of mice that display
embryonic vascular deficiencies. PECAM staining and histological analysis
confirmed that the yolk sac of mutant embryos had an underdeveloped
vasculature (Fig. 5D,E),
indicative of an angiogenesis defect. Similar defects were seen in the
vasculature of the embryo proper (Fig.
5F). Histological inspection of the placenta at E10.5 showed that
embryonic blood vessels failed to invade the labyrinth layer in Rspo3
mutants (Fig. 5G). Vascular
staining for PECAM indicated that the primary capillary plexus was formed and
vessels appeared normal at E9.5 (not shown). However, these vessels failed to
undergo proliferation and remodeling, as is characteristic for later
angiogenesis (Fig. 5H). These
results indicate that Rspo3 signaling in the placenta is required to promote
endothelial cell growth and remodeling, rather than initial differentiation
and formation of the primary plexus. Consistent with this interpretation, BrdU
labeling experiments showed a marked decrease in proliferating endothelial
cells in the mutants by E9.5 (see below,
Fig. 7E).
Rspo3 is required for Wnt/β-catenin-mediated induction of VEGF in the placenta
We next asked whether as in Xenopus, mouse Vegf may be
regulated by Rspo3. Similar to Rspo3, VEGF is required for placental
development (Carmeliet et al.,
1996; Ferrara et al.,
1996; Coultas et al.,
2005) and Rspo3 is co-expressed with Vegf and
the endothelial marker Vegfr2 (Flk1) in the placenta (see
Fig. S1D-F in the supplementary material). Whereas Vegfr2 expression
in endothelia was mostly unaffected (Fig.
6A), expression of Vegf was strongly reduced when
analyzed by both in situ hybridization
(Fig. 6B) and RT-PCR (see Fig.
S4 in the supplementary material). By contrast, expression of Tpbpa
and Csh1, markers of giant trophoblast and spongiotrophoblast cells
that produce VEGF (Coultas et al.,
2005), was mostly unaffected
(Fig. 6C,D). We conclude that
Rspo3 is required for Vegf expression and for endothelial
cell proliferation to promote proper vascularization of the mouse
placenta.
Interestingly, two Wnt/β-catenin pathway components, Wnt2 and
frizzled5, are also required for the vascularization of the mouse placenta
(Monkley et al., 1996;
Ishikawa et al., 2001) and
evidence for a general role of Wnt/β-catenin signaling in angiogenesis is
accumulating (Zerlin et al.,
2008). To corroborate therefore that the vascular defects in
Rspo3 mutants were also due to reduced Wnt/β-catenin signaling,
we carried out immunofluorescence staining to monitor nuclear β-catenin.
A marked reduction of nuclear β-catenin staining was observed in the
mutant allantois (Fig. 6E,G).
To confirm this downregulation of Wnt signaling, we bred Rspo3
heterozygotes with the Wnt-reporter mouse line BATGAL
(Maretto et al., 2003), which
drives lacZ expression at sites of Wnt signaling. Staining for
β-galactosidase showed a lacZ signal in the chorionic plate of
wild-type BATGAL mice, which was reduced in
Rspo3-/-/BATGAL allantoises and placentas
(Fig. 6F,G). Taken together,
these results suggest that Rspo3 functions in placental vascular
remodeling by promoting Wnt/β-catenin signaling to activate Vegf
expression.
|
|
|
|
|
Another angiogenic morphogenesis test is the spheroidal sprouting assay, in
which collagen gel-embedded endothelial cells give rise to a three-dimensional
capillary-like network upon angiogenic stimulation
(Korff and Augustin, 1998).
Similar to VEGF, Rspo2 induced endothelial sprouting in a dose-dependent
manner (Fig. 7H-L). The ability
of Rspo2 to induce sprouting was blocked by addition of the Wnt inhibitor Dkk1
but not by the related Dkk3, which does not inhibit Wnt signaling
(Mao et al., 2001)
(Fig. 7K). In contrast to
Rspo2, the sprouting effect of VEGF was not affected by Dkk1. Once again the
effects were dependent on VEGF signaling, as siRNA knockdown of
Vegfr2 (>70% by RT-PCR, not shown) blocked the ability of Rspo2 to
induce sprouting (Fig. 7L). We
conclude that R-spondin signaling can act directly on endothelial cells to
promote angiogenesis by activating Wnt/β-catenin and VEGF signaling.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Red-Horse et al., 2007;
Xiong, 2008). In the
hematopoietic regions of Xenopus embryos, for example, a combination
of lineage tracing and gene expression experiments showed that both lineages
pass through a progenitor state in which they co-express blood and endothelial
genes (Ciau-Uitz et al., 2000;
Walmsley et al., 2002). The
co-development of both lineages and their requirement for the same genes begs
the question of which cues regulate their separate specification? Although a
number of growth factor signaling pathways, such as VEGF, TGFβ, BMP4 and
hedgehog, have been identified that are required directly or indirectly for
formation of both lineages (Dickson et
al., 1995; Winnier et al.,
1995; Carmeliet et al.,
1996; Ferrara et al.,
1996; Shalaby et al.,
1997; Dyer et al.,
2001; Vokes et al.,
2004; Gering and Patient,
2005), the extrinsic factors that regulate the fate separation
between these lineages remain largely unknown. A main conclusion of our study
is that Rspo3-Wnt/β-catenin signaling plays a key role in this process,
by promoting angioblast and inhibiting hematopoietic cell fate in
Xenopus ventral blood island (Fig.
8). The early embryonic expression of Rspo3 in the
gastrula ventrolateral mesoderm in Xenopus is consistent with this
proposition.
In support of our model, constitutive activation of Wnt/β-catenin
signaling has been shown to block hematopoietic cell differentiation in
transgenic mice (Kirstetter et al.,
2006; Scheller et al.,
2006). Furthermore, experiments with Wnt2-/- embryoid
bodies suggest that Wnt/β-catenin signaling is required for normal
endothelial maturation and vascular plexus formation, and that Wnt2 suppresses
hematopoietic differentiation in vitro
(Wang et al., 2007).
The molecular analysis indicates that an essential mediator of Rspo3 is its
immediate downstream target gene Vegf. In support of its crucial
role, VEGF in chicken progenitor cells reduces hematopoietic and induces
endothelial cell differentiation (Eichmann
et al., 1997). A role of VEGF in regulating angioblastic versus
hematopoietic cell fate decision is also corroborated by recent experiments in
Xenopus (Koibuchi et al.,
2006). As it acts upstream of the VEGF pathway, Rspo3 signaling
may be the earliest step regulating this hematopoietic lineage bifurcation in
the Xenopus vbi.
Our results indicating a negative role of VEGF in Scl expression
and blood cell specification are in contrast to a body of studies specifically
in mouse. For example, VegfR2-deficient mice lack both endothelial
and hematopoietic cells, suggesting that VEGF signaling is essential in a
common progenitor (Shalaby et al.,
1997). Other mouse data also indicate a requirement for VEGF
signaling for Scl expression and blood cell differentiation (reviewed
by Ferrara, 1999;
Tammela et al., 2005;
Olsson et al., 2006). The
reason for this discrepancy may be differences in the role of Scl and
VEGF in regions of embryonic and definitive hematopoiesis, respectively. In
mouse, Scl is a general hematopoietic marker expressed in common
precursors of blood and endothelial cells, and required for the development of
both lineages (Shivdasani et al.,
1995; Visvader et al.,
1998). Also in the Xenopus dorsal lateral plate and
anterior vbi, which are responsible for definitive hematopoiesis, Scl
and the endothelial marker xfli are co-expressed, suggestive of a
common precursor (Walmsley et al.,
2002). By contrast, in the Xenopus vbi, which give rise
to embryonic blood and which is the focus of our study, Scl is a red
blood lineage marker, the expression of which is mutually exclusive with the
endothelial marker xfli (Walmsley
et al., 2002) (compare Fig.
1I with Fig. 1K).
As our study focuses on Xenopus primitive hematopoiesis, the role of
Vegf and Scl may be different in organs of definitive
hematopoiesis. We note, however, that VEGF signaling in Scl
induction, primitive hematopoiesis and vasculogenesis is also not conserved
between mouse and either zebrafish or chicken
(Eichmann et al., 1997;
Habeck et al., 2002;
Patterson et al., 2005).
Rspo3, Wnt signaling and angiogenesis
The defects in mutant mice reveal that embryonic vasculature regulation is
a conserved function of Rspo3-Wnt/β-catenin signaling, albeit at a
different stage, namely in angiogenesis of the yolk sac and the placenta,
where it is required for endothelial cell proliferation and remodeling. This
is also supported by the pro-angiogenic effect of R-spondin signaling in adult
endothelial cells. Taken together with its endothelial expression, this
suggests an autocrine mode of Rspo3 signaling. Recently, it was shown that
VEGF also functions in an autocrine fashion in endothelial cells during
vascular development (Lee et al.,
2007). Indeed, the rather broad effect of Rspo3 on early
specification as well as later angiogenesis is reminiscent of VEGF, which
likewise plays a role not only during early hematopoietic cell specification,
but also during subsequent cell proliferation, vascular morphogenesis and
remodeling, both in the embryo and in the adult
(Ferrara 1999;
Coultas et al., 2005).
There is large evidence that Wnt signaling plays an important role in
angiogenesis. Wnt2, Wnt4 and Wnt7b mutant mice have reduced
embryonic or adult vasculature (Monkley et
al., 1996; Shu et al.,
2002; Jeays-Ward et al.,
2003). Likewise, Fz4 and Fz5 mutant mice show
defective angiogenesis (Ishikawa et al.,
2001; Xu et al.,
2004). The Fz4 mutation is also linked to human familial
exudative vitreoretinopathy (FEVR), which is caused by a failure of peripheral
retinal vascularization (Robitaille et
al., 2002). Mutations in norrin, which encoding a high
affinity Fz4 ligand, are also linked to FEVR
(Xu et al., 2004). However, in
most cases it remains unclear whether the angiogenic role revealed by these
Wnt/Fz mutants involves Wnt/β-catenin signaling. At least in vitro it is
the Wnt/β-catenin signaling pathway, which promotes endothelial cell
proliferation (reviewed by Zerlin et al.,
2008). Furthermore, Wnt/β-catenin signaling promotes
expression of Vegf (Zhang et al.,
2001), which is a direct β-catenin target gene
(Easwaran et al., 2003).
Consistent with this, we find that R-spondins also promote endothelial cell proliferation and in vitro angiogenesis by activating Wnt/β-catenin signaling, as it is inhibited by Dkk1. This effect is blocked by siVEGFR2, suggesting that, as in Xenopus and mouse embryos, R-spondins impact endothelial cells ultimately through VEGF signaling. However, in HUVEC, we were unable to observe upregulation of Vegf by Rspo2 treatment (data not shown), whereas in Xenopus and mouse embryos, Rspo3 was required for Vegf expression. This suggests that there may be different mechanisms underlying the promotion of VEGF signaling, endothelial proliferation and morphogenesis by Rspo3.
Finally, from a medical perspective, the identification of Rspo3 as a
secreted angiogenic factor may provide novel opportunities for pharmaceutical
intervention in angiogenic and antiangiogenic therapies (reviewed by
Ferrara, 1999;
Dor et al., 2003).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/22/3655/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Aoki, M., Mieda, M., Ikeda, T., Hamada, Y., Nakamura, H. and
Okamoto, H. (2006). R-spondin3 is required for mouse
placental development. Dev. Biol.
301,218
-226.[CrossRef][Medline]
Aoki, M., Kiyonari, H., Nakamura, H. and Okamoto, H.
(2008). R-spondin2 expression in the apical ectodermal ridge is
essential for outgrowth and patterning in mouse limb development.
Dev. Growth Differ. 50,85
-95.[Medline]
Bell, S. M., Schreiner, C. M., Wert, S. E., Mucenski, M. L.,
Scott, W. J. and Whitsett, J. A. (2008). R-spondin 2 is
required for normal laryngeal-tracheal, lung and limb morphogenesis.
Development 135,1049
-1058.
Blaydon, D. C., Ishii, Y., O'Toole, E. A., Unsworth, H. C., Teh,
M. T., Ruschendorf, F., Sinclair, C., Hopsu-Havu, V. K., Tidman, N., Moss, C.
et al. (2006). The gene encoding R-spondin 4 (RSPO4), a
secreted protein implicated in Wnt signaling, is mutated in inherited
anonychia. Nat. Genet.
38,1245
-1247.[CrossRef][Medline]
Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S.,
Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K.,
Eberhardt, C. et al. (1996). Abnormal blood vessel
development and lethality in embryos lacking a single VEGF allele.
Nature 380,435
-439.[CrossRef][Medline]
Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. and
Keller, G. (1998). A common precursor for hematopoietic and
endothelial cells. Development
125,725
-732.[Abstract]
Ciau-Uitz, A., Walmsley, M. and Patient, R.
(2000). Distinct origins of adult and embryonic blood in Xenopus.
Cell 102,787
-796.[CrossRef][Medline]
Cleaver, O. and Krieg, P. A. (1998). VEGF
mediates angioblast migration during development of the dorsal aorta in
Xenopus. Development
125,3905
-3914.[Abstract]
Cleaver, O., Tonissen, K. F., Saha, M. S. and Krieg, P. A.
(1997). Neovascularization of the Xenopus embryo. Dev.
Dyn. 210,66
-77.[CrossRef][Medline]
Cleaver, O., Seufert, D. W. and Krieg, P. A.
(2000). Endoderm patterning by the notochord: development of the
hypochord in Xenopus. Development
127,869
-879.[Abstract]
Coultas, L., Chawengsaksophak, K. and Rossant, J.
(2005). Endothelial cells and VEGF in vascular development.
Nature 438,937
-945.[CrossRef][Medline]
del Barco Barrantes, I., Davidson, G., Gröne, H. J.,
Westphal, H. and Niehrs, C. (2003). Dkk1 and noggin cooperate
in mammalian head induction. Genes Dev.
17,2239
-2244.
Devic, E., Paquereau, L., Vernier, P., Knibiehler, B. and
Audigier, Y. (1996). Expression of a new G protein-coupled
receptor X-msr is associated with an endothelial lineage in Xenopus laevis.
Mech. Dev. 59,129
-140.[CrossRef][Medline]
Dickson, M. C., Martin, J. S., Cousins, F. M., Kulkarni, A. B.,
Karlsson, S. and Akhurst, R. J. (1995). Defective
haematopoiesis and vasculogenesis in transforming growth factor-beta 1 knock
out mice. Development
121,1845
-1854.[Abstract]
Dor, Y., Djonov, V. and Keshet, E. (2003).
Making vascular networks in the adult: branching morphogenesis without a
roadmap. Trends Cell Biol.
13,131
-136.[CrossRef][Medline]
Dosch, R., Gawantka, V., Delius, H., Blumenstock, C. and Niehrs,
C. (1997). Bmp-4 acts as a morphogen in dorsoventral mesoderm
patterning in Xenopus. Development
124,2325
-2334.[Abstract]
Dyer, M. A., Farrington, S. M., Mohn, D., Munday, J. R. and
Baron, M. H. (2001). Indian hedgehog activates hematopoiesis
and vasculogenesis and can respecify prospective neurectodermal cell fate in
the mouse embryo. Development
128,1717
-1730.[Abstract]
Easwaran, V., Lee, S. H., Inge, L., Guo, L., Goldbeck, C.,
Garrett, E., Wiesmann, M., Garcia, P. D., Fuller, J. H., Chan, V. et al.
(2003). beta-Catenin regulates vascular endothelial growth factor
expression in colon cancer. Cancer Res.
63,3145
-3153.
Eichmann, A., Corbel, C., Nataf, V., Vaigot, P., Breant, C. and
Le Douarin, N. M. (1997). Ligand-dependent development of the
endothelial and hemopoietic lineages from embryonic mesodermal cells
expressing vascular endothelial growth factor receptor 2. Proc.
Natl. Acad. Sci. USA 94,5141
-5146.
Ferguson, J. E., 3rd, Kelley, R. W. and Patterson, C.
(2005). Mechanisms of endothelial differentiation in embryonic
vasculogenesis. Arterioscler. Thromb. Vasc. Biol.
25,2246
-2254.
Ferrara, N. (1999). Molecular and biological
properties of vascular endothelial growth factor. J. Mol.
Med. 77,527
-543.[CrossRef][Medline]
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L.,
O'Shea, K. S., Powell-Braxton, L., Hillan, K. J. and Moore, M. W.
(1996). Heterozygous embryonic lethality induced by targeted
inactivation of the VEGF gene. Nature
380,439
-442.[CrossRef][Medline]
Gawantka, V., Delius, H., Hirschfeld, K., Blumenstock, C. and
Niehrs, C. (1995). Antagonizing the Spemann organizer: role
of the homeobox gene Xvent-1. EMBO J.
14,6268
-6279.[Medline]
Gekas, C., Dieterlen-Lievre, F., Orkin, S. H. and Mikkola, H.
K. (2005). The placenta is a niche for hematopoietic stem
cells. Dev. Cell 8,365
-375.[CrossRef][Medline]
Gering, M. and Patient, R. (2005). Hedgehog
signaling is required for adult blood stem cell formation in zebrafish.
Dev. Cell 8,389
-400.[CrossRef][Medline]
Glinka, A., Wu, W., Onichtchouk, D., Blumenstock, C. and Niehrs,
C. (1997). Head induction by simultaneous repression of Bmp
and Wnt signalling in Xenopus. Nature
389,517
-519.[CrossRef][Medline]
Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C.
and Niehrs, C. (1998). Dickkopf-1 is a member of a new family
of secreted proteins and functions in head induction.
Nature 391,357
-362.[CrossRef][Medline]
Habeck, H., Odenthal, J., Walderich, B., Maischein, H. and
Schulte-Merker, S. (2002). Analysis of a zebrafish VEGF
receptor mutant reveals specific disruption of angiogenesis. Curr.
Biol. 12,1405
-1412.[CrossRef][Medline]
Hoppler, S., Brown, J. D. and Moon, R. T.
(1996). Expression of a dominant-negative Wnt blocks induction of
MyoD in Xenopus embryos. Genes Dev.
10,2805
-2817.
Huber, T. L., Zhou, Y., Mead, P. E. and Zon, L. I.
(1998). Cooperative effects of growth factors involved in the
induction of hematopoietic mesoderm. Blood
92,4128
-4137.
Huber, T. L., Kouskoff, V., Fehling, H. J., Palis, J. and
Keller, G. (2004). Haemangioblast commitment is initiated in
the primitive streak of the mouse embryo. Nature
432,625
-630.[CrossRef][Medline]
Ishikawa, T., Tamai, Y., Zorn, A. M., Yoshida, H., Seldin, M.
F., Nishikawa, S. and Taketo, M. M. (2001). Mouse Wnt
receptor gene Fzd5 is essential for yolk sac and placental angiogenesis.
Development 128,25
-33.[Abstract]
Jaffredo, T., Gautier, R., Eichmann, A. and Dieterlen-Lievre,
F. (1998). Intraaortic hemopoietic cells are derived from
endothelial cells during ontogeny. Development
125,4575
-4583.[Abstract]
Jaffredo, T., Gautier, R., Brajeul, V. and Dieterlen-Lievre,
F. (2000). Tracing the progeny of the aortic hemangioblast in
the avian embryo. Dev. Biol.
224,204
-214.[CrossRef][Medline]
Jeays-Ward, K., Hoyle, C., Brennan, J., Dandonneau, M., Alldus,
G., Capel, B. and Swain, A. (2003). Endothelial and
steroidogenic cell migration are regulated by WNT4 in the developing mammalian
gonad. Development 130,3663
-3670.
Kazanskaya, O., Glinka, A., Del Barco Barrantes, I., Stannek,
P., Niehrs, C. and Wu, W. (2004). R-Spondin2 is a secreted
activator of Wnt/beta-Catenin signaling and is required for xenopus
myogenesis. Dev. Cell 7,525
-534.[CrossRef][Medline]
Kennedy, M., Firpo, M., Choi, K., Wall, C., Robertson, S.,
Kabrun, N. and Keller, G. (1997). A common precursor for
primitive erythropoiesis and definitive haematopoiesis.
Nature 386,488
-493.[CrossRef][Medline]
Kennedy, M., D'Souza, S. L., Lynch-Kattman, M., Schwantz, S. and
Keller, G. (2007). Development of the hemangioblast defines
the onset of hematopoiesis in human ES cell differentiation cultures.
Blood 109,2679
-2687.
Kim, K. A., Kakitani, M., Zhao, J., Oshima, T., Tang, T.,
Binnerts, M., Liu, Y., Boyle, B., Park, E., Emtage, P. et al.
(2005). Mitogenic influence of human R-spondin1 on the intestinal
epithelium. Science 309,1256
-1259.
Kim, K. A., Wagle, M., Tran, K., Zhan, X., Dixon, M. A., Liu,
S., Gros, D., Korver, W., Yonkovich, S., Tomasevic, N. et al.
(2008). R-Spondin family members regulate the Wnt pathway by a
common mechanism. Mol. Biol. Cell
19,2588
-2596.
Kirkin, V., Mazitschek, R., Krishnan, J., Steffen, A.,
Waltenberger, J., Pepper, M. S., Giannis, A. and Sleeman, J. P.
(2001). Characterization of indolinones which preferentially
inhibit VEGF-C- and VEGF-D-induced activation of VEGFR-3 rather than VEGFR-2.
Eur. J. Biochem. 268,5530
-5540.[Medline]
Kirstetter, P., Anderson, K., Porse, B. T., Jacobsen, S. E. and
Nerlov, C. (2006). Activation of the canonical Wnt pathway
leads to loss of hematopoietic stem cell repopulation and multilineage
differentiation block. Nat. Immunol.
7,1048
-1056.[CrossRef][Medline]
Koibuchi, N., Taniyama, Y., Nagao, K., Ogihara, T., Kaneda, Y.
and Morishita, R. (2006). The effect of VEGF on blood vessels
and blood cells during Xenopus development. Biochem. Biophys. Res.
Commun. 344,339
-345.[CrossRef][Medline]
Korff, T. and Augustin, H. G. (1998).
Integration of endothelial cells in multicellular spheroids prevents apoptosis
and induces differentiation. J. Cell Biol.
143,1341
-1352.
Lee, S., Chen, T. T., Barber, C. L., Jordan, M. C., Murdock, J.,
Desai, S., Ferrara, N., Nagy, A., Roos, K. P. and Iruela-Arispe, M. L.
(2007). Autocrine VEGF signaling is required for vascular
homeostasis. Cell 130,691
-703.[CrossRef][Medline]
Logan, C. Y. and Nusse, R. (2004). The Wnt
signaling pathway in development and disease. Annu. Rev. Cell Dev.
Biol. 20,781
-810.[CrossRef][Medline]
Mao, B., Wu, W., Li, Y., Hoppe, D., Stannek, P., Glinka, A. and
Niehrs, C. (2001). LDL-receptor-related protein 6 is a
receptor for Dickkopf proteins. Nature
411,321
-325.[CrossRef][Medline]
Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P.,
Broccoli, V., Hassan, A. B., Volpin, D., Bressan, G. M. and Piccolo, S.
(2003). Mapping Wnt/beta-catenin signaling during mouse
development and in colorectal tumors. Proc. Natl. Acad. Sci.
USA 100,3299
-3304.
Mead, P. E., Kelley, C. M., Hahn, P. S., Piedad, O. and Zon, L.
I. (1998). SCL specifies hematopoietic mesoderm in Xenopus
embryos. Development
125,2611
-2620.[Abstract]
Monkley, S. J., Delaney, S. J., Pennisi, D. J., Christiansen, J.
H. and Wainwright, B. J. (1996). Targeted disruption of the
Wnt2 gene results in placentation defects. Development
122,3343
-3353.[Abstract]
Moore, M. A. and Metcalf, D. (1970). Ontogeny
of the haemopoietic system: yolk sac origin of in vivo and in
vitro colony forming cells in the developing mouse embryo. Br.
J. Haematol. 18,279
-296.[Medline]
Nakamura, K., Yamamoto, A., Kamishohara, M., Takahashi, K.,
Taguchi, E., Miura, T., Kubo, K., Shibuya, M. and Isoe, T.
(2004). KRN633: a selective inhibitor of vascular endothelial
growth factor receptor-2 tyrosine kinase that suppresses tumor angiogenesis
and growth. Mol. Cancer Ther.
3,1639
-1649.
Nam, J. S., Turcotte, T. J., Smith, P. F., Choi, S. and Yoon, J.
K. (2006). Mouse cristin/R-spondin family proteins are novel
ligands for the Frizzled 8 and LRP6 receptors and activate
beta-catenin-dependent gene expression. J. Biol. Chem.
281,13247
-13257.
Nishikawa, S. I., Nishikawa, S., Hirashima, M., Matsuyoshi, N.
and Kodama, H. (1998). Progressive lineage analysis by cell
sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of
endothelial and hemopoietic lineages. Development
125,1747
-1757.[Abstract]
Olsson, A. K., Dimberg, A., Kreuger, J. and Claesson-Welsh,
L. (2006). VEGF receptor signalling-in control of vascular
function. Nat. Rev. 7,359
-371.[CrossRef]
Ottersbach, K. and Dzierzak, E. (2005). The
murine placenta contains hematopoietic stem cells within the vascular
labyrinth region. Dev. Cell
8, 377-387.[CrossRef][Medline]
Parma, P., Radi, O., Vidal, V., Chaboissier, M. C., Dellambra,
E., Valentini, S., Guerra, L., Schedl, A. and Camerino, G.
(2006). R-spondin1 is essential in sex determination, skin
differentiation and malignancy. Nat. Genet.
38,1304
-1309.[CrossRef][Medline]
Patterson, L. J., Gering, M. and Patient, R.
(2005). Scl is required for dorsal aorta as well as blood
formation in zebrafish embryos. Blood
105,3502
-3511.
Red-Horse, K., Crawford, Y., Shojaei, F. and Ferrara, N.
(2007). Endothelium-microenvironment interactions in the
developing embryo and in the adult. Dev. Cell
12,181
-194.[CrossRef][Medline]
Risau, W. and Flamme, I. (1995).
Vasculogenesis. Annu. Rev. Cell Dev. Biol.
11, 73-91.[CrossRef][Medline]
Robitaille, J., MacDonald, M. L., Kaykas, A., Sheldahl, L. C.,
Zeisler, J., Dube, M. P., Zhang, L. H., Singaraja, R. R., Guernsey, D. L.,
Zheng, B. et al. (2002). Mutant frizzled-4 disrupts retinal
angiogenesis in familial exudative vitreoretinopathy. Nat.
Genet. 32,326
-330.[CrossRef][Medline]
Rossant, J. and Howard, L. (2002). Signaling
pathways in vascular development. Annu. Rev. Cell Dev.
Biol. 18,541
-573.[CrossRef][Medline]
Scheller, M., Huelsken, J., Rosenbauer, F., Taketo, M. M.,
Birchmeier, W., Tenen, D. G. and Leutz, A. (2006).
Hematopoietic stem cell and multilineage defects generated by constitutive
beta-catenin activation. Nat. Immunol.
7,1037
-1047.[CrossRef][Medline]
Schorpp-Kistner, M., Wang, Z. Q., Angel, P. and Wagner, E.
F. (1999). JunB is essential for mammalian placentation.
EMBO J. 18,934
-948.[CrossRef][Medline]
Shalaby, F., Ho, J., Stanford, W. L., Fischer, K. D., Schuh, A.
C., Schwartz, L., Bernstein, A. and Rossant, J. (1997). A
requirement for Flk1 in primitive and definitive hematopoiesis and
vasculogenesis. Cell 89,981
-990.[CrossRef][Medline]
Shivdasani, R. A., Mayer, E. L. and Orkin, S. H.
(1995). Absence of blood formation in mice lacking the T-cell
leukaemia oncoprotein tal-1/SCL. Nature
373,432
-434.[CrossRef][Medline]
Shu, W., Jiang, Y. Q., Lu, M. M. and Morrisey, E. E.
(2002). Wnt7b regulates mesenchymal proliferation and vascular
development in the lung. Development
129,4831
-4842.[Medline]
Tammela, T., Enholm, B., Alitalo, K. and Paavonen, K.
(2005). The biology of vascular endothelial growth factors.
Cardiovasc Res. 65,550
-563.
Ueno, H. and Weissman, I. L. (2006). Clonal
analysis of mouse development reveals a polyclonal origin for yolk sac blood
islands. Dev. Cell 11,519
-533.[CrossRef][Medline]
Visvader, J. E., Fujiwara, Y. and Orkin, S. H.
(1998). Unsuspected role for the T-cell leukemia protein
SCL/tal-1 in vascular development. Genes Dev.
12,473
-479.
Vogeli, K. M., Jin, S. W., Martin, G. R. and Stainier, D. Y.
(2006). A common progenitor for haematopoietic and endothelial
lineages in the zebrafish gastrula. Nature
443,337
-339.[CrossRef][Medline]
Vokes, S. A., Yatskievych, T. A., Heimark, R. L., McMahon, J.,
McMahon, A. P., Antin, P. B. and Krieg, P. A. (2004).
Hedgehog signaling is essential for endothelial tube formation during
vasculogenesis. Development
131,4371
-4380.
Walmsley, M., Ciau-Uitz, A. and Patient, R.
(2002). Adult and embryonic blood and endothelium derive from
distinct precursor populations which are differentially programmed by BMP in
Xenopus. Development
129,5683
-5695.[CrossRef][Medline]
Wang, H., Gilner, J. B., Bautch, V. L., Wang, D. Z., Wainwright,
B. J., Kirby, S. L. and Patterson, C. (2007). Wnt2
coordinates the commitment of mesoderm to hematopoietic, endothelial and
cardiac lineages in embryoid bodies. J. Biol. Chem.
282,782
-791.
Wei, Q., Yokota, C., Semenov, M. V., Doble, B., Woodgett, J. and
He, X. (2007). R-spondin1 is a high affinity ligand for LRP6
and induces LRP6 phosphorylation and beta-catenin signaling. J.
Biol. Chem. 282,15903
-15911.
Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L.
M. (1995). Bone morphogenetic protein 4 is required for
mesoderm formation and patterning in the mouse. Genes
Dev. 9,2105
-2116.
Xiong, J. W. (2008). Molecular and
developmental biology of the hemangioblast. Dev. Dyn.
237,1218
-1231.[CrossRef][Medline]
Xu, Q., Wang, Y., Dabdoub, A., Samllwood, P. M., Williams, J.,
Woods, C., Kelley, M. W., Jiang, L., Tasman, W., Zhang, K. et al.
(2004). Vascular development in the retina and inner ear: control
by Norrin and Frizzled-4, a high affinity ligand-receptor pair.
Cell 116,883
-895.[CrossRef][Medline]
Yang, H., Wanner, I. B., Roper, S. D. and Chaudhari, N.
(1999). An optimized method for in situ hybridization with signal
amplification that allows the detection of rare mRNAs. J.
Histochem. Cytochem. 47,431
-446.
Zeigler, B. M., Sugiyama, D., Chen, M., Guo, Y., Downs, K. M.
and Speck, N. A. (2006). The allantois and chorion, when
isolated before circulation or chorioallantoic fusion, have hematopoietic
potential. Development
133,4183
-4192.
Zerlin, M., Julius, M. A. and Kitajewski, J.
(2008). Wnt/Frizzled signaling in angiogenesis.
Angiogenesis 11,63
-69.[CrossRef][Medline]
Zhang, X., Gaspard, J. P. and Chung, D. C.
(2001). Regulation of vascular endothelial growth factor by the
Wnt and K-ras pathways in colonic neoplasia. Cancer
Res. 61,6050
-6054.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
C (well-secreted variant)
mRNA plus lineage tracer FLDx (fluorescence lysinated dextran), cultured until
stage 8 and treated with cycloheximide (CHX, 40 µg/ml) for 30 minutes.
Lower panel: `responder' uninjected animal caps were explanted at stage 8,
cultured until control siblings reached stage 15, and treated with or without
CHX (10 µg/ml) for 30 minutes. Responder animal caps were bissected,
sandwiched with or without animal cap of inducer embryos and cultivated for
another 3 hours to permit induction in the presence of CHX (10 µg/ml).
Responder animal tissues were harvested and analyzed by RT-PCR shown in D.
(D) Vegf induction is an immediate early response to
Wnt/R-spondin signaling. Uninjected animal caps (responders) were co-cultured
with fluorescently labeled animal caps injected with Wnt3a and
Rspo2 mRNA (inducers) as shown in C. Responder animal caps were
cultured until control siblings reached stage 15 and treated with or without
cycloheximide (CHX) for 3 hours. Responder animal caps were harvested
separately and analyzed by RT-PCR for the markers indicated. As a control for
the efficacy of CHX treatment, the (indirect) inhibition of keratin expression
by Wnt3a and Rspo2 (lanes 2-3) is blocked by CHX (lanes
4-9).
