|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 24, 2008
doi: 10.1242/10.1242/dev.022475
Laboratory for Accelerated Vascular Research, Division of Vascular Surgery, Department of Surgery, University of California, San Francisco, CA 94143, USA.
Author for correspondence (e-mail:
rong.wang{at}ucsfmedctr.org)
Accepted 17 September 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Angiogenesis, Vascular morphogenesis, Notch, Ephrin B2/EphB4, Mouse, Arterial-venous differentiation
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Coultas et al., 2005;
Folkman, 2007). New vessel
segments are generated by the well-described process of capillary sprouting
from pre-existing vessels. Coordination between the sizes of developing
arteries and veins is crucial in establishing an interface between these
vessels and for a functional vasculature; however, the cellular and molecular
regulation of this parity is unknown
(Jones et al., 2006;
Gridley, 2007). Elucidating
the cellular and molecular basis of arterial and venous specification and
endothelial cell (EC) distribution would provide a conceptual advance in our
understanding of angiogenesis.
In this study we examined the first artery and vein to develop in the body:
the dorsal aorta (DA) and the cardinal vein (CV), respectively. Given that
initial DA and CV development involves ECs and not adjacent mural cells, this
model provides an experimental system in which to study the role of EC
signaling in arteriovenous morphogenesis. The DA emerges prior to the CV, and
its morphogenesis begins with the assembly of ECs into the DA primordium, a
transient capillary plexus (Sabin,
1917; Coffin et al.,
1991). Remodeling of this primitive network generates a lumenized
vessel, which subsequently matures into the major artery of the body. The CV
emerges slightly later, at which stage transient capillary channels develop
between the DA and CV (Sabin,
1917; Gerety and Anderson,
2002) (see Fig. S1 in the supplementary material), suggesting that
the two vessels may interact to establish the proper circulatory system.
The discovery of ephrin B2 (Efnb2), a gene encoding a
transmembrane signaling molecule specifically expressed in arterial ECs prior
to the onset of circulation, unveiled a genetic program of arteriovenous
differentiation (Wang et al.,
1998; Adams et al.,
1999). These studies demonstrate that the ephrin B2 ligand and its
venous-specific EphB4 tyrosine kinase receptor
(Wang et al., 1998;
Gerety et al., 1999) are
important for vascular remodeling of primitive capillary networks into
distinct arteries and veins. Despite its distinctive arterial expression,
ephrin B2 does not determine arterial specification in ECs
(Wang et al., 1998). The
precise cellular mechanism underlying ephrin B2 function in ECs is unknown.
Ephrin/Eph signaling mediates cellular behavior such as repulsion, adhesion
and motility in neuronal, bone and other tissue types
(Klein, 2004;
Poliakov et al., 2004;
Kuijper et al., 2007), raising
the possibility that ephrin B2/EphB4 signaling functions in a similar fashion
in ECs.
Notch receptors and their ligands are transmembrane proteins that are
primarily expressed in arteries and not veins
(Villa et al., 2001). Notch
signaling influences bi-potential cell fate decisions through cell-cell
communication (Artavanis-Tsakonas et al.,
1999). Studies in zebrafish and mice show that Notch activation
promotes arterial characteristics in ECs
(Lawson et al., 2001;
Zhong et al., 2001;
Torres-Vazquez et al., 2003;
Shawber and Kitajewski, 2004;
Carlson et al., 2005). Gain-
and loss-of-function mutations in the Notch pathway lead to abnormal vascular
development in mice (Krebs et al.,
2000; Uyttendaele et al.,
2001; Duarte et al.,
2004; Fischer et al.,
2004; Gale et al.,
2004; Krebs et al.,
2004). We have shown that expression of constitutively active
Notch4 in a subset of ECs can cause prompt and massive arteriovenous
malformations in adults (Carlson et al.,
2005). In addition to its ability to promote arterial
characteristics, Notch signaling also restricts capillary sprouting in normal
and tumor angiogenesis (Noguera-Troise et
al., 2006; Ridgway et al.,
2006; Hellstrom et al.,
2007; Siekmann and Lawson,
2007; Suchting et al.,
2007). However, the precise cellular function of Notch signaling
in the establishment of arteriovenous distinction remains unknown.
We have combined mouse genetics and in vivo analysis to examine concurrently the effects of these pathways on DA and CV development and have found that the size of the developing DA and CV is coordinated. ECs are distributed between the DA and CV, and both Notch and ephrin B2/EphB4 signaling pathways are crucial for this coordination during vascular morphogenesis. Notch controls the proportion of ECs in the DA and CV by promoting arterial specification, thereby modulating their respective lumen size. The ephrin B2/EphB4 signaling pathway segregates arterial and venous ECs into their respective vessel. Our work suggests that the growth of arteries and veins during angiogenesis is inversely coordinated, and that the Notch and ephrin B2/EphB4 pathways are essential for balanced arteriovenous development during blood vessel formation.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
), as have the Efnb2-tauLacZ
(Wang et al., 1998),
Efnb2-H2BGFP (Davy and Soriano,
2006), EphB4-tauLacZ
(Gerety et al., 1999),
Efnb2flox/flox (Gerety
and Anderson, 2002), Notch1+/-
(Conlon et al., 1995),
Notch1flox/flox
(Radtke et al., 1999) and
Tie2-LacZ (Schlaeger et al.,
1997) mice. Embryos were genotyped as described previously
(Braren et al., 2006). All
animals were treated in accordance with the guidelines of the UCSF
Institutional Animal Care and Use Committee.
Immunofluorescence
Immunofluorescence was performed according to a previously described
protocol. (Braren et al.,
2006). Goat anti-EphB4 (1:50) was from R&D Systems
(Minneapolis, MN), rabbit anti-βGal (1:200) was from MP Biomedicals
(Irvine, CA) and Alexa 488 donkey anti-goat (1:1000) was from Invitrogen
(Carlsbad, CA). Cy5 donkey anti-rabbit (1:500) was from Jackson ImmunoResearch
Laboratories (Baltimore, MD).
EC counting
To quantitatively assess the distribution of ECs, we counted ECs in serial
cross-sections of the trunk region between the otic vesicle and the heart of
E8.75 embryos. ECs were identified by CD31 immunofluorescent staining, and
total ECs included those in the DA, primordial anterior CV and capillaries in
the vicinity. For Notch4 gain-of-function analysis, five pairs of
controls and mutants at 15-16 ss were used, and between eight and twelve 10
µm frozen sections per embryos were analyzed. For Notch1
loss-of-function, four pairs of controls and mutants at 12-15 ss were used.
Depending on the quality of the sections, two, six, nine and ten 10 µm
frozen sections per embryo were analyzed. For Efnb2 loss-of-function,
three pairs of controls and mutants at 15-17 ss were used, with 13 paraffin
sections (5 µm) per embryo being analyzed. The number of sections analyzed
between mutant and somite stage-matched littermate control was equal. The sum
of ECs per mutant embryo (see Table S3 in the supplementary material) was
normalized against that of its control, with controls expressed as 100%.
Primordial CV compartment includes all ECs except those in the DA. The ratio
of DA and primordial CV ECs was calculated over the total EC number.
Whole-mount lacZ staining, histology, and immunohistochemistry
lacZ staining, tissue embedding, histology and
immunohistochemistry were performed as described
(Carpenter et al., 2005), with
modifications in fixation duration for lacZ staining: 40 minutes
(E9.0), 45 minutes (E9.5) or 2 hours (E12.5) at 4°C. For imaging, E12.5
and E9.5 lacZ-stained embryos were cleared in benzyl alcohol and
benzyl benzoate (1:2 ratio) after serial dehydration in 25, 50, 75 and 100%
methanol, in 20 minutes intervals. Section positions were identified according
to Kaufman (Kaufman,
1992).
In situ hybridization
A 2.7 kb Dll4 antisense probe was used at a final concentration of
1 µg/ml (probe plasmid kindly provided by D. Pleasure). After fixation in
4% PFA, followed by dehydration in methanol and rehydration in PBS, 0.1%
Tween-20, E9.0 embryos were digested with 10 µg/ml Proteinase K for 3
minutes on ice. AP-conjugated digoxigenin-labeled RNA probes were prepared
according to the manufacturer's instructions (Roche, Indianapolis, IN),
hybridized at 65°C overnight under stringent conditions (1.3x SSC,
50% formamide, 0.2% Tween-20, 5 mM EDTA, pH 8.0, 50 µg/ml Yeast RNA and 100
µg/ml heparin) and stained with BM purple (Roche). Stained embryos were
embedded in paraffin and cross-sectioned (10 µm).
RT-PCR
Total mRNA was extracted from snap-frozen, pooled E9.5 embryos and yolk
sacs using PolyATtract System (Promega, Madison, WI), and reverse-transcribed
using oligo dT primers according to the manufacturer's instructions
(Superscript III RT, Invitrogen). The int3 cDNA was amplified with
transgene-specific primers, CGGAGGGAAGGTGTATGCTC (sense) and
GGGTCCATGGTGATACAAGG (antisense), at 60°C annealing temperature. Primer
sequences for Gapdh were AGCTTGTCATCAACGGGAAG (sense) and
GGATGCAGGGATGATGTTCT (antisense), and for β-actin were
ATGAAGATCCTGACCGAGCG (sense) and TACTTGCGCTCAGGAGGAGC (antisense). For E8.5
embryos and yolk sacs, total RNA was extracted using the RNeasy kit (Qiagen,
Valencia, CA) for cDNA synthesis.
Ink injection analysis
Black ink (Staedtler, Nuernberg, Germany) diluted 1:4 in PBS, 0.1%
Tween-20, was injected into the outflow tract of E9.5 embryos still attached
to the yolk sac, using a micro-needle. Embryos were subsequently fixed in 4%
PFA.
In vivo EC proliferation assay
Proliferating cells were labeled 2 hours before embryo collection by
intra-peritoneal injection of BrdU (Sigma, 100 µg/g body weight) into
pregnant females 9 days post-coitum. EC proliferation was detected by double
immunofluorescent staining for CD31 and BrdU in frozen cross-sections (10
µm) using a BrdU staining kit (Zymed Laboratories, South San Francisco, CA)
in combination with fluorescent secondary antibodies. In each section, DA ECs
were counted over an area spanning the otic vesicle to the heart, and the
proportion of BrdU-positive ECs calculated.
Statistical analyses
Data bars represent the mean values and error bars the standard deviation.
All cell counts were analyzed using two-tailed t-test.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). We
verified that tTA was active specifically in the ECs by examining
β-galactosidase (β-gal) activity in embryos carrying both
Tie2-tTA and TRE-LacZ reporter genes. β-gal activity
was detected specifically in the vasculature of yolk sacs by E9.5 and more
strongly at E12.5 (see Fig. S2A,C in the supplementary material), and as shown
in embryo cross-sections, was restricted to a subset of the ECs of DA and CV
at E9.5 while more uniformly at E12.5 (see Fig. S2B,D in the supplementary
material). We verified int3 expression by RT-PCR in pooled embryos and yolk sacs using transgene-specific primers that do not amplify the endogenous Notch4 gene. The int3 mRNA was detected in the Tie2-tTA;TRE-int3 mutant at E8.5 [9-12 somite stage (ss)] and E9.5 (22-26 ss), at higher a level than the low basal level seen in TRE-int3 tissues, and was not detected in Tie2-tTA tissues (see Fig. S2E in the supplementary material). The Tie2-tTA;TRE-int3 embryos exhibited severe vascular abnormalities by E9.5 and ultimately died by E11.5. Characterization of the gross phenotype of the mutant embryos is described in Tables S1 and S2, and in Fig. S2F-H in the supplementary material. As no obvious abnormalities were detected in either the TRE-int3 or Tie2-tTA embryos, they, along with the wild type, were included as controls.
|
;
Gerety et al., 1999) verified
that int3 results in an enlarged anterior DA and an underdeveloped CV
(Fig. 2A-D). We confirmed with
serial cross-sections at E9.5 the enlargement of mutant DA and the
underdeveloped mutant CVs displaying a primitive capillary structure lacking
the well-defined lumen seen in controls
(Fig. 1E,F). The morphological
defects in the mutant DA and CV were accompanied by the development of
arteriovenous shunting at E9.5, demonstrated by ink injection
(Fig. 2E,F).
To determine whether alterations in smooth muscle cell (SMC) recruitment
were involved in the DA enlargement, we performed CD31 and smooth muscle
-actin double staining in E9.0 (18 ss) embryos
(Fig. 2G,H). At this stage, no
SMCs were associated with either the control or mutant DA, yet the mutant DA
was enlarged (Fig. 2H). This
result suggests that enlargement of the DA occurred before, and thus
independently of, the recruitment of SMCs.
int3 does not affect absolute EC number
To investigate the cellular mechanism underlying the reciprocal DA and CV
size, we tested whether increased EC proliferation is associated with the
enlarged DA. We performed in vivo BrdU-labeling combined by CD31 staining in
embryos at E8.75 (13-15 ss), prior to apparent gross mutant abnormalities.
CD31-positive and BrdU-positive proliferating ECs were counted in
cross-sections of the DA (Fig.
3A). The mutant DA exhibited a 14.5% (±15.2) increase in EC
number compared with controls, indicating the enlargement of DA. However, the
number of proliferating ECs was indistinguishable between mutant and control
at 
12% (±2.9, control versus ±3.2, mutant;
Fig. 3B). This result suggests
that the increase in DA size was not due to an increase in EC
proliferation.
We also tested whether EC death was decreased in the mutant but did not detect any apoptotic ECs in either control or mutant DA by TUNEL assay and CD31 staining (data not shown), thus we could not evaluate the effect of int3 on EC apoptosis directly. We then counted the total ECs, including in the DA, CV and capillaries in the vicinity, from the cross-section of anterior E8.75 (15-16 ss) embryos labeled by immunofluorescent CD31 staining, and found no significant change in the absolute number of ECs between the mutant and control (0.3±9.4% increase in the mutant over the control; P=0.94, n=5). Because both total EC number and EC proliferation were not significantly affected, these results also suggest that int3 did not affect EC survival.
int3 increases the ratio of arterial to venous ECs
To quantitatively assess the distribution of ECs between DA and CVs, we
counted ECs in serial cross-sections of the anterior trunk E8.75 (15-16 ss).
The proportion of DA ECs increased from 34.8% in controls
(Fig. 1G) to 49.5% in mutants
(P=0.02, n=5; Fig.
1H), reflecting the enlarged mutant DA. Conversely, EC proportion
in the mutant CV including capillaries in the vicinity was reduced from 65.2%
in controls to 50.5% in mutants, confirming the underdevelopment of CVs. These
data show that int3 leads to an increase in the number of arterial
ECs with a concomitant reduction in the number of venous ECs.
|
|
|
E10.5, when
Tie2-tTA;TRE-int3 embryos were severely retarded from int3
expression. We thus optimized the timing of int3 expression by
treating the pregnant females with tetracycline in water until day 7.5 of
gestation, as we described previously
(Carpenter et al., 2005).
Embryos were collected at E10.5. Under these conditions, only a subset of
mutant embryos was affected (51.2%; 22 out of 43 mutants), and four mutants
analyzed for head vessels exhibited enlarged internal carotid arteries, which
were often accompanied by smaller head veins
(Fig. 1I,J). This finding
suggests that int3 can also induce enlarged arteries along with
underdeveloped veins in other organs.
The CV primordium is expanded, while DA is smaller in Notch1-/- embryos
It has been previously reported that the Notch1-/- DA
is smaller than wild-type DA (Krebs et
al., 2000), and we have confirmed this finding (see Fig. S3B in
the supplementary material). To analyze the CV structure in
Notch1-/- mutants, we stained the embryos for both EphB4
and CD31 at E9.0 (15 ss) when the mutant embryos were affected. At this stage,
when the control CV was still composed of capillary plexus, the
Notch1-/- primordial CV was expanded
(Fig. 4B, arrowheads). This
phenotype is reciprocal to that of the Notch4 gain-of-function
mutant.
To quantitatively assess the DA and CV sizes, we counted ECs in serial cross-sections of anterior E8.75 (12-15 ss) embryos. Total EC numbers, including those in the DA and primordial CV were comparable in mutants and controls (4.2±11.7% increase in the mutant over the control; P=0.52, n=4). However, the proportion of ECs in the DA was reduced in Notch1-/- (21.1%, compared with 47.7% in controls, P=0.0007; Fig. 4C,D). Concomitantly, the proportion of ECs in the CV region was significantly increased. These findings further suggest that the reduced DA size is accompanied by an increase in the CV size in the Notch1-/- embryos, reciprocal to that of the Notch4 gain-of-function mutant.
Determining EC identity, we found that EphB4-positive ECs were exclusively
located in the control CV primordium, and not in the DA
(Fig. 4A). By contrast,
EphB4-positive ECs clustered at the smaller, atretic DA in addition to the CV
primordium (Fig. 4B).
Quantitative analysis showed that the ratio of EphB4-postive to negative ECs
in the DA region (as DAs were small and atretic in the mutant) was increased
from 0.01 in the control to 0.15 in Notch1-/- (data not
shown). As previously demonstrated
(Fischer et al., 2004), we
observed that the mutant DA ECs were devoid of ephrin B2 expression (data not
shown). In addition, in situ hybridization revealed that the DA ECs express
Dll4 in the control but not in Notch1-/- embryo (see Fig.
S3C,D in the supplementary material). These findings demonstrate that
Notch1-/- DA may lose arterial identity, but harbor ECs
with venous identity.
To determine whether lack of Notch1 in ECs is responsible for such
defects, we used conditional mutants in which the
Notch1flox/flox allele
(Radtke et al., 1999) was
excised in ECs by Cre recombinase under the control of Tie1 promoter:
Tie1-Cre (Gustafsson et al.,
2001). We have shown that Tie1-Cre is active in about 80%
ECs and a minority of hematopoietic cells
(He et al., 2008). CD31
staining reveals that these mutant embryos displayed similarly smaller,
atretic DAs and enlarged CV primordia, at a similar developmental stage to
Notch1-/- embryos (Fig.
4E-H). These results suggest that Notch1 in ECs is
essential for the balanced growth of the DA and the CV. In summary, these data
suggest that Notch loss- and gain-of-function mutants elicit
reciprocal effects balancing DA and CV morphogenesis.
Enlarged DA and underdeveloped CV in Efnb2-/- embryos
The balanced distribution of ECs between the DA and CV led us to
hypothesize that a cell-sorting mechanism would be involved. The ephrin
B2/EphB4 system is known to mark these specific venous and arterial
compartments, and has the potential to affect cell sorting. Twenty out of 29
Efnb2-/- embryos (average 17.2 ss) developed enlarged DA
on both sides, which were accompanied by reduced CV primordial capillaries
(Fig. 5A-F). The remaining nine
mutants, at a later stage (average 19.6 ss) with more severe developmental
defects, exhibited an enlarged left-anterior DA that was still accompanied by
a reduction in number of CV capillaries. But the right-anterior DA was smaller
and coincided with an increase in number of CV primordial capillaries (data
not shown).
|
To determine the arterial-venous identity of the ECs, we stained cross-sections for EphB4 and CD31 and demonstrated that, in controls, EphB4-positive cells were present only in the veins at E8.75 (Fig. 5G). In Efnb2-/- mutants, however, EphB4-positive ECs were also present in the enlarged DA (Fig. 5H). The expression of another arterial marker, Dll4, absent in the Notch1-/- mutant, was unchanged in the Efnb2-/- mutant (data not shown), suggesting that lack of ephrin B2 did not affect overall EC identity. These data indicate that venous ECs may mislocalize to the DA when the embryo lacks ephrin B2.
To examine whether ephrin B2 in ECs is responsible for DA and CV
development, we analyzed EC-specific conditional knockouts, using
Tie1-Cre lines described above and the
Efnb2flox/flox allele
(Gerety and Anderson, 2002).
The conditional mutant embryos developed similar phenotypes to the
Efnb2-/- embryos at the same stage, suggesting that loss
of ephrin B2 in ECs is responsible for the vascular defects
(Fig. 5I-L). In summary, these
results imply that ephrin B2 signaling within the ECs is responsible for the
coordinated sizes of the developing DA and CV, in a manner similar to, but
distinct from, Notch signaling.
Ephb4-/- embryos also exhibit enlarged DA and underdeveloped anterior CV
Because EphB4 is a putative receptor for ephrin B2, and
Ephb4-/- embryos exhibit similar vascular phenotypes to
the Efnb2-/- mutants
(Gerety et al., 1999), we
examined the Ephb4-/- DA and CV.
Ephb4-/- embryos indeed developed enlarged DA along with
underdeveloped anterior CV around E9.25 (20 ss)
(Fig. 6A-H). In addition, the
enlarged DA harbored ephrin B2-negative ECs
(Fig. 6E,F) and EphB4-positive
ECs, as judged by EphB4-tauLacZ promoter activity
(Fig. 6G,H), not seen in the
controls. These data demonstrate that Ephb4 deficiency led to similar
DA enlargement and CV underdevelopment as with Efnb2 deficiency, and
that the enlarged mutant DA contained mislocalized EphB4-positive, ephrin
B2-negative (and thus likely venous) ECs. In summary, our results demonstrate
that both Efnb2 and Ephb4 deficiency led to DA enlargement
and CV reduction, with the enlarged DA containing mislocalized ECs expressing
EphB4. Together, our findings suggest that ephrin B2/EphB4 signaling is
required to sort ECs with differential identities into their respective
vessels to coordinate artery and vein sizes.
|
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Coordinated arterial and venous growth is achieved through a reciprocal balance
Developing arteries and veins must coordinate both the number and size of
their branches to generate a proper circulatory system. The cellular and
molecular mechanisms underlying this regulation are poorly understood. One
potential mechanism to achieve such equilibrium is interdependent vessel
growth. In support of this hypothesis, we have provided quantitative evidence
showing that an increase or decrease in DA size leads to a reciprocal change
in CV size.
An expansion of the CV region with a concomitant loss of DA segments has
been observed in zebrafish. In a subset of zebrafish embryos, inhibition of
Notch signaling through high dose antisense constructs targeting the
Notch downstream gene gridlock (grl), was shown to
increase CV length or region but not lumen size, with loss of DA segments
(Zhong et al., 2001). However,
this phenotype did not occur in the majority of embryos injected with the high
dose construct nor in embryos injected with low dose antisense DNA. In
addition, even in the most severe zebrafish mindbomb mutant, a
putative Notch loss-of-function mutant, the DA remained normal,
although the expression of arterial markers was diminished
(Lawson et al., 2001).
Conversely, in gain-of-function mutants, induced by over-expression of
grl or expression of Notch ICD, the size of the DA was not
affected, despite increased ephrin B2 expression
(Lawson et al., 2001;
Zhong et al., 2001).
Therefore, although these earlier studies show that Notch activity is
necessary and sufficient for arterial marker expression, a role for Notch in
balancing DA and CV lumen size has not been established. Our findings in both
Notch gain- and loss-of-function mouse mutants suggest that Notch is
critical in equilibrating both arterial and venous lumen size.
Consistent with our findings, prior studies have shown that the DA is small
and atretic in Notch loss-of-function mutants
(Krebs et al., 2000;
Duarte et al., 2004;
Gale et al., 2004;
Krebs et al., 2004). However,
these previous reports did not elaborate on CV development. Enlarged and
reduced vessel sizes have been reported in Notch4 gain-of-function
mutants (Uyttendaele et al.,
2001), further suggesting that Notch controls vessel size.
However, this earlier study did not specify coordinated changes in arteries
and veins. We have combined mouse genetics and in vivo imaging to examine the
effects of Notch on both the DA and the CV concurrently. We report here that
Notch signaling regulates coordinated growth of both DA and CV in mice by
balancing the ratio of arterial versus venous ECs.
It is unclear at present whether this balanced regulation is a universal
mechanism during angiogenesis. Our evidence from the carotid arteries and the
head veins supports the notion that it occurs in other developing arteries and
veins. Furthermore, VEGF, a molecule genetically upstream of Notch
(Lawson et al., 2002;
Mukouyama et al., 2002),
dictates the ratio of arterial and venous blood vessel types during
angiogenesis in cardiac muscle (Visconti
et al., 2002), suggesting that this mechanism of angiogenesis may
be universal. In this study, 50% of capillaries in control animals were
ephrin B2 positive. In the VEGF over-expressing mutant, nearly 90% of
capillaries were ephrin B2 positive and fewer than 10% of capillaries were
EphB4 positive. Similarly, a recent study reports that the Tie2-Cre
conditional deletion of Smad4, a component of TGF-β signaling,
yields a small DA and an enlarged CV at E9.5
(Lan et al., 2007). This
result also lends support to the reciprocal regulation of arterial and venous
size, which, together with our findings, suggests that the reciprocal
relationship between growing arteries and veins may be a general process.
Arterial-venous differentiation, not cell proliferation, is crucial for the balanced growth of the DA and CV
Our data demonstrate that the cellular mechanism underlying the
interdependence between arterial and venous size is a balanced allocation of
ECs between these vessels. Balanced differentiation of one cell type at the
expense of another by Notch during cell fate decisions has been observed in
C. elegans ventral uterine precursor/anchor cells in the gonad,
Drosophila neural versus epidermal precursor cells in the ventral
ectoderm (Artavanis-Tsakonas et al.,
1999), and T versus B cells in the mouse immune system
(Pear and Radtke, 2003). Our
quantitative data at cellular resolution suggest that the role of Notch in the
balance between two cell types seems to extend into the mouse vasculature,
where it similarly regulates the balance between arterial and venous ECs.
Although changes in cell proliferation could lead to differential size, we demonstrate that the proliferation of ECs was not affected by int3. Thus, Notch regulates EC allocation by dictating arterial specification, thereby controlling the ratio of arterial to venous ECs.
Coincident with defective DA and CV size is evidence of abnormal vascular
perfusion and arteriovenous shunting. We show that ink injected into the heart
leaks from the DA into the CV compartment in Notch gain-of-function
mutants. Others have similarly demonstrated DA and CV shunting in embryos
lacking Notch1 (Gridley,
2007). These studies suggest the importance of proper EC
allocation between arteries and veins in the establishment of a functional
circulatory system.
The reciprocal size changes between the mutant DA and CVs are unlikely results of aberrant blood flow
It is well established that increase in blood flow induces enlargement,
whereas a decrease leads to reduction in vessel diameter
(Korshunov and Berk, 2003).
Such observations raise the issue of whether the reciprocal DA and CV size
changes are secondary to hemodynamic changes. As it is currently not feasible
to measure blood flow changes in early mouse embryos, it is difficult to
address this question empirically. However, evidence suggests that the
reciprocal DA and CV sizes are likely to be primary effects of genetic
perturbation and not of blood flow changes. First, the phenotypes were
apparent at E8.75-E9.0, shortly after E8.5, when blood pressure is irregular
and minimal, and unlikely to cause such defects
(Jones et al., 2004). We have
intentionally analyzed the defects early to avoid flow influence, and mutants
were compared with size and somite-stage matched littermate controls. Second,
the inverse size change does not fit the well-established flow theory. If the
observed size changes in the DA were due to changes in flow, then CV size
would coincide, as opposed to the reciprocal phenotype we observed. By
contrast, both arteries and veins were reduced in a Myc
(c-myc) mutant specifically harboring flow defects, as predicted by
the flow theory (He et al.,
2008). In this mutant, Myc (c-myc) was deleted
only in the hematopoietic lineage, affecting blood cells and blood viscosity,
therein changing flow as well. Therefore, although variation in blood flow may
contribute to vascular defects, it is unlikely to be the cause of reciprocal
DA and CV size changes seen in the Notch and Efnb2
mutants.
Coordination of DA and CV sizes may involve proper EC allocation
The presence of EphB4-positive ECs in the enlarged DA of both
Ephb4 and Efnb2 null mutants is of great interest.
EphB4-positive cells, as single cells and in small clusters, have been
observed in the vitelline artery of wild-type mouse embryos
(Gerety et al., 1999) and in
the DA of adult mice (Shin et al.,
2001). It is unknown why these venous cells reside in arteries and
where their ultimate destination may be. Our data suggest that venous ECs
transiently inhabit the DA, and that ephrin B2/EphB4 signaling may be
responsible for the proper distribution of these ECs from DA to CV.
The ephrin/Eph pathway mediates both forward signaling in the Eph
receptor-expressing cell and reverse signaling in the ephrin ligand expressing
cell. Forward signaling is crucial for embryonic vascular development, as mice
capable of forward but not reverse signaling, survive through birth without
the apparent embryonic vascular defects seen in the complete null mutant
(Cowan et al., 2004). One
characteristic outcome of forward signaling is cell repulsion, specifically
the repulsion of the Eph-positive cell away from the ephrin B2-positive cell
(Pasquale et al., 2008; Kuijper et al.,
2007). Ephrin B2/EphB4 signaling results in such repulsion in ECs,
where EphB4-positive ECs retract from ephrin B2 positive ECs in culture
(Marston et al., 2003). We
found that without ephrin B2/EphB4 signaling, the aberrant intermingling of
EphB4-positive ECs in the enlarged DA may reflect a failure in the repulsion
of EphB4-positive ECs from ephrin B2-positive ECs in the DA in vivo.
Considering the concurrent enlarged DA and diminished CV size, these
mislocalized EphB4-positive ECs may normally originate in the DA and
subsequently contribute to CV formation. The lack of an enlarged CV and an
underdeveloped DA as well as the absence of ephrin B2-positive ECs in the CV
of either Efnb2- or Ephb4-null mutants suggests that ephrin
B2/EphB4 signaling functions to repel EphB4-positive ECs away from ephrin
B2-positive ECs, and from the DA to the CV, not vice versa.
Sabin proposed that the DA extends diverticula to form the CV, based on her
observations in living chick embryos and prior studies
(Sabin, 1917). However, later
electron microscopy studies failed to detect such aortic protrusions, thus
questioning her model (Hirakow and Hiruma,
1981; Poole and Coffin,
1988). Our molecular evidence supports Sabin's theory. More recent
support for this model includes in vivo real-time imaging of zebrafish
vascular development, which demonstrated that segments of DA extensions become
an integral part of veins (Isogai et al.,
2003). In addition, arterial segments have been shown to
incorporate into the vitelline vein during yolk sac vascular remodeling in the
chick (le Noble et al., 2004).
Thus, it is likely that ECs may migrate from arteries to veins.
Although we have not directly observed EC migration in the developing mouse
embryo, we and others have detected lateral capillary channels linking the DA
and CV (see Fig. S1 in the supplementary material)
(Gerety and Anderson, 2002).
These structures may be physical bridges between the developing DA and CV.
Thus, we propose a model where Notch promotes arterial differentiation,
therein regulating EC allocation; and ephrin B2/EphB4 forward signaling
segregates venous ECs, transiently residing in the DA, to the CV.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/22/3755/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: Estrada Control Nicolau de Mesquita, Hovione PharmaScience
Ltd, Taipa, Macau
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Adams, R. H., Wilkinson, G. A., Weiss, C., Diella, F., Gale, N.
W., Deutsch, U., Risau, W. and Klein, R. (1999). Roles of
ephrinB ligands and EphB receptors in cardiovascular development: demarcation
of arterial/venous domains, vascular morphogenesis, and sprouting
angiogenesis. Genes Dev,
13,295
-306.
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Braren, R., Hu, H., Kim, Y. H., Beggs, H. E., Reichardt, L. F.
and Wang, R. (2006). Endothelial FAK is essential for
vascular network stability, cell survival, and lamellipodial formation.
J. Cell Biol. 172,151
-162.
Carlson, T. R., Yan, Y., Wu, X., Lam, M. T., Tang, G. L.,
Beverly, L. J., Messina, L. M., Capobianco, A. J., Werb, Z. and Wang, R.
(2005). Endothelial expression of constitutively active Notch4
elicits reversible arteriovenous malformations in adult mice. Proc.
Natl. Acad. Sci. USA 102,9884
-9889.
Carmeliet, P. (2005). Angiogenesis in life,
disease and medicine. Nature
438,932
-936.[CrossRef][Medline]
Carpenter, B., Lin, Y., Stoll, S., Raffai, R. L., McCuskey, R.
and Wang, R. (2005). VEGF is crucial for the hepatic vascular
development required for lipoprotein uptake.
Development 132,3293
-3303.
Coffin, J. D., Harrison, J., Schwartz, S. and Heimark, R.
(1991). Angioblast differentiation and morphogenesis of the
vascular endothelium in the mouse embryo. Dev. Biol.
148, 51-62.[CrossRef][Medline]
Conlon, R. A., Reaume, A. G. and Rossant, J.
(1995). Notch1 is required for the coordinate segmentation of
somites. Development
121,1533
-1545.[Abstract]
Coultas, L., Chawengsaksophak, K. and Rossant, J.
(2005). Endothelial cells and VEGF in vascular development.
Nature 438,937
-945.[CrossRef][Medline]
Cowan, C. A., Yokoyama, N., Saxena, A., Chumley, M. J., Silvany,
R. E., Baker, L. A., Srivastava, D. and Henkemeyer, M.
(2004). Ephrin-B2 reverse signaling is required for axon
pathfinding and cardiac valve formation but not early vascular development.
Dev. Biol. 271,263
-271.[CrossRef][Medline]
Davy, A. and Soriano, P. (2006). Ephrin-B2
forward signaling regulates somite patterning and neural crest cell
development. Dev. Biol.
304,182
-193[CrossRef][Medline]
Duarte, A., Hirashima, M., Benedito, R., Trindade, A., Diniz,
P., Bekman, E., Costa, L., Henrique, D. and Rossant, J.
(2004). Dosage-sensitive requirement for mouse Dll4 in artery
development. Genes Dev.
18,2474
-2478.
Fischer, A., Schumacher, N., Maier, M., Sendtner, M. and
Gessler, M. (2004). The Notch target genes Hey1 and Hey2 are
required for embryonic vascular development. Genes
Dev. 18,901
-911.
Folkman, J. (2007). Angiogenesis: an organizing
principle for drug discovery? Nat. Rev. Drug Discov.
6, 273-286.[CrossRef][Medline]
Gale, N. W., Dominguez, M. G., Noguera, I., Pan, L., Hughes, V.,
Valenzuela, D. M., Murphy, A. J., Adams, N. C., Lin, H. C., Holash, J. et
al. (2004). Haploinsufficiency of delta-like 4 ligand results
in embryonic lethality due to major defects in arterial and vascular
development. Proc. Natl. Acad. Sci. USA
101,15949
-15954.
Gerety, S. S. and Anderson, D. J. (2002).
Cardiovascular ephrinB2 function is essential for embryonic angiogenesis.
Development 129,1397
-1410.[Medline]
Gerety, S. S., Wang, H. U., Chen, Z. F. and Anderson, D. J.
(1999). Symmetrical mutant phenotypes of the receptor EphB4 and
its specific transmembrane ligand ephrin-B2 in cardiovascular development.
Mol. Cell 4,403
-414.[CrossRef][Medline]
Gridley, T. (2007). Notch signaling in vascular
development and physiology. Development
134,2709
-2718.
Gustafsson, E., Brakebusch, C., Hietanen, K. and Fassler, R.
(2001). Tie-1-directed expression of Cre recombinase in
endothelial cells of embryoid bodies and transgenic mice. J. Cell
Sci. 114,671
-676.[Abstract]
He, C., Hu, H., Braren, R., Fong, S. Y., Trumpp, A., Carlson, T.
R. and Wang, R. A. (2008). c-myc in the hematopoeitic lineage
is crucial for its angiogenic function in the mouse embryo.
Development 135,2467
-2477.
Hellstrom, M., Phng, L. K., Hofmann, J. J., Wallgard, E.,
Coultas, L., Lindblom, P., Alva, J., Nilsson, A. K., Karlsson, L., Gaiano, N.
et al. (2007). Dll4 signalling through Notch1 regulates
formation of tip cells during angiogenesis. Nature
445,776
-780.[CrossRef][Medline]
Hirakow, R. and Hiruma, T. (1981). Scanning
electron microscopic study on the development of primitive blood vessels in
chick embryos at the early somite-stage. Anat.
Embryol. 163,299
-306.[CrossRef][Medline]
Isogai, S., Lawson, N. D., Torrealday, S., Horiguchi, M. and
Weinstein, B. M. (2003). Angiogenic network formation in the
developing vertebrate trunk. Development
130,5281
-5290.
Jones, E. A., Baron, M. H., Fraser, S. E. and Dickinson, M.
E. (2004). Measuring hemodynamic changes during mammalian
development. Am J. Physiol. Heart Circ. Physiol.
287,H1561
-H1569.
Jones, E. A., le, Noble, F. and Eichmann, A.
(2006). What determines blood vessel structure? Genetic
prespecification vs. hemodynamics. Physiology
21,388
-395.
Kaufman, M. H. (1992). The Atlas of
Mouse Development, 1st edn. Academic Press: San Diego,
CA.
Klein, R. (2004). Eph/ephrin signaling in
morphogenesis, neural development and plasticity. Curr. Opin. Cell
Biol. 16,580
-589.[CrossRef][Medline]
Korshunov, V. A. and Berk, B. C. (2003).
Flow-induced vascular remodeling in the mouse: a model for carotid
intima-media thickening. Arterioscler. Thromb. Vasc.
Biol. 23,2185
-2191.
Krebs, L. T., Xue, Y., Norton, C. R., Shutter, J. R., Maguire,
M., Sundberg, J. P., Gallahan, D., Closson, V., Kitajewski, J., Callahan, R.
et al. (2000). Notch signaling is essential for vascular
morphogenesis in mice. Genes Dev.
14,1343
-1352.
Krebs, L. T., Shutter, J. R., Tanigaki, K., Honjo, T., Stark, K.
L. and Gridley, T. (2004). Haploinsufficient lethality and
formation of arteriovenous malformations in Notch pathway mutants.
Genes Dev. 18,2469
-2473.
Kuijper, S., Turner, C. J. and Adams, R. H.
(2007). Regulation of angiogenesis by Eph-ephrin interactions.
Trends Cardiovasc. Med.
17,145
-151.[CrossRef][Medline]
Lan, Y., Liu, B., Yao, H., Li, F., Weng, T., Yang, G., Li, W.,
Cheng, X., Mao, N. and Yang, X. (2007). Essential role of
endothelial Smad4 in vascular remodeling and integrity. Mol. Cell.
Biol. 27,7683
-7692.
Lawson, N. D., Scheer, N., Pham, V. N., Kim, C. H., Chitnis, A.
B., Campos-Ortega, J. A. and Weinstein, B. M. (2001). Notch
signaling is required for arterial-venous differentiation during embryonic
vascular development. Development
128,3675
-3683.
Lawson, N. D., Vogel, A. M. and Weinstein, B. M.
(2002). sonic hedgehog and vascular endothelial growth factor act
upstream of the Notch pathway during arterial endothelial differentiation.
Dev. Cell 3,127
-136.[CrossRef][Medline]
le Noble, F., Moyon, D., Pardanaud, L., Yuan, L., Djonov, V.,
Matthijsen, R., Breant, C., Fleury, V. and Eichmann, A.
(2004). Flow regulates arterial-venous differentiation in the
chick embryo yolk sac. Development
131,361
-375.
Marston, D. J., Dickinson, S. and Nobes, C. D.
(2003). Rac-dependent trans-endocytosis of ephrinBs regulates
Eph-ephrin contact repulsion. Nat. Cell. Biol.
5, 879-888.[CrossRef][Medline]
Mukouyama, Y. S., Shin, D., Britsch, S., Taniguchi, M. and
Anderson, D. J. (2002). Sensory nerves determine the pattern
of arterial differentiation and blood vessel branching in the skin.
Cell 109,693
-705.[CrossRef][Medline]
Noguera-Troise, I., Daly, C., Papadopoulos, N. J., Coetzee, S.,
Boland, P., Gale, N. W., Lin, H. C., Yancopoulos, G. D. and Thurston, G.
(2006). Blockade of Dll4 inhibits tumour growth by promoting
non-productive angiogenesis. Nature
444,1032
-1037.[CrossRef][Medline]
Pasquale, E. B. (2008). Eph-ephrin
bidirectional signaling in physiology and disease.
Cell 133,38
-52.[CrossRef][Medline]
Pear, W. S. and Radtke, F. (2003). Notch
signaling in lymphopoiesis. Semin. Immunol.
15, 69-79.[CrossRef][Medline]
Poliakov, A., Cotrina, M. and Wilkinson, D. G.
(2004). Diverse roles of eph receptors and ephrins in the
regulation of cell migration and tissue assembly. Dev.
Cell 7,465
-480.[CrossRef][Medline]
Poole, T. J. and Coffin, J. D. (1988).
Developmental angiogenesis: quail embryonic vasculature. Scanning
Microsc. 2,443
-448.[Medline]
Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J.,
MacDonald, H. R. and Aguet, M. (1999). Deficient T cell fate
specification in mice with an induced inactivation of Notch1.
Immunity 10,547
-558.[CrossRef][Medline]
Ridgway, J., Zhang, G., Wu, Y., Stawicki, S., Liang, W. C.,
Chanthery, Y., Kowalski, J., Watts, R. J., Callahan, C., Kasman, I. et al.
(2006). Inhibition of Dll4 signalling inhibits tumour growth by
deregulating angiogenesis. Nature
444,1083
-1087.[CrossRef][Medline]
Sabin, F. R. (1917). Origin and development of
the primitive vessels of the chick and of the pig. Contrib.
Embryol. 6,61
-124.
Schlaeger, T. M., Bartunkova, S., Lawitts, J. A., Teichmann, G.,
Risau, W., Deutsch, U. and Sato, T. N. (1997). Uniform
vascular-endothelial-cell-specific gene expression in both embryonic.
Proc. Natl. Acad. Sci. USA
94,3058
-3063.
Shawber, C. J. and Kitajewski, J. (2004). Notch
function in the vasculature: insights from zebrafish, mouse and man.
BioEssays 26,225
-234.[CrossRef][Medline]
Shin, D., Garcia-Cardena, G., Hayashi, S., Gerety, S., Asahara,
T., Stavrakis, G., Isner, J., Folkman, J., Gimbrone, M. A., Jr et al.
(2001). Expression of ephrinB2 identifies a stable genetic
difference between arterial and venous vascular smooth muscle as well as
endothelial cells, and marks subsets of microvessels at sites of adult
neovascularization. Dev. Biol.
230,139
-150.[CrossRef][Medline]
Siekmann, A. F. and Lawson, N. D. (2007). Notch
signalling limits angiogenic cell behaviour in developing zebrafish arteries.
Nature 445,781
-784.[CrossRef][Medline]
Suchting, S., Freitas, C., le, Noble, F., Benedito, R., Breant,
C., Duarte, A. and Eichmann, A. (2007). The Notch ligand
Delta-like 4 negatively regulates endothelial tip cell formation and vessel
branching. Proc. Natl. Acad. Sci. USA
104,3225
-3230.
Torres-Vazquez, J., Kamei, M. and Weinstein, B. M.
(2003). Molecular distinction between arteries and veins.
Cell Tissue Res. 314,43
-59.[CrossRef][Medline]
Uyttendaele, H., Ho, J., Rossant, J. and Kitajewski, J.
(2001). Vascular patterning defects associated with expression of
activated Notch4 in embryonic endothelium. Proc. Natl. Acad. Sci.
USA 98,5643
-5648.
Villa, N., Walker, L., Lindsell, C. E., Gasson, J.,
Iruela-Arispe, M. L. and Weinmaster, G. (2001). Vascular
expression of Notch pathway receptors and ligands is restricted to arterial
vessels. Mech. Dev. 108,161
-164.[CrossRef][Medline]
Visconti, R. P., Richardson, C. D. and Sato, T. N.
(2002). Orchestration of angiogenesis and arteriovenous
contribution by angiopoietins and vascular endothelial growth factor (VEGF).
Proc. Natl. Acad. Sci. USA
99,8219
-8224.
Wang, H. U., Chen, Z. F. and Anderson, D. J.
(1998). Molecular distinction and angiogenic interaction between
embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4).
Cell 93,741
-753.[CrossRef][Medline]
Zhong, T. P., Childs, S., Leu, J. P. and Fishman, M. C.
(2001). Gridlock signalling pathway fashions the first embryonic
artery. Nature 414,216
-220.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
This article has been cited by other articles:
|
|
 |
|
  R. Benedito and R. H. Adams Aorta's Cardinal Secret Science, October 9, 2009; 326(5950): 242 - 243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Herbert, J. Huisken, T. N. Kim, M. E. Feldman, B. T. Houseman, R. A. Wang, K. M. Shokat, and D. Y. R. Stainier Arterial-Venous Segregation by Selective Cell Sprouting: An Alternative Mode of Blood Vessel Formation Science, October 9, 2009; 326(5950): 294 - 298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Weinsheimer, H. Kim, L. Pawlikowska, Y. Chen, M. T. Lawton, S. Sidney, P.-Y. Kwok, C. E. McCulloch, and W. L. Young EPHB4 Gene Polymorphisms and Risk of Intracranial Hemorrhage in Patients With Brain Arteriovenous Malformations Circ Cardiovasc Genet, October 1, 2009; 2(5): 476 - 482. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
