|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 October 2008
doi: 10.1242/dev.024786
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 The Department of Cell Biology, Duke University Medical Center, Durham, NC
27710, USA.
2 The Department of Cellular Sociology, National Institute for Basic Biology,
Okazaki, Japan.
3 Molecular and Integrative Physiology, University of Illinois at Urbana
Champaign, IL 61801, USA.
* Author for correspondence (e-mail: b.capel{at}cellbio.duke.edu)
Accepted 15 September 2008
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-secretase activity or deleting
the downstream target gene Hairy/Enhancer-of-split 1, results in an
increase in Leydig cells in the testis. By contrast, constitutively active
Notch signaling in gonadal somatic progenitor cells causes a dramatic Leydig
cell loss, associated with an increase in undifferentiated mesenchymal cells.
These results indicate that active Notch signaling restricts fetal Leydig cell
differentiation by promoting a progenitor cell fate. Germ cell loss and
abnormal testis cord formation were observed in both gain- and
loss-of-function gonads, suggesting that regulation of the Leydig/interstitial
cell population is important for male germ cell survival and testis cord
formation.
Key words: Notch, Stem cells, Leydig cell, Germ cell, Testis cord, Hes1, Mouse
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
10.0 days post coitum
(dpc) with the thickening of the epithelial layer (the coelomic epithelium)
overlying the mesonephric tubules (Brennan
and Capel, 2004
). Expression of the Y chromosome gene Sry
in a subset of somatic progenitor cells initiates the differentiation of
Sertoli cells and leads to rapid morphological changes in the gonad.
Approximately 36-48 hours from the onset of Sry expression, a
well-organized testis structure is formed: Sertoli cells aggregate around germ
cells, segregating the tubular testis cords from the interstitial space.
Peritubular myoid cells tightly surround the outside of testis cords. The
interstitial region between testis cords contains steroid-secreting Leydig
cells, other uncharacterized mesenchymal cells and the vasculature, including
a characteristic coelomic vessel along the surface of the gonad. This
well-organized structure provides a supportive environment for male germ cell
development in fetal and adult life.
Fetal Leydig cells are first apparent in the testis at 12.5 dpc and their
number declines shortly after birth
(Habert et al., 2001). The
embryonic origin of Leydig cell precursors is not yet clear. Some evidence
suggests that precursors arise from the coelomic epithelium
(Brennan et al., 2003;
Karl and Capel, 1998), whereas
other evidence suggests that Leydig progenitors migrate from the mesonephros
into the gonad before 11.0 dpc and remain undifferentiated until 12.5 dpc
(Jeays-Ward et al., 2003). The
fetal Leydig cell population increases at least twofold before birth; however,
no mitotic activity has been detected in differentiated Leydig cells
(Byskov, 1986;
Kerr et al., 1988;
Migrenne et al., 2001;
Orth, 1982). The increase in
Leydig cell number has been attributed to differentiation of a population of
progenitor/stem cells located in the interstitium
(Orth, 1982). However, the
mechanism that controls mesenchymal stem cell differentiation and self-renewal
during Leydig cell development is unknown
(Habert et al., 2001).
Notch, a transmembrane receptor that mediates local communication between
cells, is involved in cell fate determination, particularly in stem cell
maintenance and differentiation in many animal systems
(Lai, 2004). For example,
Notch signaling restricts neural differentiation by repressing the expression
of proneural genes during Drosophila neural-epidermal fate decisions
(Parks et al., 1997). A
failure of Notch signaling causes all proneural cluster cells to express high
levels of proneural proteins and become neurons. Constitutive Notch signaling
has the opposite effect, and suppresses neural differentiation. During
mammalian embryogenesis, Notch signaling has been found to regulate progenitor
cell differentiation in both neuronal and pituitary development
(Jensen et al., 2000;
Raetzman et al., 2007), and to
regulate adult stem cell maintenance and differentiation in the hematopoietic
and intestinal stem cell systems (Duncan
et al., 2005; Fre et al.,
2005).
In mammals, four Notch receptors (Notch1-Notch4) interact with
structurally similar Notch ligands, delta-like 1 (also called
Delta1), delta-like 3, delta-like 4, jagged 1 and jagged 2. After
binding with its ligand, Notch is activated by -secretase-dependent
proteolysis within the transmembrane domain to release the Notch intracellular
domain (NICD) (De Strooper et al.,
1999; Huppert et al.,
2000; Schroeter et al.,
1998). Blocking -secretase function, for example, by use of
the -secretase inhibitor
N-[N-(3,5-difluorophenacetyl-L-alanyl]-S-phenylglycine-t-butyl Ester
(DAPT), has been shown to affect kidney development by blocking Notch activity
(Cheng et al., 2003). After
cleavage, NICD translocates into the nucleus and associates with the
constitutive DNA-binding protein CSL (after CBF1, suppressor of hairless and
Lag1) to activate transcription of downstream targets. The hairy/enhancer of
split genes, encoding the basic helix-loop-helix transcription factors Hes1
and Hes5, are the most well-defined targets of the NICD-CSL complex
(Kageyama et al., 2007).
Based on the expression of multiple Notch receptors and downstream targets in the gonad, we investigated whether Notch signaling is involved in gonadal somatic cell differentiation by analyzing gonads in which Notch signaling was gained or lost during testis development. Our findings indicate that Notch signaling regulates Leydig progenitor cell maintenance and differentiation during fetal life.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
Notch3lacZ mice, in which lacZ is recombined into
the Notch3 EGF repeat region, were generously provided by Drs Marc
Tessier-Lavigne and Bill Skarnes (Leighton
et al., 2001). Hes1+/- mice (generously
provided to L.R. by R. Kageyama, Kyoto University, Japan) were maintained on
C57BL/6 or mixed genetic backgrounds
(Ishibashi et al., 1995).
RosaNotch mice (generously provided by Douglas A. Melton,
Harvard University) (Murtaugh et al.,
2003) and Sf1-cre mice (generously provided by Keith L.
Parker, UTSMC) (Bingham et al.,
2006) were maintained on a hybrid 129; C57BL/6 background, and are
healthy and fertile as heterozygotes or homozygotes.
RosaNotch; Sf1-cre embryos were generated by
crossing a RosaNotch female with an Sf1-cre male
mouse. Hs-cre transgenic XY mice (generously provided by Argiris
Efstratiadis, Columbia) were crossed with RosaNotch, and
Cre expression was induced as described
(Dietrich et al., 2000).
Expression experiments were performed on random bred CD1 mice (Jackson
Laboratory). All experiments were conducted in accordance with the principles
and procedures outlined in the NIH Guidelines for the Care and Use of
Experimental Animals.
In situ hybridization, β-gal staining and immunocytochemistry
Gonads were dissected and fixed overnight in 4%
paraformaldehyde/phosphate-buffered saline (PFA-PBS). In situ hybridization
was performed as previously described on whole-mount tissue
(Nieto et al., 1992). RNA
antisense probes were made for Notch1 (1.8 kb), Notch2 (900
bp; intracellular domain), Notch3 (2.6 kb) and Notch4
(1.8 kb; intracellular domain) from plasmids kindly provided by Tom Gridley,
and for Hes1, Hes3 and Hes5, from plasmids kindly provided
by Tom Vogt. RNA probes were synthesized using the DIG RNA labeling kit
(Roche) following manufacturer's instructions. β-Gal staining was
performed as previously described (Yao et
al., 2002). Stained gonads were embedded, cryosectioned and imaged
with a Zeiss axiophot microscope. Immunocytochemistry was performed on
cryosections and whole-mount tissue as previously described
(Brennan et al., 2002).
Antibodies used were rabbit anti-3-HSD and rabbit anti-SF1 (the kind gifts of
Ken-ichirou Morohashi; both used at a dilution of 1:2000), rat anti-PECAM1
(Pharmingen, San Diego, CA, USA; 1:500), rabbit anti-laminin (the kind gift of
Harold Erikson, 1:500), rabbit anti-SOX9 (the kind gift of Francis Poulat,
1:1000), rabbit anti-cleaved caspase 3 (Cell Signaling, 1:500), rabbit
anti-SCP3 (Novus, 1:500), rabbit anti-GFP (Invitrogen, 1:1000), rabbit
anti-LHX9 (the kind gift of T. Jessell, Columbia, 1:2500) and
anti-β-galactosidase (1:2000, Cappel-ICN). Cy2-, Cy3- or Cy5-conjugated
secondary antibodies (Jackson ImmunoResearch) were used at a dilution of
1:500. DNA was stained with Syto13 (Invitrogen, 1:5000). Samples were mounted
in DABCO as described (Karl and Capel,
1998) and imaged on a Zeiss LSM510 confocal microscope. Each image
shown in the figures is representative of at least three sections of three
independent gonads.
Histology
Testes were dissected and fixed overnight in Bouin's fixative at 4°C.
Samples were then dehydrated and embedded in paraffin. Sections were cut (8
µm), and stained using standard Hematoxylin and Eosin procedures, mounted
and photographed using a Zeiss Axioplan 2 microscope. For immunostaining,
peroxidase-conjugated secondary antibodies and HistoMark BLACK Peroxidase
System kit (KPL) were used following the manufacturers' protocol. After
peroxidase staining, sections were stained with Hematoxylin and Eosin.
Organ culture
Genital ridges (11.5 dpc) were cultured in agar blocks at 37°C with 5%
CO2/95% air in 30 µl Dulbecco's Minimal Eagle Medium (DMEM) for
48 hours, supplemented with 10% fetal calf serum and 50 µg/ml ampicillin
(Martineau et al., 1997). DAPT
(Calbiochem, 100 µM final concentration) or DMSO was added to the
medium.
Statistical analysis
For each embryo, positive cells were counted on 10 evenly spaced sections
(10 µmx460.07 µmx460.07 µm) through the whole gonad, and
the total number of cells was calculated. For each genotype we present the
mean±s.e.m. of total cell numbers from at least three independent
gonads. The two-tailed P values were determined by using Student's
t-test. P<0.05 is considered statistically
significant.
Reverse transcription and quantitative PCR (QPCR)
Gonads were separated from the mesonephros and total RNA was isolated using
TRIzol (Invitrogen). Reverse transcription reactions were performed using the
IScript cDNA Synthesis Kit (BioRad). The BioRad MyiQ iCycler and SYBR Green
Supermix were used for performing the Q-PCR reaction. The iCycler software was
used for QPCR data analysis. Primers were as follows: hypoxanthine guanine
phosphoribosyl transferase 1 (Hprt1), TCAGTCAACGGGGGACATAAA and
GGGGCTGTACTGCTTAACCAG; Sox9, GCGGAGCTCAGCAAGACTCTG and
ATCGGGGTGGTCTTTCTTGTG; Amh, GGCTTCGGGCTCATCTTAACC and
TGAAACAGCGGGAATCAGAGC; Dhh, GCCTGATGACAGAGCGTTGC and
GAGTGAATCCTGTGCGTGGTG; Ptgds, GGCTCCTGGACACTA CACCT and
CTGGGTTCTGCTGTAGAGGGT; Pdgfra, TCCATGCTAGACTCAGAAGTCA and
TCCCGGTGGACACAATTTTTC; Pdgfa, GAGGAAGCCGAGATACCCC and
GGCACATGGTTAATGGCATGG; Lhx9, AGATGGAGCGCAGATCCAAG and
GCAGATAGTACCTGTCGGAGA; Arx, CAAGGATGGTGAGGACAGC and
TCTGGAACCACACCTGGACT; Ptch1, AAAGAACTGCGGCAAGTTTTTG and
CTTCTCCTATCTTCTGACGGGT; Cyp11a (Scc), TGGCCCCATTTACAGGGAGAA
and GGCATCTGAACTCTTAAACAGGA; and Cyp17a1, CAGAGAAGTGCTCGTGAAGAAG and
AGGAGCT ACTACTATCCGCAAA. Independent cDNA samples from 4 pairs of mutant and
control gonads were examined. Each PCR reaction was repeated 3 times. Gene
expression level was normalized to Hprt1 and compared using the
Student's t-test.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) (data
not shown). Notch2 expression was detected by mRNA in situ
hybridization (Fig. 1A,B), and
by using a lacZ reporter targeted to the Notch2 locus
(Notch2LacZ) (Fig.
1C,M-R) (Hamada et al.,
1999). Notch2 is expressed at higher levels in XY than in
XX gonads throughout these stages (see Fig. S1 in the supplementary material).
Using both methods, Notch2 was detected at low levels at 11.5 dpc
(Fig. 1A,M,P).
lacZ-positive cells (detected using an antibody against β-gal)
were found in the coelomic epithelium and in deeper layers of the XY gonad
(Fig. 1M,P). At 12.0 dpc,
Notch2 expression was localized to cells that are clustered around
groups of germ cells in the position of pre-Sertoli cells at the beginning of
testis cord development (Fig.
1N,Q). Using a histochemical X-gal detection method,
Notch2 was expressed in Sertoli cells inside testis cords at 12.5 dpc
(Fig. 1C). At 13.5 dpc,
Notch2 expression declined in Sertoli cells, and shifted to the
interstitium (Fig. 1O,R; see
Fig. S1G in the supplementary material). The Notch3 expression pattern was determined by in situ hybridization and X-gal staining of Notch3LacZ gonads. Notch3 was not detected in XX or XY gonads at 11.5 dpc (Fig. 1D; see Fig. S1D in the supplementary material). At 12.5-13.5 dpc, Notch3 was expressed in the interstitium of the XY gonad and at relatively lower levels in XX gonads (Fig. 1E,F; see Fig. S1E,F in the supplementary material). β-Gal activity was never detected inside testis cords at any stages examined, suggesting that Notch3 is not expressed in Sertoli cells or their progenitors, but overlaps with Notch2 expression after 12.5 dpc (Fig. 1E,F; see Fig. S1G,H in the supplementary material).
|
Blocking Notch signaling via a -secretase inhibitor promotes Leydig cell differentiation in XY gonads
To investigate Notch function, we cultured XY gonads with the
-secretase inhibitor DAPT to block the Notch signaling pathway. Mouse
embryonic gonads (11.5 dpc) were cultured for 2 days in DMEM with DAPT or DMSO
as a control. Cultured male gonads stained with antibodies against SOX9 (a
marker of Sertoli cells) and PECAM1 (a marker of endothelial cells and germ
cells) appeared normal, with a male-specific coelomic vessel and organized
testis cords (Fig. 2A,B).
However, when treated and untreated gonads were stained with an antibody
against 3β-HSD (3beta-hydroxysteroid dehydrogenase) to detect
differentiated Leydig cells, Leydig cell numbers were significantly increased
(138%; n=8 gonads; P<0.001) in DAPT treated gonads
compared with DMSO controls (Fig.
2C-E) (n=8). By contrast, Sertoli cell numbers were equal
to those in the DMSO control but decreased with respect to the DAPT-treated
gonads (Fig. 2A,B,E)
(n=3 gonads; P=0.1792). This result suggests that Notch
signaling specifically restricts Leydig cell differentiation.
Increase of Leydig cell numbers in Hes1-/- XY gonads
To investigate whether the effects of Notch signaling on Leydig cell
development are mediated through the transcriptional repressor Hes1,
we analyzed Hes1-/- mouse gonads using antibodies against
SOX9, PECAM1 and 3β-HSD. In both Hes1+/- and
wild-type littermates, germ cells and Sertoli cells were well organized into
testis cords, with Leydig cells and vessels located between the cords. In
Hes1-/- male gonads, SOX9-positive and 3-HSD-positive
cells were present in the testis at the appropriate stages, 11.5 dpc (data not
shown) and 13.5 dpc (Fig.
2F-J), indicating that Hes1 is not required for
initiation of Sertoli or Leydig cell differentiation. However, Leydig cell
numbers significantly increased in Hes1-/- gonads relative
to wild-type controls (Fig.
2H-J) (47%; n=3 gonads; P=0.039). By contrast,
Sertoli cell numbers were relatively normal
(Fig. 2F,G,J) (n=3
gonads; P=0.2138).
Both the in vitro and in vivo disruption of Notch signaling caused an increase in Leydig cell number, indicating that the Notch-Hes1 pathway normally functions to restrict Leydig cell differentiation from progenitor cells during testis development. The discrepancy between these two experiments may result from the fact that the inhibitor blocks all Notch signaling, whereas loss of Hes1 disrupts only one downstream pathway.
Notch signaling inhibits Leydig cell development
To test our hypothesis further, we developed a gain-of-function assay using
RosaNotch; Sf1-cre mice. In
RosaNotch mice
(Murtaugh et al., 2003), the
NICD transgene and an EGFP reporter are targeted to the Rosa locus
behind a floxed transcriptional STOP sequence. Expression of NICD and EGFP is
constitutively activated when Cre recombinase deletes the floxed STOP
fragment. Previous studies have shown that Cre recombinase activity in
Sf1-cre mice reflects the endogenous SF1 expression pattern in
gonadal somatic cells beginning at 11.5 dpc
(Bingham et al., 2006;
Kim et al., 2007). To verify
the timing and cell-specificity of Cre expression in
RosaNotch; Sf1-cre gonads, we used antibodies
against Cre recombinase, and antibodies against GFP to detect NICD expression.
Although NICD-GFP was not detected above background at 10.5 dpc, nuclear
accumulation occurred by 11.5 dpc in many somatic cells, and expression was
detected in differentiated Sertoli and Leydig cells at all later stages
examined (see Fig. S2 in the supplementary material and data not shown).
|
By contrast, based on antibody staining, the number of 3β-HSD and SF-1-positive cells significantly decreased in RosaNotch; Sf1-cre XY gonads at 13.5 dpc compared with wild type or mice with only one of the two transgenes (Fig. 4A-D; see Fig. S2F,G in the supplementary material). To determine whether the decrease in Leydig cell number is due to apoptosis, we stained the gonad with an antibody against caspase 3. We observed no significant increase in apoptosis in the gonads of RosaNotch; Sf1-cre mice (Fig. 4E,F) (n=9 sections from three independent gonads of each genotype; P=0.7813).
An alternative explanation for the reduction in Leydig cell numbers is that
Leydig cells fail to differentiate when Notch is activated in progenitors. To
investigate this possibility, we stained with an antibody against LIM homeobox
gene 9 (Lhx9). LHX9 is essential for the initial formation of the
gonad and is expressed in somatic progenitors in the epithelium and subjacent
mesenchymal cells at the earliest stages of gonad formation (see Fig. S3A in
the supplementary material) (Birk et al.,
2000). At 13.5 dpc and later stages, some LHX9-positive cells are
normally detected in the coelomic domain and in the interstitial space between
cords (see Fig. S3B in the supplementary material), suggesting that some cells
maintain undifferentiated characteristics during gonad development. The number
of LHX9-positive progenitor cells was increased in
RosaNotch; Sf1-cre male gonads at 13.5 dpc
(Fig. 4G,H) (n=9
sections from three independent gonads; P<0.01), whereas the
number of differentiated Leydig cells was reduced based on expression of
3β-HSD (Fig. 4I,J)
(n=9 sections from three independent gonads; P<0.01),
suggesting that upregulation of Notch signaling promotes the maintenance of
progenitor cells, and restricts their differentiation into Leydig cells
(Fig. 4K).
Undifferentiated progenitors in RosaNotch; Sf1-cre gonads are maintained throughout embryonic development
One possible explanation for the increase in numbers of LHX9-positive cells
at 13.5 dpc is that Notch signaling causes a developmental delay in the gonad,
which is resolved at later stages. To test this possibility, we allowed
RosaNotch; Sf1-cre embryos to develop until after
birth. At postnatal day (P) 1, investigation of the Leydig cell population
using antibodies against 3β-HSD indicated that Leydig cell
differentiation was not restored in RosaNotch;
Sf1-cre testes, although testis development had proceeded
(Fig. 5A,B). Histological
staining with Hematoxylin-Eosin revealed an increase of spindle-shaped
interstitial mesenchymal cells in the RosaNotch;
Sf1-cre testis when compared with wild type, where typical Leydig
cells can be easily recognized by their cell shape and staining pattern
(Fig. 5C,D). A spindle-shaped
cell of similar description has been identified as the adult Leydig stem cell
(Ariyaratne and Chamindrani
Mendis-Handagama, 2000;
Davidoff et al., 2004;
Kerr et al., 1988). The
increase of spindle shaped mesenchymal cells was also correlated with an
increase of LHX9-positive cells (Fig.
5E,F). Many of the LHX9-positive cells were also constitutively
expressing NICD at P1 in RosaNotch; Sf1-cre
testes (Fig. 5G,H), suggesting
that constitutive Notch signaling in some interstitial progenitor cells
maintains their undifferentiated state and prevents their differentiation into
Leydig cells throughout fetal development. The gain-of-function mutant
(RosaNotch; Sf1-cre) has a relatively small
epididymis and descent of the testes is partial at P1. As expected, we did not
detect a defect in male reproductive tract development in Hes1 mutant
embryos (where excessive Leydig cells differentiate).
|
Sertoli cell markers were not significantly different in RosaNotch; Sf1-cre gonads, but markers of differentiated Leydig cells were significantly downregulated
To investigate the interaction between the Notch pathway and other
molecules and pathways involved in gonad development, gene expression profiles
were compared between 13.5 dpc RosaNotch; Sf1-cre
and control testes by Q-RT-PCR (Fig.
6). Sertoli cell-specific genes, such as Sox9
(P=0.0534), Dhh (P=0.7942), Pdgfa
(P=0.964) and Ptgds (P=0.4774) were expressed at
similar levels to wild-type controls. Only Amh was downregulated
(P=0.0323). This result is consistent with the observation that
RosaNotch; Sf1-cre gonads exhibit normal Sertoli
cell histology and SOX9 immunostaining (see Figs
3 and
5). Two genes specific to
differentiated Leydig cells, Scc and Cyp17a1, were
significantly downregulated in the mutant testes (P=0.0057 and 0.0046
respectively), as expected from the observed Leydig cell loss. By contrast,
the interstitial cell gene, Lhx9, which is not expressed in
differentiated Leydig cells, was significantly increased in
RosaNotch; Sf1-cre gonads (P=0.0212),
consistent with the observed increase in undifferentiated progenitor cells in
these gonads (see Figs 4 and
5). Expression of Arx,
Pdgfra and Ptch1 in interstitial cells has been reported
previously, and shown to be important for Leydig cell differentiation
(Brennan et al., 2003;
Kitamura et al., 2002;
Yao et al., 2002); however,
their cell-type specificity is not known. Expression levels of these genes
were not significantly different in RosaNotch;
Sf1-cre gonads (P=0.0881, 0.2915 and 0.5526, respectively),
suggesting that they are likely to be expressed in progenitor cells and are
not repressed by Notch signaling.
Testis cord formation and germ cell survival are affected by both gain and loss of Notch signaling
In the XY gonad, peritubular myoid cells surround Sertoli and germ cells to
form testis cords bounded by a basal lamina. Although testis cords formed in
both Hes1-/- and RosaNotch;
Sf1-cre gonads, both SOX9 and laminin staining revealed that they
were smaller and irregularly shaped compared with wild type, despite the fact
that Sertoli cell differentiation appeared to occur normally
(Fig. 7A-F). Additionally, a
significant germ cell loss was found in XY RosaNotch;
Sf1-cre gonads at later stages, based on both histological staining
and immunofluorescent staining with germ cell nuclear antigen 1 (GCNA1)
(Fig. 7G-J)
(P<0.001; n=3). Activated caspase 3 was present in the
interior of testis cords, suggesting germ cells undergo apoptosis at P1 (see
Fig. S4 in the supplementary material). In Hes1-/- mice
with increased Leydig cell numbers, there was also a significant male-specific
germ cell loss on the C57BL/6 background at 13.5 dpc
(Fig. 7K,L, compare also
Fig. 2F,G) (n=3;
P<0.001), despite the fact that Hes1 is not expressed in
Sertoli or germ cells. No obvious germ cell loss was observed in XX mutant
gonads, suggesting that the effect of Hes1 on germ cell numbers
occurs after sexually dimorphic development of germ cells begins in the
gonads. These findings imply that Leydig cells or their progenitors have
functions that strongly affect both testis cord formation and germ cell
maintenance in the XY gonad.
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; Orth, 1982).
By contrast, cell division is rarely detected among differentiated Leydig
cells, implying that the increase in differentiated Leydig cell numbers during
gonad growth relies on recruitment from an undifferentiated progenitor pool of
cells in the interstitial compartment that continuously proliferate and
differentiate (Orth, 1982).
Our results strongly support this model and suggest that Notch signaling
regulates fetal Leydig progenitor cell maintenance.
|
|
|
). Based on the
early expression patterns of Notch2 and Hes5 in Sertoli
progenitors, we hypothesized that Notch was involved in the fate decision that
gives rise to Sertoli cells, possibly by regulating an asymmetric division of
a progenitor of both the Sertoli and Leydig cell lineages. However, in these
experiments, constitutively active Notch driven by Sf1-cre
(RosaNotch; Sf1-cre) restricts the differentiation of
Leydig cells from the progenitor pool, but does not significantly affect
establishment of the Sertoli cell population, suggesting that Notch signaling
does not control a potential Leydig versus Sertoli cell fate decision at any
of the stages we studied. We found that Leydig cell differentiation cannot be
disrupted by constitutive expression of Notch after 13.5 dpc, suggesting that
only undifferentiated progenitor cells are responsive to active Notch
signaling. It is possible that Sertoli cell commitment is established prior to
the accumulation of NICD using Sf1-cre as an activator. Although it
has been shown that Cre recombinase activity starts as early as 10.5 dpc in
Sf1-cre mice (Bingham et al.,
2006), we did not detect NICD-GFP expression in
RosaNotch; Sf1-cre at 10.5 dpc (see Fig. S2A in the
supplementary material). Mouse strain background or the recombination and
transcriptional efficiency of NICD-GFP could delay the accumulation of nuclear
NICD-GFP in our experiments.
Instead of an increase in the number of Sertoli cells, there was an
increase of spindle-shaped LHX9-positive mesenchymal cells in the interstitium
of RosaNotch; Sf1-cre testes. LHX9 is expressed in the
epithelium and the interstitial mesenchyme in the primordial gonad at very
early stages (9.5-11.5 dpc), and is maintained in some interstitial cells
throughout male gonad development (Mazaud
et al., 2002). Because the Lhx9-null mutant gonads fail
to develop, and regress completely by 13.0 dpc
(Birk et al., 2000;
Mazaud et al., 2002), a later
role for Lhx9 in maintaining interstitial progenitor cells has not
been tested. Lhx2, the closest homolog of Lhx9, is expressed
in hair follicle stem cells, and regulates the maintenance of this population
(Rhee et al., 2006).
Lhx9 may have a similar function in the maintenance of the gonadal
progenitor cell pool.
In adult testes, interstitial mesenchymal cells have been identified as
progenitors for Leydig cells in immunohistological studies and in the ethane
dimethane sulfonate (EDS)-treated adult rat testis during regeneration of
Leydig cells (Davidoff et al.,
2004). Based on our results, we hypothesize that mesenchymal
Leydig stem/progenitor cells arise in the gonad at early stages. Some of these
cells differentiate into fetal Leydig cells during embryonic gonad
development, and others retain their undifferentiated characteristics and
serve as precursor/stem cells for the expansion of Leydig cells during
postnatal testis development (Habert et
al., 2001). It has been recognized that fetal Leydig cells do not
give rise to adult Leydig cells. However, it is not clear whether the same
stem/progenitor cell population that gives rise to fetal Leydig cells also
gives rise to adult Leydig cells. It is possible that the stem cell population
established at fetal stages enters a quiescent phase after birth, and becomes
active again prior to puberty to establish and maintain the adult Leydig cell
population. An appropriate cell lineage tracing experiment will be needed to
prove this hypothesis. Even if the fetal and adult Leydig stem/progenitor
population is the same, the mechanisms of self-renewal and differentiation may
be different at fetal and adult stages. A conditional block or activation of
Notch signaling in adult Leydig stem cells will uncover whether Notch also
regulates adult stem cell maintenance and Leydig differentiation.
Some steroidogenic markers of Leydig cell progenitors appear in the gonad
as early as 12.5 dpc, suggesting that the first wave of Leydig cell fate
commitment might occur as early as 11.5 dpc
(Val et al., 2006). This may
be the reason why a gain-of-Notch-function did not completely abolish the
differentiated Leydig cell population: perhaps some progenitors are committed
to Leydig cell differentiation prior to the stage when Sf1-cre is
active and NICD accumulates. Further experiments are needed to clarify this
possibility.
Notch2 and Notch3 are expressed in an overlapping pattern
in the interstitial compartment. Mice mutant for Notch3 appear normal
(Krebs et al., 2003). As
Notch2-/- mice are embryonic lethal, we examined
Notch2 function using a Notch2 hypomorphic mutant
Notch2del/del
(McCright et al., 2001) and
conditional allele Notch2flox/-
(Saito et al., 2003) crossed
with the Sf1-cre or Hs-cre line to conditionally delete
Notch2 in SF1-positive somatic cells or throughout the gonad.
However, no difference was observed between wild-type and mutant gonads, which
may reflect a redundancy between Notch receptors. We have not identified the
ligand responsible for Notch signaling to Leydig precursors. Jagged 1
(Jag1) is expressed in the interstitium
(Brennan et al., 2002), and is
a good candidate. As Jag1-null mutants are embryonic lethal, a
conditional allele will be necessary for a functional approach
(High et al., 2008). Jagged 2
is expressed in the XY specific coelomic vessel and its branches as reported
previously (Brennan et al.,
2002). Other ligands, delta-like 1, delta-like 3 and delta-like 4,
are also expressed in XY gonads at 11.5 and 12.5 dpc
(Nef et al., 2005) (data not
shown). Further expression and functional analysis will be necessary to
identify the ligands that activate the Notch pathway in Leydig progenitor
cells.
|
;
Jost et al., 1973). Our data
strongly suggest that Leydig cells also have an important impact on germ cell
survival and testis cord structure. In gonads with either an increase or a
decrease in Leydig cell number, we observed germ cell loss and cord structure
disruptions. This is consistent with loss of function mutants of Dhh
(Pierucci-Alves et al., 2001;
Yao et al., 2002) and
Pdgfra (Brennan et al.,
2003) in which Leydig cells were lost, and cord structure was also
affected. Germ cell loss was also observed in Dhh mutant gonads
(Clark et al., 2000;
Yao et al., 2002). In
Dhh mutants, it was possible that testis cord and germ cell defects
were caused by defects in Sertoli cells, which express Dhh and are
known to be important for aggregation of germ cells into testis cords
(Clark et al., 2000). As both
Sertoli and Leydig progenitor cells activate Notch signaling in the
RosaNotch; Sf1-cre gonad, it is possible that
defects from either or both of them affect cord structure and germ cell
survival in the gain-of-function mutants. However, this cannot be the case in
Hes1 loss-of-function mutants as no Hes1 expression was
detected in Sertoli or germ cells. These results support the idea that Leydig
cells, and perhaps the number, types and distribution of other interstitial
cells, have an impact on shaping cord structure and on the survival of male
germ cells. It is possible that Notch signaling directly regulates the
interaction between Sertoli and interstitial cells (including peritubular
myoid cells or other interstitial progenitors), or that abnormal Leydig cell
development indirectly affects cord formation. Overall, our results strongly support the presence of Leydig progenitor cells in the mouse embryonic testis, and uncover the molecular mechanism that regulates maintenance of these cells. Leydig cells play a crucial role during spermatogenesis in adult life. Our data strongly imply that Leydig cells or their progenitors are also important for germ cell survival and cord formation during fetal life. This study may shed light on the function of Notch signaling in the regulation of progenitor/stem cell populations in other systems, and could lead to therapeutic approaches to regulate Leydig cell number in adolescent and adult life.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/22/3745/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Ariyaratne, H. B. and Chamindrani Mendis-Handagama, S.
(2000). Changes in the testis interstitium of Sprague Dawley rats
from birth to sexual maturity. Biol. Reprod.
62,680
-690.
Baker, P. J. and O'Shaughnessy, P. J. (2001). Role of gonadotrophins in regulating numbers of Leydig and Sertoli cells during fetal and postnatal development in mice. Reproduction 122,227 -234.[Abstract]
Bingham, N. C., Verma-Kurvari, S., Parada, L. F. and Parker, K. L. (2006). Development of a steroidogenic factor 1/Cre transgenic mouse line. Genesis 44,419 -424.[CrossRef][Medline]
Birk, O. S., Casiano, D. E., Wassif, C. A., Cogliati, T., Zhao, L., Zhao, Y., Grinberg, A., Huang, S., Kreidberg, J. A., Parker, K. L. et al. (2000). The LIM homeobox gene Lhx9 is essential for mouse gonad formation. Nature 403,909 -913.[CrossRef][Medline]
Brennan, J. and Capel, B. (2004). One tissue, two fates: molecular genetic events that underlie testis versus ovary development. Nat. Rev. Genet. 5, 509-521.[Medline]
Brennan, J., Karl, J. and Capel, B. (2002). Divergent vascular mechanisms downstream of Sry establish the arterial system in the XY gonad. Dev. Biol. 244,418 -428.[CrossRef][Medline]
Brennan, J., Tilmann, C. and Capel, B. (2003).
Pdgfr-alpha mediates testis cord organization and fetal Leydig cell
development in the XY gonad. Genes Dev.
17,800
-810.
Byskov, A. G. (1986). Differentiation of
mammalian embryonic gonad. Physiol. Rev.
66, 71-117.
Cheng, H. T., Miner, J. H., Lin, M., Tansey, M. G., Roth, K. and
Kopan, R. (2003). Gamma-secretase activity is dispensable for
mesenchyme-to-epithelium transition but required for podocyte and proximal
tubule formation in developing mouse kidney.
Development 130,5031
-5042.
Clark, A. M., Garland, K. K. and Russell, L. D.
(2000). Desert hedgehog (Dhh) gene is required in the
mouse testis for formation of adult-type Leydig cells and normal development
of peritubular cells and seminiferous tubules. Biol.
Reprod. 63,1825
-1838.
Davidoff, M. S., Middendorff, R., Enikolopov, G., Riethmacher,
D., Holstein, A. F. and Muller, D. (2004). Progenitor cells
of the testosterone-producing Leydig cells revealed. J. Cell
Biol. 167,935
-944.
De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J. et al. (1999). A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398,518 -522.[CrossRef][Medline]
Dietrich, P., Dragatsis, I., Xuan, S., Zeitlin, S. and Efstratiadis, A. (2000). Conditional mutagenesis in mice with heat shock promoter-driven cre transgenes. Mamm. Genome 11,196 -205.[CrossRef][Medline]
Duncan, A. W., Rattis, F. M., DiMascio, L. N., Congdon, K. L., Pazianos, G., Zhao, C., Yoon, K., Cook, J. M., Willert, K., Gaiano, N. et al. (2005). Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat. Immunol. 6, 314-322.[CrossRef][Medline]
Fre, S., Huyghe, M., Mourikis, P., Robine, S., Louvard, D. and Artavanis-Tsakonas, S. (2005). Notch signals control the fate of immature progenitor cells in the intestine. Nature 435,964 -968.[CrossRef][Medline]
Geissler, W. M., Davis, D. L., Wu, L., Bradshaw, K. D., Patel, S., Mendonca, B. B., Elliston, K. O., Wilson, J. D., Russell, D. W. and Andersson, S. (1994). Male pseudohermaphroditism caused by mutations of testicular 17 beta-hydroxysteroid dehydrogenase 3. Nat. Genet. 7,34 -39.[CrossRef][Medline]
Habert, R., Lejeune, H. and Saez, J. M. (2001). Origin, differentiation and regulation of fetal and adult Leydig cells. Mol. Cell Endocrinol. 179, 47-74.[CrossRef][Medline]
Hamada, Y., Kadokawa, Y., Okabe, M., Ikawa, M., Coleman, J. R. and Tsujimoto, Y. (1999). Mutation in ankyrin repeats of the mouse Notch2 gene induces early embryonic lethality. Development 126,3415 -3424.[Abstract]
High, F. A., Lu, M. M., Pear, W. S., Loomes, K. M., Kaestner, K.
H. and Epstein, J. A. (2008). Endothelial expression of the
Notch ligand Jagged1 is required for vascular smooth muscle development.
Proc. Natl. Acad. Sci. USA
105,1955
-1959.
Huppert, S. S., Le, A., Schroeter, E. H., Mumm, J. S., Saxena, M. T., Milner, L. A. and Kopan, R. (2000). Embryonic lethality in mice homozygous for a processing-deficient allele of Notch1. Nature 405,966 -970.[CrossRef][Medline]
Ishibashi, M., Ang, S. L., Shiota, K., Nakanishi, S., Kageyama,
R. and Guillemot, F. (1995). Targeted disruption of mammalian
hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural
helix-loop-helix factors, premature neurogenesis, and severe neural tube
defects. Genes Dev. 9,3136
-3148.
Jeays-Ward, K., Hoyle, C., Brennan, J., Dandonneau, M., Alldus,
G., Capel, B. and Swain, A. (2003). Endothelial and
steroidogenic cell migration are regulated by WNT4 in the developing mammalian
gonad. Development 130,3663
-3670.
Jensen, J., Pedersen, E. E., Galante, P., Hald, J., Heller, R. S., Ishibashi, M., Kageyama, R., Guillemot, F., Serup, P. and Madsen, O. D. (2000). Control of endodermal endocrine development by Hes-1. Nat. Genet. 24, 36-44.[CrossRef][Medline]
Jost, A., Vigier, B., Prepin, J. and Perchellet, J. P. (1973). Studies on sex differentiation in mammals. Recent Prog. Horm. Res. 29, 1-41.[Medline]
Kageyama, R., Ohtsuka, T. and Kobayashi, T.
(2007). The Hes gene family: repressors and oscillators that
orchestrate embryogenesis. Development
134,1243
-1251.
Karl, J. and Capel, B. (1998). Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev. Biol. 203,323 -333.[CrossRef][Medline]
Kerr, J. B., Risbridger, G. P. and Knell, C. M. (1988). Stimulation of interstitial cell growth after selective destruction of foetal Leydig cells in the testis of postnatal rats. Cell Tissue Res. 252,89 -98.[Medline]
Kim, Y., Bingham, N., Sekido, R., Parker, K. L., Lovell-Badge,
R. and Capel, B. (2007). Fibroblast growth factor receptor 2
regulates proliferation and Sertoli differentiation during male sex
determination. Proc. Natl. Acad. Sci. USA
104,16558
-16563.
Kitamura, K., Yanazawa, M., Sugiyama, N., Miura, H., Iizuka-Kogo, A., Kusaka, M., Omichi, K., Suzuki, R., Kato-Fukui, Y., Kamiirisa, K. et al. (2002). Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans. Nat. Genet. 32,359 -369.[CrossRef][Medline]
Krebs, L. T., Xue, Y., Norton, C. R., Sundberg, J. P., Beatus, P., Lendahl, U., Joutel, A. and Gridley, T. (2003). Characterization of Notch3-deficient mice: normal embryonic development and absence of genetic interactions with a Notch1 mutation. Genesis 37,139 -143.[CrossRef][Medline]
Lai, E. C. (2004). Notch signaling: control of
cell communication and cell fate. Development
131,965
-973.
Leighton, P. A., Mitchell, K. J., Goodrich, L. V., Lu, X., Pinson, K., Scherz, P., Skarnes, W. C. and Tessier-Lavigne, M. (2001). Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature 410,174 -179.[CrossRef][Medline]
Martineau, J., Nordqvist, K., Tilmann, C., Lovell-Badge, R. and Capel, B. (1997). Male-specific cell migration into the developing gonad. Curr. Biol. 7, 958-968.[CrossRef][Medline]
Mazaud, S., Oreal, E., Guigon, C. J., Carre-Eusebe, D. and Magre, S. (2002). Lhx9 expression during gonadal morphogenesis as related to the state of cell differentiation. Gene Expr. Patterns 2,373 -377.[CrossRef][Medline]
McCright, B., Gao, X., Shen, L., Lozier, J., Lan, Y., Maguire, M., Herzlinger, D., Weinmaster, G., Jiang, R. and Gridley, T. (2001). Defects in development of the kidney, heart and eye vasculature in mice homozygous for a hypomorphic Notch2 mutation. Development 128,491 -502.[Abstract]
Migrenne, S., Pairault, C., Racine, C., Livera, G., Geloso, A. and Habert, R. (2001). Luteinizing hormone-dependent activity and luteinizing hormone-independent differentiation of rat fetal Leydig cells. Mol. Cell Endocrinol. 172,193 -202.[CrossRef][Medline]
Murtaugh, L. C., Stanger, B. Z., Kwan, K. M. and Melton, D.
A. (2003). Notch signaling controls multiple steps of
pancreatic differentiation. Proc. Natl. Acad. Sci. USA
100,14920
-14925.
Nef, S., Schaad, O., Stallings, N. R., Cederroth, C. R., Pitetti, J. L., Schaer, G., Malki, S., Dubois-Dauphin, M., Boizet-Bonhoure, B., Descombes, P. et al. (2005). Gene expression during sex determination reveals a robust female genetic program at the onset of ovarian development. Dev. Biol. 287,361 -377.[Medline]
Nieto, M. A., Gilardi-Hebenstreit, P., Charnay, P. and Wilkinson, D. G. (1992). A receptor protein tyrosine kinase implicated in the segmental patterning of the hindbrain and mesoderm. Development 116,1137 -1150.[Abstract]
Orth, J. M. (1982). Proliferation of Sertoli cells in fetal and postnatal rats: a quantitative autoradiographic study. Anat. Rec. 203,485 -492.[CrossRef][Medline]
Parks, A. L., Huppert, S. S. and Muskavitch, M. A. (1997). The dynamics of neurogenic signalling underlying bristle development in Drosophila melanogaster. Mech Dev 63, 61-74.[CrossRef][Medline]
Pierucci-Alves, F., Clark, A. M. and Russell, L. D.
(2001). A developmental study of the Desert hedgehog-null mouse
testis. Biol. Reprod.
65,1392
-1402.
Raetzman, L. T., Cai, J. X. and Camper, S. A. (2007). Hes1 is required for pituitary growth and melanotrope specification. Dev. Biol. 304,455 -466.[CrossRef][Medline]
Rhee, H., Polak, L. and Fuchs, E. (2006). Lhx2
maintains stem cell character in hair follicles.
Science 312,1946
-1949.
Saito, T., Chiba, S., Ichikawa, M., Kunisato, A., Asai, T., Shimizu, K., Yamaguchi, T., Yamamoto, G., Seo, S., Kumano, K. et al. (2003). Notch2 is preferentially expressed in mature B cells and indispensable for marginal zone B lineage development. Immunity 18,675 -685.[CrossRef][Medline]
Schroeter, E. H., Kisslinger, J. A. and Kopan, R. (1998). Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 393,382 -386.[CrossRef][Medline]
Val, P., Jeays-Ward, K. and Swain, A. (2006). Identification of a novel population of adrenal-like cells in the mammalian testis. Dev. Biol. 299,250 -256.[CrossRef][Medline]
Yao, H. H., Whoriskey, W. and Capel, B. (2002).
Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis
organogenesis. Genes Dev.
16,1433
-1440.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
