|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 16 October 2008
doi: 10.1242/dev.024034
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Hubrecht Institute, KNAW & University Medical Centre Utrecht, 3584 CT
Utrecht, The Netherlands.
2 Department of Biological Sciences, National University of Singapore, 117543
Singapore.
3 Exelixis, San Francisco, CA, USA.
4 Wageningen University, Experimental Zoology Group, 6709 PG Wageningen, The
Netherlands.
* Author for correspondence (e-mail: s.schulte{at}niob.knaw.nl)
Accepted 15 September 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Cyp26b1, Osteoblast, Osteogenesis, Retinoic acid, Zebrafish
| INTRODUCTION |
|---|
|
|
|---|
In mice, a Cyp26a1 knockout that exhibits spina bifida and tail
truncation as a consequence of patterning defects, and also shows homeotic
transformations of anterior vertebrae has been described
(Abu-Abed et al., 2001
;
Sakai et al., 2001
), whereas
Cyp26b1 knockout mouse embryos display craniofacial defects and
reduced limbs (Yashiro et al.,
2004
). Homozygous mutants die immediately after birth owing to
respiratory distress before vertebral defects become obvious, and hence no
other bone defects have been reported. In zebrafish, the effects of Cyp26
enzymes have been studied in the context of hindbrain
(Emoto et al., 2005
;
Hernandez et al., 2007
;
White et al., 2007
) and neural
crest patterning (Reijntjes et al.,
2007
).
In this study, we have characterized a zebrafish mutant in cyp26b1, which exhibits severe over-ossification of the vertebral column. In both zebrafish and mouse, we report expression of cyp26b1 in osteoblasts of the pre-vertebrae regions. We suggest that it is the tight regulation of RA within osteoblasts by Cyp26b1 activity that is crucial for axial osteogenesis.
In zebrafish and medaka, which are considered to have highly similar modes
of axial skeleton ossification (Inohaya et
al., 2007
), vertebrae form by intramembranous ossification without
passing through a cartilage stage
(Ekanayake and Hall, 1987
;
Fleming et al., 2004
). It has
been suggested for both species that notochord cells are involved in the
initial bone matrix formation of the centra during development of the
vertebral column (Fleming et al.,
2004
; Inohaya et al.,
2007
). However, Inohaya et al.
(Inohaya et al., 2007
) could
also show that sclerotome-derived progenitor cells differentiate into
osteoblasts on the surface of the notochordal sheath, where they produce and
mineralize bone matrix: this matrix is formed by cells distal to the
notochord. Subsequent vertebral growth then proceeds from the anterior and
posterior edges of the forming centra.
Until now, several in vitro studies have reported effects of RA exposure on
mineralization, however, with contradicting results. Some studies describe an
increase in mineralization (Skillington et
al., 2002
; Wang and Kirsch,
2002
; Song et al.,
2005
; Yamashita et al.,
2005
; Malladi et al.,
2006
; Wan et al.,
2007
), whereas others report a suppression of cell differentiation
and therefore a decrease in mineralization
(Cohen-Tanugi and Forest, 1998
;
Iba et al., 2001
) upon RA
treatment of cultured cells. Here, we establish an in vivo model to follow
early osteoblasts. We show that, upon RA treatment, axial osteoblasts in
osterix:nuGFP transgenic zebrafish retain their normal positions.
Moreover, osteoblast numbers do not change. Therefore, over-ossification of
the axial skeleton upon RA excess is most probably caused by increased
activity of osteoblasts along the vertebral column.
| MATERIALS AND METHODS |
|---|
|
|
|---|
BAC recombineering
YFP was recombined directly after the ATG site of the gene of interest on a
BAC clone, containing the genomic information of the gene of interest
(Kimura et al., 2006
). The
following BACs and primers were used: DKEY-53014 (containing 73.5 kb upstream
of the cyp26b1 coding region, and >73.5 kb downstream of
cyp26b1); Cyp26b1_GFP_fw
(ttgctcatcactccaaagagatatttgagacaagtccccggacgttcacaACCATGGTGAGCAAGGGCGAGG AG);
Cyp26b1_Neo_rev
(cacgcagccagcgtcgccaacgccgagacaaggtcaaaactctcgaagagTCAGAAGAACTCGTCAAGAAGGCG);
and CH211-51D23 (containing 111.6 kb upstream of the osx-coding
region, and 66.3 kb downstream of osx); Osx_GFP_fw
(cagctctcctctcccgcttttggattgaccctcactggactgcttcctccACCATGGTGAGCAAGGGCGAGGAG);
and Osx_Neo_rev (gcagctgtgagatcgcagtgagttttccgtacctccagaatcgacgc
ggcTCAGAAGAACTCGTCAAGAAGGCG).
Meiotic mapping
The stocksteif mutation was mapped to linkage group 7 using
standard simple sequence length polymorphism mapping. The following six
primers were used for fine mapping: R3.2-fw (5' ACCGTAATTGAAACCACGTC
3'), R3.2-rv (5' GCCAAATATTTCGATCTGTG 3'), R1.11-fw
(5' GATGCTCAGACCTGTGTTTG 3'), R1.11-rv (5'
TGAAGTCAATGCTGGTCAAC 3'), R2.22-fw (5' TCACCCTTCCATGAACTTAAC
3') and R2.22-rv (5' AAACAGCCAGCGTAGATAAAC 3').
Skeletal staining
Embryos were fixed in 3.5% formaldehyde/0.1 M sodium phosphate buffer for 1
hour and stored in 70% methanol. The protocol for simultaneous bone and
cartilage staining was adapted from that previously described
(Walker and Kimmel, 2007
).
Briefly, embryos were rinsed in 50% ethanol and subsequently stained with 0.2
mg/ml Alcian Blue 8 GX (Sigma) in 70% ethanol/80 mM MgCl2. After
washes in 0.02% Triton, embryos were bleached in 1%
H2O2/1% KOH for 30 minutes, washed in a saturated sodium
tetraborate solution, and digested for 1 hour in 1 mg/ml trypsin (Sigma) in
60% saturated sodiumtetraborate. Bones were stained with 0.04 mg/ml Alizarin
red S (Sigma) in 1% KOH. Destaining was carried out in an increasing glycerol
series (10%, 30%, 70%) and specimens were stored at 4°C in 70%
glycerol.
For Alizarin Red staining only, the Alcian Blue step was omitted. Juvenile fish were fixed for 2 hours, incubated in acetone to remove fat (up to 24 hours) and digested with 10 mg/ml trypsin in 60% sodiumtetraborate overnight. Scales were removed manually. In vivo skeletal staining was carried out with 0.001% calcein (Sigma) in embryo water for at least 2 days.
Pharmacological treatments
Stock solutions of 10 mM all-trans retinoic acid (Sigma) and 10 mM R115866
(Janssen Pharmaceutica) in DMSO were diluted in embryo medium. Sibling
controls were incubated in corresponding dilutions of DMSO. RA treatments were
carried out in the dark and solutions were changed every
12 hours.
MicroCT scans
Fixed samples were wrapped in parafilm and scanned with a Skyscan 1072
microCT system at 80 kV and 100 µA. The cubic voxelsize was 6.08 µm for
the wild type and 2.73 µm for the stocksteif animals. The scans
were reconstructed and subsequently segmented as previously described
(Feldkamp et al., 1984
;
Waarsing et al., 2004
). The
segmented images were visualized as a surface using a custom-written Matlab
7.3 script.
In situ hybridization
For all sectioned zebrafish material, in situ hybridization was carried out
first on whole-mount embryos
(Schulte-Merker, 2002
), and
only subsequently were embryos embedded in 3% agarose and cut (100 µm
sections) on a vibrotome (Microm HM650V), or embedded in plastic and cut (10
µm sections) on a microtome (Leica RM2035). For sections of mouse material,
paraffin-embedded embryos were sectioned then hybridized in situ, according to
standard procedures (Moorman et al.,
2001
).
| RESULTS |
|---|
|
|
|---|
To assess whether the phenotypic effects might be due to early patterning defects, we performed in situ hybridization for somitic markers (myoD, smad1), which did not show any differences between mutants and siblings (data not shown).
In a few exceptional cases, mutants survived when separated early from their siblings, until a maximum age of 6 months. These mutants remain smaller (Fig. 1B), have problems swimming and exhibit a protruding jaw (Fig. 1C). In skeletal preparations, most centra appear fused, and only about five distinct intervertebral boundaries can be observed along the body axis (Fig. 1C). Neural and haemal arches both exhibit fan-shaped expansions (Fig. 1C). Furthermore, the angles of the arches with respect to the body axis are more irregular and obtuse in mutants than in siblings. The phenotype is not restricted to the vertebral column at this later stage: hypurals partially fuse in the tail, and the head skeleton shows abnormalitites as well (Fig. 1C). Phenotypic analysis of 3-, 6- and 9-week-old mutants showed that the severity of bone defects increases over time with the older mutants exhibiting the broadest arches (data not shown).
MicroCT scans demonstrate that in sst mutants excess bone can replace the notochord by proximal growth, leading to completely solid centra (Fig. 1D), whereas the notochord remains present as a continuous rod in the vertebral column of wild-type siblings (see Fig. S1 and S2 in the supplementary material).
stocksteif encodes cyp26b1
In order to molecularly identify the stocksteif locus, we
positionally cloned the gene. The mutation mapped to linkage group 7
(Fig. 2A). Fine mapping
identified two flanking markers on BAC clone zC197C14. In 839 embryos tested,
R3.2 left two recombinants (<0.2 cM) and R1.11 left one recombinant
(<0.1 cM). The single gene enclosed by both markers is cyp26b1.
Sequence analysis of the coding region of cyp26b1, as well as
exon-intron-boundaries revealed no mutations causing amino acid alterations.
Indeed, the sequence of mutant cyp26b1 cDNA also showed no base
changes.
To obtain additional alleles of sst, we performed a reverse
genetic screen (Wienholds et al.,
2002
). One allele, a nonsense mutation in exon 1, is predicted to
change a lysine to a stop codon at position 46 (K46STOP;
sstsa0002) out of 512 amino acids in the putative
wild-type protein. Another allele, a splice donor mutation
(sstsa0003), changes the most 5' nucleotide of
intron 2 from G to A (Fig. 2B),
probably resulting in deficient splicing of this intron and consequently a
full knockout of the encoded protein. Fig.
2C,D show Alizarin Red stained progeny from a cross between the
two original sstsa0002 and sstsa0003
founders. Identical stainings were also obtained for transheterozygous embryos
from crosses between sstsa0002 and
sstt24295 carriers, and homozygous mutant embryos for both
newly obtained alleles, sstsa0002 and
sstsa0003 (data not shown).
As described above, we have been able to raise a few homozygous mutants from the original sstt24295 allele. By contrast, all transheterozygous embryos (both sstsa0002/sstsa0003 and sstsa0002/sstt24295), as well as the homozygous embryos for sstsa0002 and sstsa0003 die around day 8 of development, without developing a swim bladder. In addition to the over-ossification of the vertebral column, these mutants also exhibit a protruding jaw and lack some tissue dorsal to the ethmoid plate (Fig. 2C',D',E-G). The cartilage derived ethmoid plate itself (asterisk in Fig. 2G) is reduced in size and shows a more narrow morphology in homozygous sstsa0002 and sstsa0003 mutants than in siblings.
|
In situ hybridization for cyp26b1 showed that expression levels in homozygous mutants are upregulated in comparison with siblings (see Fig. S4H,I in the supplementary material), suggesting a positive-feedback response to increased RA levels.
In summary, this shows that cyp26b1 deficiency leads to cranial cartilage defects. By contrast, bone structures are not affected in the head at this stage, but show severe over-ossification in the trunk.
Cyp26b1 is expressed in osteoblasts
To further understand the role of Cyp26b1 in ossification, we examined its
expression pattern both in zebrafish and mice. In zebrafish, we confirmed
previously reported cyp26b1 expression up to 72 hpf
(Zhao et al., 2005
) in the
head region, covering expression in the hindbrain, branchial arches and
pectoral fins (Fig. 3A, see
Fig. S4A-C in the supplementary material). In addition, we here show that
previously unreported expression can also be found in bone elements [examples
are shown in Fig. 3A
(cleithrum), Fig. S4E (operculum) and Fig. S4F,G in the supplementary material
(parasphenoid)]. Moreover, we report a segmented pattern in the area
surrounding the notochord that is most clearly visible in sst mutants
because of their upregulated cyp26b1 levels
(Fig. 3B). To determine whether
the latter staining represents expression in sclerotome-derived cells, we
compared cyp26b1 expression with that of twist
(Fig. 3C,D), which has been
shown to be specific, within the somites, for sclerotome in zebrafish
(Morin-Kensicki and Eisen,
1997
) as well as in medaka
(Renn et al., 2006
).
Expression patterns of cyp26b1 and twist do correspond with
one another, indicating that cyp26b1 in zebrafish is expressed in
sclerotome-derived cells.
To investigate whether cyp26b1 is expressed in osteoblasts, we first generated a new transgenic zebrafish reporter line, in which mCherry expression is controlled by the medaka osterix promoter (Renn and Winkler, unpublished). Briefly, in transgenic larvae, osterix:mCherry-positive cells in the head are seen in all intramembranous bones, such as parasphenoid and cleithrum, and later in the operculum and branchiostegal rays, as well as in endochondral bones (data not shown).
In order to compare osterix expression with cyp26b1 expression in vivo, we recombined YFP into a BAC clone that contained the genomic sequence of cyp26b1. This construct was injected into one-cell stage Tg(osx:mCherry) embryos. Because in these transient assays not all cells will incorporate the cyp26b1:YFP construct, we expected patchy cyp26b1:YFP expression. Indeed, we were able to detect single YFP-positive cells in osx:mCherry positive bone elements (Fig. 3F-K). In various embryos that we have analyzed, we have only seen YFP expression in places where we had previously observed cyp26b1 mRNA expression. Ectopic expression was never observed. We conclude that cyp26b1 is expressed in osteoblasts.
In mice, Cyp26b1 is expressed during early embryonic development
in the hindbrain, neural tube, craniofacial structures, in outgrowing limb
buds (MacLean et al., 2001
)
and in the pre-vertebrae regions at E12.5 and E14.5
(Abu-Abed et al., 2002
). We
confirm and extend these findings by showing that also in mice it is the
condensing sclerotome surrounding the notochord that expresses
Cyp26b1 (Fig. 4B,C),
as in zebrafish.
Furthermore, in situ hybridizations on consecutive sections using probes against Cyp26b1 and Osterix show expression of both genes in overlapping regions of the mouse axial skeleton (Fig. 4D-G). Vertebrae are formed in an anterior-posterior progression with more posterior vertebrae being less mature than anterior ones. Cyp26b1 is expressed in all forming vertebrae, including the most posterior ones (arrows in Fig. 4D), whereas Osterix is expressed only in the most mature vertebrae (Fig. 4F). Thus, Cyp26b1 expression precedes Osterix expression.
|
In vivo observations of axial osterix expression
In the course of these studies, we noticed that in zebrafish axial
osterix expression could be detected only at points in time when
neural and haemal arches were about to appear at day 17
(Fleming et al., 2004
) (K.M.S.
and S.S.-M., unpublished). We have failed to detect osterix mRNA in
the axis prior to this point in time. This suggests that cells that form the
calcified material of the centra do not express osterix at these
stages in zebrafish.
Further support for this notion stems from the analysis of a transgenic zebrafish line, in which mCherry is controlled by the medaka osterix promoter. Here, we only detect mCherry-positive cells in the arches and at the anterior and posterior edges of the forming vertebrae, but not in the central part of the centra at this stage. Expression could be detected only shortly prior to the formation of neural and haemal arches (see Fig. 6A-D). To confirm that this is not a limitation of the transgene, we have recombined YFP into a BAC containing the zebrafish osterix gene. Again, after injections of this construct in one-cell stage embryos, we were able to detect expression only in cranial bone and, after day 17, in haemal and neural arches. The main bodies of the centra, however, were always devoid of YFP expression in these transient expression assays (data not shown). Both transgenic lines show identical results and exhibit expression patterns identical to those we observe with osterix mRNA in situ.
|
|
Treatment of wild-type embryos with either retinoic acid or R115866 phenocopies the stocksteif mutant phenotype
As sst mutants lack Cyp26b1 activity and therefore should have at
least a local excess of RA, we asked whether RA treatment of wild-type embryos
can phenocopy the mutant phenotype. Treatments were started at day 4 or later
to avoid defects associated with early RA treatments of embryos
(Keegan et al., 2005
;
Hernandez et al., 2007
;
Reijntjes et al., 2007
).
Wild-type embryos were treated with 1 µM RA starting at day 4, 5, 6 or 7 of
development. At 8 dpf, Alizarin Red staining was performed. Sibling controls
received equivalent treatments of DMSO, with no detectable effect on
ossification. RA treatments, however, resulted in three phenotypic classes,
all exhibiting axial over-ossification, with the most severe one completely
mimicking the sst mutant phenotype
(Fig. 5A). As shown in
Fig. 5B, all embryos for which
treatment was started at 4 dpf showed a phenotype, with 35% exhibiting a
completely over-ossified notochord. For treatments started at 5 dpf and 6 dpf,
respectively, 90% and 70% showed a phenotype. Embryos treated for 24 hours
with RA onwards from day 7 were indistinguishable from controls, presumably as
24 hours were insufficient to allow for mineralization to occur.
To investigate more specifically the effect of aberrant Cyp26b1 function,
we treated wild-type embryos with 0.5 µM of the R115866 compound, a
selective antagonist for the three Cyp26 enzymes
(Hernandez et al., 2007
).
Treatments were identical, and results near-identical to the described RA
treatments: all embryos for which treatment was started at day 4 showed a
phenotype resembling the sst mutant
(Fig. 5C).
Osteoblast numbers do not alter upon retinoic acid treatment
Obvious explanations for the observed phenotype would be mislocalization of
osteoblasts, an increased number of osteoblasts or increased osteoblast
activity. In order to distinguish between these scenarios, and in order to
quantify precisely osteoblasts in vivo, we established, next to the described
osterix:mCherry line, an additional line with nuclear GFP
(nuGFP) controlled by the medaka osterix promoter region.
Unfortunately, because even the hypomorphic sstt24295
allele is near-lethal, we have not been able to obtain homozygous
sstt24295 larvae in this transgenic background. Therefore,
we decided to visualize directly the response of osteoblasts to excess RA in
the osterix:nuGFP zebrafish line.
|
Next, we performed cell counts. Although in projections of confocal scans it is not always clear whether a spot of GFP expression refers to one or more nuclei, nuclei of separate cells can be clearly distinguished from each other in single confocal scans [e.g. the encircled spot in one projection (Fig. 6J) was resolved to represent two cells in a single scan (Fig. 6K)]. Furthermore, cells that are seen in projections but belong to arches at the other side of the embryo can be discriminated in single scans [examples of such cells are indicated with arrows in projections (Fig. 6J,M)]. Therefore, all cell counts were carried out in single confocal scans. In at least five different larvae per condition, several segments were counted (schematic representation of counted area is seen in Fig. 6O). As shown in Fig. 6P, there is no significant difference in numbers of osterix:nuGFP-positive cells between DMSO controls and RA-treated larvae. In conclusion, RA treatment of embryos from 17 to 20 dpf does not alter localization of mature osterix-expressing osteoblasts or their numbers.
| DISCUSSION |
|---|
|
|
|---|
In a few exceptional cases, we have been able to raise homozygous mutants of the original sstt24295 allele to a later stage in life. Phenotypic analysis of larvae at different ages showed that the severity of bone defects increases over time, indicating that the gene affected in sst mutants is crucial for controlling proper ossification not only during embryogenesis, but also in late larval and adult stages. We suggest that sst activity is required throughout life to control osteogenesis, at least in axial skeletogenesis. This notion is supported by the late RA treatments we performed (17-20 dpf), which also resulted in axial over-ossification, indicating sensitivity to RA at late larval stages.
Hypomorphic and loss-of-function mutants for cyp26b1
Positional cloning of sstt24295 revealed two flanking
markers enclosing the retinoic acid metabolizing gene cyp26b1, but no
causative mutation could be found in this allele.
In order to identify additional alleles, we undertook a reverse genetic screen. We obtained two additional alleles of sst, both of which fail to complement the original sstt24295 allele. We focus in this study on sstsa0002, which encodes a nonsense mutation in exon 1, predicted to change a lysine to a stop codon at position 46 (K46STOP; sstsa0002) of the protein. As this will truncate the protein even N-terminal to the cytochrome P450 domain (at amino acid 50), we conclude that this allele encodes a loss-of-function allele.
When comparing the sstt24295 and the sstsa0002 allele, there are a number of noteworthy differences. First, all sstsa0002 mutants die shortly after hatching, whereas we have been able to raise very few sstt24295 homozygotes to late larval and adult stages. Second, when examining the head cartilage, sstt24295 does not show alterations when compared with wild-type siblings, whereas the sstsa0002 allele shows a protruding jaw and a reduced and misshapen ethmoid plate. Both lines of evidence suggest that sstt24295 is a hypomorph and that it represents a slightly weaker allele than sstsa0002. The observed jaw phenotype is most likely the reason for early lethality in the strong alleles and correlates with the adult head skeleton phenotype that we find in the hypomorphic sstt24295 allele (Fig. 1C).
In the original stocksteif allele, we also observe
over-ossification of neural and haemal arches, whereas the other two
sst alleles die too early to analyze arch formation. In mice, similar
arch phenotypes can be observed by treatments with the Cyp26 inhibitor
R115866, which results in over-ossification and fusion of arches of treated
embryos (Laue et al., 2008
).
This suggests a conserved role for the function of Cyp26b1 among
vertebrates.
|
Jaw phenotypes mimicking what we observe in both embryonic and adult
cyp26b1 mutants were not described in Cyp26a1 mutant mice
(Abu-Abed et al., 2001
;
Sakai et al., 2001
). The
Cyp26a1 mouse phenotype therefore is clearly distinct from what we
observe in zebrafish cyp26b1 mutants. Moreover, expression patterns
of both genes are also distinct from each other: compared with Cyp26b1,
Cyp26a1 expression is restricted to the extremities of the vertebral
arches and ribs, and has not been detected in the pre-vertebrae regions
(Abu-Abed et al., 2002
).
We conclude that stocksteif manifests a novel phenotype, which allows new insight into the function of cyp26b1 and retinoid signalling during vertebral ossification.
Retinoic acid treatment leads to axial over-ossification
Pharmacological treatments with either RA itself or the Cyp26 inhibitor
R115866 completely phenocopy the stocksteif over-ossification
phenotype, demonstrating a role for RA in ossification of the vertebral
column. We propose that it is the regulation of Cyp26b1 activity, which
defines local concentrations of RA within the vertebral area. Disruption of
the gene or altered RA levels result in over-ossification along the vertebral
column, most probably due to a local excess of RA within osteoblasts.
To support this notion, we examined the axial expression of Cyp26b1 in zebrafish and mice. Localization of Cyp26b1 transcripts in both species was found abutting the notochord, and comparison with zebrafish twist expression suggests that Cyp26b1 is indeed expressed in sclerotome-derived cells of both teleosts and mammals. Furthermore, in both zebrafish and mice, we could clearly establish that Cyp26b1 is expressed in cells that also express osterix (Fig. 3F-K; Fig. 4D-G). Therefore, we suggest that Cyp26b1 activity controls RA levels within osteoblasts, possibly setting up a boundary of low versus high RA levels between cells that express Cyp26b1 and those that do not.
Evidence for two populations of osteoblasts
In zebrafish, we have never been able to detect osterix expression
in the axial skeleton before arches appear, neither by in situ hybridization
nor in the described transgenic lines. However, there is mineralized matrix
present, as visualized by Alizarin Red or calcein staining, raising the issue
of which cells are responsible for initial ossification of the very earliest
centrum material. We suggest the existence of two types of osteoblasts: both
are osteoblasts in the functional sense of secreting matrix that is then
mineralized. However, one group does not express osterix, whereas the
other group does. The latter group includes the osteoblasts of the future head
skeleton, the vertebral arches and late-appearing osteoblasts at the anterior
and posterior edges of the centra (Fig.
6A,C). The osterix-negative cells provide the initial
material of the centrum body.
Further evidence for this hypothesis stems from Fleming et al.
(Fleming et al., 2004
), who
were never able to detect osteoblasts in centrum bone matrix, whereas they
could detect them in developing skull bones. It remains to be seen whether the
osterix-negative cells are identical to cells of the notochord, which
are postulated by Fleming et al. (Fleming
et al., 2004
) to initiate centrum formation.
Finally, it is interesting to note that osterix (Sp7)-null mutant
mice are born with mineralized centra, whereas they lack almost all
craniofacial bone elements (Nakashima et
al., 2002
). Although it is possible that centrum osteoblasts in
mice express osterix, but do not require it for osteoblast function, it does
point to a difference between centrum osteoblasts and all other
osteoblasts.
Effects of retinoic acid on osteoblast activity
We considered three models that may explain why excess RA results in
over-ossification: (1) RA causes ectopic bone formation by mis-positioning of
osteoblasts; (2) RA causes an increase in osteoblast number; or (3) RA
increases the activity of osteoblasts while not affecting their number.
To distinguish between these mechanisms, we made use of a zebrafish osterix:nuGFP transgenic reporter line, in order to directly visualize the response of mature osteoblasts to RA. We show that, upon RA treatment, osterix-positive osteoblasts do not change position, nor do they increase in number. We therefore favour the third model and suggest that osteoblasts increase their mineralization activity upon exposure to excess RA.
As at present there is no marker available for the putative osterix-negative osteoblasts in the centra, we are unable to assess whether RA also acts on this type of osteoblasts. It is noteworthy that skeletons of the adult hypomorphic sst mutants show over-ossification at precisely the sites where we do see osterix expression: anterior and posterior edges of the centra, as well as neural and haemal arches. Therefore, our results could be explained by postulating an increase in the activity of osterix-positive osteoblasts for the later aspects of the phenotype. However, we do consider it likely that RA also has an effect on osterix-negative osteoblasts, as the sst phenotype becomes apparent already at day 8 of development.
In the past, conflicting results have been reported about in vitro studies
that have examined the effect of RA on mineralization. An increase in
mineralization was reported (Skillington
et al., 2002
; Wang and Kirsch,
2002
; Song et al.,
2005
; Yamashita et al.,
2005
; Malladi et al.,
2006
; Wan et al.,
2007
), whereas different studies show suppression of cell
differentiation with a concomitant decrease in mineralization
(Cohen-Tanugi and Forest, 1998
;
Iba et al., 2001
) upon RA
treatment of cultured cells. Here, we show in an in vivo setting that RA
increases bone formation and suggest this to occur by an increased activity of
osteoblasts. We have demonstrated that zebrafish offer an attractive model for
performing genetic and pharmacological studies on osteoblasts, allowing in
vivo observations and histological read-outs at the same time. In a field
where the interpretation of in vitro and ex vivo experiments is inherently
difficult, the use of an in vivo model that allows monitoring osteoblasts in
real time will be highly beneficial.
A model for RA activity in axial skeletogenesis
We have shown that systemic treatment of larvae with RA produces phenotypes
very similar to those of cyp26b1 loss of function, even though one
could speculate that mis-regulation of RA in axial osteoblasts causes a more
spatially restricted increase in local RA levels, than exposing all cells to
excess RA. We have incorporated all data presented in this manuscript in the
following model.
In the wild-type situation, expression of Cyp26b1 protein within osteoblasts leads to lower RA levels within cyp26b1-positive cells (i.e. osteoblasts) than in neighbouring cells that do not express cyp26b1 (i.e. non-osteoblasts). We propose that the juxtaposition of areas with low versus high RA levels is significant in maintaining cyp26b1-positive cells in a state in which they produce tightly controlled amounts of calcified matrix. Only when cells are exposed to comparatively higher levels of RA, e.g. in cyp26b1 mutants or after exposure to exogenous RA, will they then begin to produce an excess of calcified tissue.
In RA-treated embryos, all cells within the embryo experience high RA levels, and consequently there is no boundary between `RA low' and `RA high' regions. Accordingly, both osterix-negative osteoblasts within the body of the centrum and osterix-positive osteoblasts in the anterior and posterior regions of the centrum produce more matrix, leading to the observed over-ossification phenotype.
In loss-of-function stocksteif mutant embryos, RA levels are not lowered in osteoblasts (or only mildly lowered in the hypomorphic allele), again leading to increased osteoblast activity and resulting in the same events as just described for systemic RA exposure.
Conclusion
In summary, we have shown that regulation of RA levels and the tight
control of Cyp26b1 activity are essential for regulation of skeletogenesis in
zebrafish. Our data demonstrate a previously unappreciated role for RA and
cyp26b1 in osteogenesis of the vertebral column and provide novel
insight into the regulation of bone formation.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/22/3765/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abu-Abed, S., Dolle, P., Metzger, D., Beckett, B., Chambon, P.
and Petkovich, M. (2001). The retinoic acid-metabolizing
enzyme, CYP26A1, is essential for normal hindbrain patterning, vertebral
identity, and development of posterior structures. Genes
Dev. 15,226
-240.
Abu-Abed, S., MacLean, G., Fraulob, V., Chambon, P., Petkovich, M. and Dolle, P. (2002). Differential expression of the retinoic acid-metabolizing enzymes CYP26A1 and CYP26B1 during murine organogenesis. Mech. Dev. 110,173 -177.[CrossRef][Medline]
Avaron, F., Hoffman, L., Guay, D. and Akimenko, M. A. (2006). Characterization of two new zebrafish members of the hedgehog family: atypical expression of a zebrafish indian hedgehog gene in skeletal elements of both endochondral and dermal origins. Dev. Dyn. 235,478 -489.[CrossRef][Medline]
Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J.,
Mamiya, S., Yashiro, K., Chawengsaksophak, K., Wilson, M. J., Rossant, J.,
Hamada, H. and Koopman, P. (2006). Retinoid signaling
determines germ cell fate in mice. Science
312,596
-600.
Cohen-Tanugi, A. and Forest, N. (1998). Retinoic acid suppresses the osteogenic differentiation capacity of murine osteoblast-like 3/A/1D-1M cell cultures. Differentiation 63,115 -123.[CrossRef][Medline]
Ekanayake, S. and Hall, B. K. (1987). The development of acellularity of the vertebral bone of the Japanese medaka, Oryzias latipes (Teleostei; Cyprinidontidae). J. Morphol. 193,253 -261.[CrossRef][Medline]
Emoto, Y., Wada, H., Okamoto, H., Kudo, A. and Imai, Y. (2005). Retinoic acid-metabolizing enzyme Cyp26a1 is essential for determining territories of hindbrain and spinal cord in zebrafish. Dev. Biol. 278,415 -427.[CrossRef][Medline]
Feldkamp, L. A., Davis, L. C. and Kress, J. W. (1984). Practical cone-beam algorithm. J. Opt. Soc. Am. A 1,612 -619.[CrossRef]
Fleming, A., Keynes, R. and Tannahill, D.
(2004). A central role for the notochord in vertebral patterning.
Development 131,873
-880.
Grandel, H. and Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio). Mech. Dev. 79,99 -120.[CrossRef][Medline]
Gu, X., Xu, F., Wang, X., Gao, X. and Zhao, Q. (2005). Molecular cloning and expression of a novel CYP26 gene (cyp26d1) during zebrafish early development. Gene Expr. Patterns 5,733 -739.[CrossRef][Medline]
Hernandez, R. E., Putzke, A. P., Myers, J. P., Margaretha, L.
and Moens, C. B. (2007). Cyp26 enzymes generate the retinoic
acid response pattern necessary for hindbrain development.
Development 134,177
-187.
Iba, K., Chiba, H., Yamashita, T., Ishii, S. and Sawada, N. (2001). Phase-independent inhibition by retinoic acid of mineralization correlated with loss of tetranectin expression in a human osteoblastic cell line. Cell Struct. Funct. 26,227 -233.[CrossRef][Medline]
Inohaya, K., Takano, Y. and Kudo, A. (2007). The teleost intervertebral region acts as a growth center of the centrum: in vivo visualization of osteoblasts and their progenitors in transgenic fish. Dev. Dyn. 236,3031 -3046.[CrossRef][Medline]
Kawakami, K., Koga, A., Hori, H. and Shima, A. (1998). Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio. Gene 225, 17-22.[CrossRef][Medline]
Keegan, B. R., Feldman, J. L., Begemann, G., Ingham, P. W. and
Yelon, D. (2005). Retinoic acid signaling restricts the
cardiac progenitor pool. Science
307,247
-249.
Kimura, Y., Okamura, Y. and Higashijima, S.
(2006). alx, a zebrafish homolog of Chx10, marks ipsilateral
descending excitatory interneurons that participate in the regulation of
spinal locomotor circuits. J. Neurosci.
26,5684
-5697.
Laue, K., Jänicke, M., Plaster, N., Sonntag, C. and
Hammerschmidt, M. (2008). Restriction of retinoic acid
activity by Cyp26b1 is required for proper timing and patterning of
osteogenesis during zebrafish development. Development
135,3775
-3787.
MacLean, G., Abu-Abed, S., Dolle, P., Tahayato, A., Chambon, P. and Petkovich, M. (2001). Cloning of a novel retinoic-acid metabolizing cytochrome P450, Cyp26B1, and comparative expression analysis with Cyp26A1 during early murine development. Mech. Dev. 107,195 -201.[CrossRef][Medline]
Maden, M. (2002). Retinoid signalling in the development of the central nervous system. Nat. Rev. Neurosci. 3,843 -853.[CrossRef][Medline]
Malladi, P., Xu, Y., Yang, G. P. and Longaker, M. T. (2006). Functions of vitamin D, retinoic acid, and dexamethasone in mouse adipose-derived mesenchymal cells. Tissue Eng. 12,2031 -2040.[CrossRef][Medline]
Moorman, A. F., Houweling, A. C., de Boer, P. A. and
Christoffels, V. M. (2001). Sensitive nonradioactive
detection of mRNA in tissue sections: novel application of the whole-mount in
situ hybridization protocol. J. Histochem. Cytochem.
49, 1-8.
Morin-Kensicki, E. M. and Eisen, J. S. (1997). Sclerotome development and peripheral nervous system segmentation in embryonic zebrafish. Development 124,159 -167.[Abstract]
Nakashima, K., Zhou, X., Kunkel, G., Zhang, Z., Deng, J. M., Behringer, R. R. and de Crombrugghe, B. (2002). The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 108, 17-29.[CrossRef][Medline]
Nelson, D. R. (1999). A second CYP26 P450 in humans and zebrafish: CYP26B1. Arch. Biochem. Biophys. 371,345 -347.[CrossRef][Medline]
Reijntjes, S., Rodaway, A. and Maden, M. (2007). The retinoic acid metabolising gene, CYP26B1, patterns the cartilaginous cranial neural crest in zebrafish. Int. J. Dev. Biol. 51,351 -360.[CrossRef][Medline]
Rembold, M., Lahiri, K., Foulkes, N. S. and Wittbrodt, J. (2006). Transgenesis in fish: efficient selection of transgenic fish by co-injection with a fluorescent reporter construct. Nat. Protocols 1,1133 -1139.[CrossRef]
Renn, J., Schaedel, M., Volff, J. N., Goerlich, R., Schartl, M. and Winkler, C. (2006). Dynamic expression of sparc precedes formation of skeletal elements in the Medaka (Oryzias latipes). Gene 372,208 -218.[CrossRef][Medline]
Ross, S. A., McCaffery, P. J., Drager, U. C. and De Luca, L.
M. (2000). Retinoids in embryonal development.
Physiol Rev. 80,1021
-1054.
Sakai, Y., Meno, C., Fujii, H., Nishino, J., Shiratori, H.,
Saijoh, Y., Rossant, J. and Hamada, H. (2001). The retinoic
acid-inactivating enzyme CYP26 is essential for establishing an uneven
distribution of retinoic acid along the anterio-posterior axis within the
mouse embryo. Genes Dev.
15,213
-225.
Schulte-Merker, S. (2002). Looking at embryos. In Zebrafish, A Practical Approach (ed. C. Nüsslein-Volhard and R. Dahm), pp. 41-43. New York: Oxford University Press.
Skillington, J., Choy, L. and Derynck, R.
(2002). Bone morphogenetic protein and retinoic acid signaling
cooperate to induce osteoblast differentiation of preadipocytes. J.
Cell Biol. 159,135
-146.
Song, H. M., Nacamuli, R. P., Xia, W., Bari, A. S., Shi, Y. Y., Fang, T. D. and Longaker, M. T. (2005). High-dose retinoic acid modulates rat calvarial osteoblast biology. J. Cell Physiol. 202,255 -262.[CrossRef][Medline]
van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al. (1996). Mutations affecting somite formation and patterning in the zebrafish, Danio rerio. Development 123,153 -164.[Abstract]
Waarsing, J. H., Day, J. S. and Weinans, H. (2004). An improved segmentation method for in vivo microCT imaging. J. Bone Miner. Res. 19,1640 -1650.[CrossRef][Medline]
Walker, M. B. and Kimmel, C. B. (2007). A two-color acid-free cartilage and bone stain for zebrafish larvae. Biotech. Histochem. 82,23 -28.[CrossRef][Medline]
Wan, D. C., Siedhoff, M. T., Kwan, M. D., Nacamuli, R. P., Wu, B. M. and Longaker, M. T. (2007). Refining retinoic acid stimulation for osteogenic differentiation of murine adipose-derived adult stromal cells. Tissue Eng. 13,1623 -1631.[CrossRef][Medline]
Wang, W. and Kirsch, T. (2002). Retinoic acid
stimulates annexin-mediated growth plate chondrocyte mineralization.
J. Cell Biol. 157,1061
-1069.
White, J. A., Guo, Y. D., Baetz, K., Beckett-Jones, B.,
Bonasoro, J., Hsu, K. E., Dilworth, F. J., Jones, G. and Petkovich, M.
(1996). Identification of the retinoic acid-inducible
all-trans-retinoic acid 4-hydroxylase. J. Biol. Chem.
271,29922
-29927.
White, J. A., Ramshaw, H., Taimi, M., Stangle, W., Zhang, A.,
Everingham, S., Creighton, S., Tam, S. P., Jones, G. and Petkovich, M.
(2000). Identification of the human cytochrome P450, P450RAI-2,
which is predominantly expressed in the adult cerebellum and is responsible
for all-transretinoic acid metabolism. Proc. Natl. Acad. Sci.
USA 97,6403
-6408.
White, R. J., Nie, Q., Lander, A. D. and Schilling, T. F. (2007). Complex regulation of cyp26a1 creates a robust retinoic acid gradient in the zebrafish embryo. PLoS Biol. 5, e304.[CrossRef][Medline]
Wienholds, E., Schulte-Merker, S., Walderich, B. and Plasterk,
R. H. (2002). Target-selected inactivation of the zebrafish
rag1 gene. Science 297,99
-102.
Yamashita, A., Takada, T., Narita, J., Yamamoto, G. and Torii, R. (2005). Osteoblastic differentiation of monkey embryonic stem cells in vitro. Cloning Stem Cells 7, 232-237.[Medline]
Yashiro, K., Zhao, X., Uehara, M., Yamashita, K., Nishijima, M., Nishino, J., Saijoh, Y., Sakai, Y. and Hamada, H. (2004). Regulation of retinoic acid distribution is required for proximodistal patterning and outgrowth of the developing mouse limb. Dev. Cell 6,411 -422.[CrossRef][Medline]
Zhao, Q., Dobbs-McAuliffe, B. and Linney, E. (2005). Expression of cyp26b1 during zebrafish early development. Gene Expr. Patterns 5,363 -369.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
K. Laue, M. Janicke, N. Plaster, C. Sonntag, and M. Hammerschmidt Restriction of retinoic acid activity by Cyp26b1 is required for proper timing and patterning of osteogenesis during zebrafish development Development, November 15, 2008; 135(22): 3775 - 3787. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||