|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online November 7, 2008
doi: 10.1242/10.1242/dev.026229
1 Department of Biological Science, College of Natural Sciences, Daegu
University, Jillyang, Gyeongsan, Gyeongbuk 712-714, South Korea.
2 Department of Animal Biology, School of Veterinary Medicine, University of
Pennsylvania, 3800 Spruce Street, Philadelphia, PA 19104, USA.
* Author for correspondence (e-mail: saintj{at}vet.upenn.edu)
Accepted 2 October 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Fgf8, Wnt8, Bmp, Neural crest, Induction, Xenopus
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). At the time of its induction, the NC-forming region is
flanked by the neural plate on one side and the non-neural ectoderm on the
other, and sits on top of the underlying paraxial mesoderm. Because of their
position relative to the NC, each one of these tissues has been proposed as a
source of NC inducer(s). The relative contribution of these tissues to NC
induction appears to vary greatly from one species to another (reviewed by
Knecht and Bronner-Fraser,
2002; Huang and Saint-Jeannet,
2004).
At least three major signaling pathways have been implicated in NC
induction (reviewed by Jones and Trainor,
2005). Studies in frog and fish have shown that NC forms in
regions of the ectoderm where Bone Morphogenetic Protein (Bmp) signaling is
partially attenuated by Bmp antagonists, such as Chordin, Noggin and
Follistatin, which are derived from the axial mesoderm
(Marchant et al., 1998;
Nguyen et al., 1998;
Tribulo et al., 2003).
However, it is also true that changes in Bmp signaling levels in the ectoderm
are not sufficient for NC induction and that other signaling pathways are
involved (LaBonne and Bronner-Fraser,
1998; Garcia-Castro et al.,
2002). A large body of work indicates that signaling through the
canonical Wnt pathway is crucial to specify the NC in fish, frog and chick
(Saint-Jeannet et al., 1997;
LaBonne and Bronner-Fraser,
1998; Chang and
Hemmati-Brivanlou, 1998; Bang
et al., 1999; Deardorff et
al., 2001; Garcia-Castro et
al., 2002; Lewis et al.,
2004) (reviewed by Wu et al.,
2003; Heeg-Truesdell and
LaBonne, 2007). The source of this Wnt signal has been proposed to
reside in the paraxial mesoderm of frog and fish
(Bang et al., 1999;
Lewis et al., 2004), and in
the ectoderm of birds (Garcia-Castro et
al., 2002). In the mouse, the situation is not as clearly defined.
Genetic analyses suggest that Wnt signaling may have a role in NC lineage
specification, rather than in induction
(Ikeya et al., 1997;
Hari et al., 2002). However,
because of functional redundancy, an earlier role of Wnt in NC formation
cannot be completely excluded.
Studies in Xenopus have shown that members of the Fibroblast
Growth Factor (Fgf) family are also involved in NC induction
(Kengaku and Okamoto, 1993;
Mayor et al., 1995;
Mayor et al., 1997;
Villanueva et al., 2002;
Monsoro-Burq et al., 2003).
Expression of a dominant-negative Fgf receptor blocks NC formation in the
whole embryo (Mayor et al.,
1997) and in animal explants recombined with paraxial mesoderm
(Monsoro-Burq et al., 2003).
Fgf8 is expressed in the paraxial mesoderm and is a likely candidate to
mediate this activity (Monsoro-Burq et
al., 2003). So far, Xenopus is the only model organism in
which Fgf signaling has been implicated in NC induction.
Therefore, in Xenopus, NC induction depends on a Bmp signal, which
must be partially attenuated by Bmp antagonists, and on a separate signal
mediated by either a canonical Wnt or an Fgf. However, it is unclear how Wnt
and Fgf interact at the neural plate border to generate the NC. While there
are suggestions that these pathways might be linked
(LaBonne and Bronner-Fraser,
1998), there is also evidence that they may act independently
(Monsoro-Burq et al., 2003;
Monsoro-Burq et al., 2005). In
this study, we present a comparative analysis of the NC-inducing activity of
Wnt8 and Fgf8a, two candidate NC inducers in Xenopus. Loss- and
gain-of-function studies indicate that these ligands share very similar
properties. Individually, Fgf8a and Wnt8 are both necessary to specify the NC.
By using a number of assays in the whole embryo and in animal explants, we
also show that Fgf8a requires active canonical Wnt signaling to mediate its
activity. Moreover, Fgf8a is a potent inducer of Wnt8 and is required for Wnt8
expression in the paraxial mesoderm. These results indicate that Fgf8a induces
NC indirectly through Wnt8 activation, which suggests that these factors
function in the same pathway to specify the NC.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
Wnt8 (25 pg) (Wolda et al.,
1993), Fgf8a (5 pg)
(Christen and Slack, 1997), and
XFD (2 ng) (Amaya et al.,
1991) mRNA was synthesized in vitro using the Message Machine Kit
(Ambion). Wnt8 (W8MO; AAAGTGGTGTTTTGCATGATGAAGG; 25-50 ng)
(Park and Saint-Jeannet,
2008), β-catenin (βCatMO; 25-50 ng)
(Heasman et al., 2000) and
Fgf8a (F8MO; 50 ng) (Fletcher et al.,
2006) morpholino antisense oligonucleotides were purchased from
Gene-Tools LLC (Philomath, OR). In whole embryo experiments, synthetic mRNAs
and antisense oligonucleotides were injected unilaterally into two-cell-stage
embryos. For Wnt8 and β-catenin, plasmid DNA was injected to avoid axis
duplication (100 pg and 200 pg, respectively). Injected embryos were cultured
in 0.1x normal amphibian medium (NAM). For animal explant experiments,
both blastomeres at the two-cell stage were injected in the animal pole
region, with Wnt8 or Fgf8a mRNA either alone or in
combination with Chordin DNA (10 pg)
(Sasai et al., 1994); explants
were then dissected at the late blastula stage and immediately cultured in
vitro for several hours (5 or 10 hours) in 0.5xNAM. In some experiments,
40 µM of U0126 (Calbiochem) was added to the culture medium to block the
MAPK pathway (Kuroda et al.,
2005). Animal explants were subsequently analyzed by real-time
RT-PCR for the expression of various marker genes
(Hong and Saint-Jeannet,
2007).
Lineage tracing and in situ hybridization
In all experiments, embryos were co-injected with β-gal mRNA
to identify the manipulated side. Embryos at the appropriate stage were fixed
in MEMFA and successively processed for Red-Gal staining (Research Organics)
and in situ hybridization. Antisense DIG-labeled probes (Genius Kit, Roche)
were synthesized using template cDNA encoding Sox8
(O'Donnell et al., 2006),
Snail2 (Mayor et al., 1995),
Sox2 (Mizuseki et al., 1998),
Pax3 (Bang et al., 1997), Ap2
(Luo et al., 2003), Wnt8
(Smith and Harland, 1991),
Fgf8 (Christen and Slack,
1997), Xbra (Smith et al.,
1991) and Sox10 (Aoki et al.,
2003). Whole-mount in situ hybridization was performed as
previously described (Harland,
1991). For in situ hybridization on sections, embryos at stage 12
and 12.5 were fixed in MEMFA for 1 hour and embedded in Paraplast+,
and 12 µm serial sections were hybridized with Sox8, Fgf8 or Wnt8 probes
according to the procedure described by Henry et al.
(Henry et al., 1996). Sections
were briefly counterstained with Eosin.
TUNEL staining
TUNEL staining was carried as described
(Hensey and Gautier, 1998).
Morpholino-injected embryos fixed in MEMFA were rehydrated in PBT and washed
in TdT buffer (Roche) for 30 minutes. End labeling was carried out overnight
at room temperature in TdT buffer containing 0.5 µM DIG-dUTP and 150 U/ml
TdT. Embryos were then washed for 2 hours at 65°C in PBS/1 mM EDTA. DIG
was detected by anti-DIG Fab fragments conjugated to alkaline phosphatase
(Roche; 1:2000) and the chromogenic reaction was performed using NBT/BCIP
(Roche).
Real-time RT-PCR
For each sample, total RNA was extracted from 10 animal explants by using
an RNeasy micro RNA isolation kit (Qiagen) according to the manufacturer's
instructions. During the extraction procedure the samples were treated with
DNase I, to eliminate possible contamination by genomic DNA. The amount of RNA
was quantified by measuring the optical density using a spectrophotometer
(Beckman). Real-time RT-PCR was performed as previously described, using
specific primer sets (Hong and
Saint-Jeannet, 2007). In each case, EF1
was used as an
internal reference (data not shown), and each bar on the histograms has been
normalized to the level of EF1 expression. The histograms in each
figure are presented as mean±s.e.m. of three independent experiments. A
Student's t-test was used to define statistically significant values
in each group.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Monsoro-Burq et al., 2003;
Smith and Harland, 1991;
Bang et al., 1999).
Morpholino-mediated knockdown of Fgf8a or Wnt8 resulted in a similar loss of
NC progenitors at the neurula stage, as determined by the expression of four
NC-specific genes: Pax3, Snail2, Sox8 and Sox10
(Fig. 1A). Often this loss of
the NC tissue was associated with an expansion of the neural plate
(Sox2) on the injected side (Fig.
1A). In these embryos lacking Fgf8a or Wnt8 function, mesoderm
appeared to form normally, as determined by the expression at the gastrula
stage of the general mesoderm marker Xbra
(Fig. 1B). In both knockdowns,
the loss of early NC progenitors resulted into a severe reduction of migrating
NC cells in the branchial arches at the tailbud stage
(Fig. 1C), due to increased
cell death (Fig. 1D). These
results suggest that Fgf8a and Wnt8 are both required for NC formation.
We also compared the ability of Wnt8 and Fgf8a to induce NC markers in
blastula-stage animal pole explants neuralized by Bmp attenuation (Chordin
injection). The neuralization of these explants was assessed by the expression
of the pan-neural gene Sox2. In this assay, Fgf8a had the ability to
enhance the neuralization mediated by Chordin
(Fig. 1E), as had been
previously reported (Lamb and Harland,
1995). We observed that Fgf8a and Wnt8 were very similar in their
ability to activate NC markers (Pax3, Snail2 and Sox8) in
these explants (Fig. 1E).
Importantly, the induction of these NC-specific genes occurred independently
of mesoderm formation. Marker genes for skeletal muscle (m-Actin) and
notochord (Col2a1) were not significantly increased in these
explants, suggesting that Wnt8 and Fgf8a directly convert these cells from a
neural (Sox2) to an NC (Pax3, Snail2 and Sox8)
fate. Taken together, these results indicate that, individually, Fgf8a and
Wnt8 are both necessary to generate NC progenitors in Xenopus.
However, it is unclear whether this dual requirement reflects the fact that
these two signaling molecules operate in the same or in parallel pathways
(Fig. 1F).
NC induction by Fgf8a requires active canonical Wnt signaling
To determine whether Fgf8a and Wnt8 are functioning independently, we first
compared the ability of Fgf8a and Wnt8 to restore NC progenitors in Wnt8- or
Fgf8a-depleted embryos, respectively. Although injection of Fgf8a
mRNA expands Snail2 and Sox8 expression domains
(Fig. 2A), as previously
reported (Monsoro-Burq et al.,
2003; Hong and Saint-Jeannet,
2007), Fgf8a expression was unable to restore the expression of
these NC markers in embryos injected with Wnt8 or β-catenin morpholino
(Fig. 2A). Conversely,
injection of Wnt8 or β-catenin plasmid DNA was very
efficient at restoring NC progenitors in Fgf8a-depleted embryos
(Fig. 2B). These results
indicate that NC induction by Fgf8a requires active Wnt signaling in the
embryo, whereas Wnt8 NC-inducing activity can occur independently of Fgf8a
function.
We also evaluated the relationship between Fgf8a and Wnt8 in animal explants. We found that the NC-inducing activity of Wnt8 and Fgf8a in neuralized explants was dramatically inhibited by co-injection of a Wnt8 or a β-catenin morpholino, as visualized by real-time RT-PCR (Fig. 3A). The loss of Snail2 expression in these explants co-injected with Wnt8 morpholino was also evaluated by whole-mount in situ hybridization (Fig. 3B). Manipulating Wnt signaling in Fgf8a-injected explants did not significantly change the levels of expression of the neural plate marker Sox2 (Fig. 3A). Whereas in Wnt8-injected explants, the inhibition of Wnt signaling restored Sox2 expression to levels similar to those observed in neuralized explants (Chordin injected; not shown). These results support the view that Fgf8a requires a functional canonical Wnt pathway to mediate its NC-inducing activity, suggesting that Fgf8a may act upstream of Wnt8 during NC induction.
|
), are
first activated in the prospective NC tissue
(Fig. 4B).
Adjacent transverse sections of stage 12 and stage 12.5 embryos were
hybridized with Sox8 or Wnt8 probes to further evaluate
their spatial relationship (Fig.
4C). At stage 12, Wnt8 is detected in the mesoderm
immediately contiguous to the NC-forming region where the first Sox8-positive
cells are detected (Fig. 4C).
At stage 12.5, Sox8 is greatly increased in the ectoderm adjacent to
Wnt8 expression in the mesoderm. At this stage, Wnt8 is no longer
confined to the mesoderm and is also detected in the ectoderm layer, as
previously reported (Bang et al.,
1999). The hybridization of adjacent serial sections with
Sox8, Wnt8 and Fgf8 probes confirms that Fgf8 is
never co-expressed with Wnt8 in the mesoderm underlying the
NC-forming region (Fig. 4D).
Fgf8 expression is restricted to the posterior mesoderm at this stage
(Fig. 4E). With the
understanding that we are looking at the mRNA expression of two secreted
factors, and in the absence of appropriate antibodies to further evaluate the
localization of the corresponding proteins, these data suggest that compared
with Fgf8a the spatiotemporal expression of Wnt8 is more
consistent with a role in NC induction.
|
|
In the whole embryo, targeted injection of an Fgf8a morpholino or
expression of a dominant-negative Fgf receptor (XFD)
(Amaya et al., 1991) resulted
in a reduction of Wnt8 expression in the paraxial mesoderm of
late-gastrula-stage embryos (76%, n=73; and 91%, n=40;
respectively; Fig. 5B).
Conversely, overexpression of Fgf8a dramatically expanded the Wnt8
expression domain in most injected embryos (98%; n=83)
(Fig. 5B). These results
indicate that Fgf8a is required for Wnt8 expression in the paraxial mesoderm,
which is consistent with the proposal that Fgf8a functions upstream of Wnt8
during NC induction.
Fgf8a promotes NC fate at the anterior neural fold by up-regulating Wnt8
The absence of NC tissue at the anterior edge of the neural plate
(Fig. 6A) is believed to depend
on the activity of an endogenous Wnt inhibitor, Dkk1, whose function is to
prevent Wnt-mediated expansion of the NC tissue in this region of the ectoderm
(Carmona-Fontaine et al.,
2007). Consistent with this view, inhibition of Dkk1 function
expands the NC domain anteriorly
(Carmona-Fontaine et al.,
2007), and excess Wnt signaling in this region of the embryo
results in ectopic NC formation at the anterior neural fold
(Wu et al., 2004;
Voigt and Papalopulu, 2006;
Carmona-Fontaine et al., 2007)
(Fig. 6B). Surprisingly,
several laboratories have also reported that Fgf misexpression can also induce
the expression of NC markers in this NC-free domain
(Villanueva et al., 2002;
Monsoro-Burq et al., 2003;
Monsoro-Burq et al., 2005)
(Fig. 6C), suggesting that a
mechanism independent of Dkk1 may preclude NC formation in this region. Our
findings placing Fgf8a upstream of Wnt8 may help to resolve this apparent
discrepancy. We observed that Fgf8a-mediated induction of Snail2 and
Sox8 at the anterior neural fold was associated with a dramatic
upregulation of Wnt8 anteriorly
(Fig. 6C), when compared with
control embryos (Fig. 6D),
suggesting that the activity of the Wnt inhibitor Dkk1 can fully account for
the exclusion of the NC from the anterior neural fold.
|
|
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Monsoro-Burq et al.,
2003)?
The existence of a paraxial mesoderm-derived Wnt signal in NC induction,
which was first proposed almost 10 years ago
(Bang et al., 1999), has been
recently challenged (Monsoro-Burq et al.,
2003). In this study, the authors proposed that by interfering
with Wnt signaling extracellularly, by using Wnt antagonists, such as
dominant-negative Wnt8 (LaBonne and
Bronner-Fraser, 1998; Bang et
al., 1999) or Nfz8, a truncated and diffusible form of the Wnt
receptor Frizzled 8 (Monsoro-Burq et al.,
2003), NC formation was impaired not by blocking the activity of a
Wnt signal derived from the paraxial mesoderm but rather, indirectly, by
altering the character of the mesoderm and therefore changing its signaling
properties. In support of this view, these authors reported that interfering
with the response of the ectoderm to Wnt signaling by means of intracellular
Wnt antagonists, such as Gsk3 and dominant-negative Tcf3, did not prevent the
induction of NC markers by the paraxial mesoderm
(Monsoro-Burq et al., 2003).
However, in these studies we cannot exclude the possibility that these
intracellular inhibitors were not fully active at blocking Wnt signaling
(Huang and Saint-Jeannet,
2004). Moreover, these findings conflict with other studies that
have clearly demonstrated that interfering with the reception of Wnt signaling
in the ectoderm, by using dominant-negative forms of Frizzled 3 (Fz3),
Frizzled 7 (Fz7) and their co-receptor Lrp6, or by morpholino-mediated
knockdown of Fz3, Fz7, Lrp6, Kermen and β-catenin, was sufficient to
block NC formation in the whole embryo
(Tamai et al., 2000;
Deardorff et al., 2001;
Wu et al., 2004;
Abu-Elmagd et al., 2006;
Hassler et al., 2007).
The same study proposed that an Fgf rather than a Wnt signal was in fact
responsible for the NC-inducing activity of the paraxial mesoderm
(Monsoro-Burq et al., 2003).
This finding was based on the observation that a piece of dorsolateral
marginal zone (DLMZ), which normally induces NC markers in the ectoderm
(Bonstein et al., 1998), was
unable to induce NC when recombined with animal explants made refractory to
Fgf signaling by expression with a dominant-negative Fgf receptor (XFD).
However, these experiments do not take into account the fact that intact Fgf
signaling is required for neuralization of the ectoderm by Bmp antagonists
(Launay et al., 1996;
Delaune et al., 2004;
Kuroda et al., 2005).
Therefore, and because neural and NC induction are tightly linked, an
alternative interpretation would be that NC induction was blocked not as a
result of the inability of a DLMZ-derived Fgf ligand to signal in the
ectoderm, but rather, indirectly, because the neuralization of these explants
was impaired by the expression of XFD
(Launay et al., 1996).
Consistent with this possibility, and as previously described
(Kuroda et al., 2005), we
observed that the MAPK inhibitor U0126 blocks neuralization by Chordin (see
Fig. S1B,C in the supplementary material). Moreover, animal explants
co-injected with Chordin and Fgf8a, or Chordin and Wnt8, and cultured in the
presence of U0126, show reduced expression of the NC marker Snail2 (see Fig.
S1B,C in the supplementary material). These results confirm previous
observations on the active role played by Fgf/MAPK signaling in neuralization
of the ectoderm by Bmp antagonists (Launay
et al., 1996; Delaune et al.,
2004; Kuroda et al.,
2005). Furthermore, these observations suggest that the loss of NC
in Fgf8a- and Wnt8-injected explants treated with the MAPK inhibitor (see Fig.
S1B,C in the supplementary material), or in explants injected with XFD and
recombined with DLMZ (Monsoro-Burq et al.,
2003), is likely to be secondary to the inability of Bmp
antagonists to neuralize the ectoderm in the absence of an active MAPK
pathway.
Other evidence suggesting that Wnt and Fgf signaling may function
independently during NC induction came from the observation that these factors
differ in their ability to regulate the expression of two neural plate
border-specifier genes, Pax3 and Msx1
(Monsoro-Burq et al., 2005).
However, other studies have shown that Pax3 expression at the neural plate
border is not only dependent on a Wnt signal
(Monsoro-Burq et al., 2005),
but is also tightly regulated by Fgf8a signaling
(Sato et al., 2005;
Hong and Saint-Jeannet, 2007).
Similarly, Msx1 expression in the ectoderm is controlled by either Fgf8
(Monsoro-Burq et al., 2005) or
Wnt8 signaling (Bang et al.,
1999; Tribulo et al.,
2003; Hong and Saint-Jeannet,
2007). The differences in the activity of Wnt8 and Fgf8a reported
by different laboratories could be explained by subtle differences in the
types of reagent or assay used to evaluate the expression of these genes.
It has been previously shown that the co-expression of Chordin and eFgf
induces Snail2 in animal explants, and that this activity is inhibited by the
expression of a dominant-negative Wnt8, raising the possibility that the
induction of Snail2 by Fgf signaling might be indirect
(LaBonne and Bronner-Fraser,
1998). However, because eFgf is also a potent mesoderm inducer
(Isaacs et al., 1992), in
these experiments we cannot exclude the possibility that the Snail2 activation
is secondary to the production of a mesoderm-derived Wnt signal
(LaBonne and Bronner-Fraser,
1998). By contrast, Fgf8a does not induce mesoderm in animal
explants (Fig. 1E)
(Fletcher et al., 2006),
suggesting that Fgf8a NC-inducing activity is directly linked to its ability
to regulate Wnt8 expression.
Spatially, Wnt8 is contiguous to the Sox8 expression domain around the time of NC induction, these factors being confined to the paraxial mesoderm and the ectoderm, respectively. Conversely, Fgf8 remains restricted to the posterior mesoderm and never comes into close proximity with the NC-forming region (Fig. 4). Although we cannot exclude the possibility that Fgf8a protein diffuses to induce NC, at the mRNA level the expression pattern of these molecules is more consistent with a role of Wnt8 in NC induction. Specific antibodies will be needed to further document the expression of Wnt8 and Fgf8a, and the extent to which these molecules diffuse within and across germ layers.
In Xenopus, Fz3 and Fz7 are expressed in the ectoderm, including
the NC-forming region, and are therefore excellent candidates to mediate Wnt8
activity. Fz3- and Fz7-depleted embryos completely lack NC progenitors
(Deardorff et al., 2001;
Abu-Elmagd et al., 2006), and
Snail2 induction by Wnt8 in neuralized animal explants is blocked in the
absence of Fz7 function (Abu-Elmagd et al.,
2006). Nuclear accumulation of β-catenin has been reported in
the region of the ectoderm fated to form the NC
(Schohl and Fagotto, 2002),
consistent with a direct role of Wnt signaling in NC induction. Additionally,
β-catenin has been shown to induce NC markers in animal explants in a
cell-autonomous manner (LaBonne and
Bronner-Fraser, 1998), and the Snail2 promoter in both
X. laevis and X. tropicalis has functional Tcf/Lef-binding
sites (Vallin et al., 2001),
providing further evidence that canonical Wnt signaling induces the NC
directly.
In summary, this study addresses the outstanding question of the relative contribution of Fgf and Wnt signaling to NC induction in Xenopus. Our results provide evidence that, although Fgf8a and Wnt8 are both required to induce the NC, the NC-inducing activity of Fgf8a is indirect through the activation of Wnt8 expression in the paraxial mesoderm. We therefore propose that Fgf8a and Wnt8 are part of the same signaling cascade that specifies the NC in Xenopus.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/23/3903/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Abu-Elmagd, M., Garcia-Morales, C. and Wheeler, G.
(2006). Frizzled 7 mediates canonical Wnt in neural crest
induction. Dev. Biol.
298,285
-298.[CrossRef][Medline]
Amaya, E., Musci, T. J. and Kirschner, M. W.
(1991). Expression of a dominant negative mutant of the FGF
receptor disrupts mesoderm formation in Xenopus embryos.
Cell 66,257
-270.[CrossRef][Medline]
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee,
Y.-H., Credidio, C. and Saint-Jeannet, J.-P. (2003). Sox10
regulates the development of neural crest-derived melanocytes in Xenopus.
Dev. Biol. 259,19
-33.[CrossRef][Medline]
Bang, A. G., Papalopulu, N., Kintner, C. and Goulding, M. D.
(1997). Expression of Pax3 is initiated in the early neural plate
by posteriorizing signals produced by the organizer and by posterior non-axial
mesoderm. Development
124,2075
-2085.[Abstract]
Bang, A. G., Papalopulu, N., Goulding, M. D. and Kintner, C.
(1999). Expression of Pax-3 in the lateral neural plate is
dependent on a Wnt-mediated signal from the posterior non-axial mesoderm.
Dev. Biol. 212,366
-380.[CrossRef][Medline]
Bonstein, L., Elias, S. and Frank, D. (1998).
Paraxial-fated mesoderm is required for neural crest induction in Xenopus
embryos. Dev. Biol. 193,156
-168.[CrossRef][Medline]
Carmona-Fontaine, C., Acuna, G., Ellwanger, K. C. and Mayor,
R. (2007). Neural crests are actively precluded from the
anterior neural fold by a novel inhibitory mechanism dependent on Dickkopf1
secreted by the prechordal mesoderm. Dev. Biol.
309,208
-221.[CrossRef][Medline]
Chang, C. and Hemmati-Brivanlou, A. (1998).
Neural crest induction by Xwnt7B in Xenopus. Dev.
Biol. 194,129
-134.[CrossRef][Medline]
Christen, B. and Slack, J. M. W. (1997). FGF-8
is associated with anteroposterior patterning and limb regeneration in
Xenopus. Dev. Biol. 192,455
-466.[CrossRef][Medline]
Deardorff, M. A., Tan, C., Saint-Jeannet, J.-P. and Klein, P.
S. (2001). A role for frizzled-3 in neural crest development.
Development 128,3655
-3663.
Delaune, E., Lemaire, P. and Kodjabachian, L.
(2004). Neural induction in Xenopus requires early FGF signaling
in addition to BMP inhibition. Development
132,299
-310.[CrossRef][Medline]
Fletcher, R. B., Baker, J. C. and Harland, R. M.
(2006). FGF8 spliceforms mediate early mesoderm and posterior
neural tissue formation in Xenopus.
Development 133,1703
-1714.
Garcia-Castro, M. I., Marcelle, C. and Bronner-Fraser, M.
(2002). Ectodermal Wnt function as a neural crest inducer.
Science 297,848
-851.
Hari, L., Brault, V., Kleber, M., Lee, H. Y., Ille, F.,
Leimeroth, R., Paratore, C., Suter, U., Kemler, R. and Sommer, L.
(2002). Lineage-specific requirement of β-catenin in neural
crest development. J. Cell Biol.
159,867
-880.
Harland, R. M. (1991). In situ hybridization:
an improved whole-mount method for Xenopus embryos. Methods Cell
Biol. 36,685
-695.[Medline]
Hassler, C., Cruciat, C. M., Huang, Y. L., Kuriyama, S., Mayor,
R. and Niehrs, C. (2007). Kremen is required for neural crest
induction in Xenopus and promotes LRP6-mediated Wnt signaling.
Development 134,4255
-4263.
Heasman, J., Kofron, M. and Wylie, C. (2000).
β-catenin signaling activity dissected in the early Xenopus embryo: a
novel antisense approach. Dev. Biol.
222,124
-134.[CrossRef][Medline]
Heeg-Truesdell, E. and LaBonne, C. (2007).
Multiples roles for Wnt signaling in the development of the vertebrate neural
crest. Adv. Dev. Biol.
17,204
-221.
Henry, G. L., Brivanlou, I. H., Kessler, D. S.,
Hemmati-Brivanlou, A. and Melton, D. A. (1996). TGF-beta
signals and a pattern in Xenopus laevis endodermal development.
Development 122,1007
-1015.[Abstract]
Hensey, C. and Gautier, J. (1998). Programmed
cell death during Xenopus development: a spatio-temporal analysis.
Dev. Biol. 203,36
-48.[CrossRef][Medline]
Hong, C.-S. and Saint-Jeannet, J.-P. (2007).
The activity of Pax3 and Zic1 regulates three distinct cell fates at the
neural plate border. Mol. Biol. Cell
18,2192
-2202.
Huang, X. and Saint-Jeannet, J.-P. (2004).
Induction of the neural crest and the opportunities of life on the edge.
Dev. Biol. 275,1
-11.[CrossRef][Medline]
Ikeya, M., Lee, S. M. K., Johnson, J. E., McMahon, A. P. and
Takada, S. (1997). Wnt signaling is required for expansion of
neural crest and CNS progenitors. Nature
389,966
-970.[CrossRef][Medline]
Isaacs, H. V., Tannahill, D. and Slack, J. M. W.
(1992). Expression of a novel FGF in the Xenopus embryos: a new
candidate inducing factor for mesoderm and anteroposterior specification.
Development 114,711
-720.[Abstract]
Jones, N. C. and Trainor, P. A. (2005). Role of
morphogens in neural crest cell determination. J.
Neurobiol. 64,388
-404.[CrossRef][Medline]
Kengaku, M. and Okamoto, H. (1993). Basic
fibroblast growth factor induces differentiation of neural tube and neural
crest lineages of cultured ectoderm cells from xenopus gastrula.
Development 119,1067
-1078.[Abstract]
Knecht, A. K. and Bronner-Fraser, M. (2002).
Induction of the neural crest: a multigene process. Nat. Rev.
Genet. 3,453
-461.[CrossRef][Medline]
Kuroda, H., Fuentealba, L., Ikeda, A., Reversade, B. and
Derobertis, E. M. (2005). Default neural induction:
neuralization of dissociated xenopus cells is mediated by ras/mapk activation.
Genes Dev. 19,1022
-1027.
LaBonne, C. and Bronner-Fraser, M. (1998).
Neural crest induction in Xenopus: evidence for a two-signal model.
Development 125,2403
-2414.[Abstract]
Lamb, T. M. and Harland, R. M. (1995).
Fibroblast growth factor is a direct neural inducer, which combined with
noggin generates anterior-posterior neural pattern.
Development 121,3627
-3636.[Abstract]
Launay, C., Fromentaux, V., Shi, D.-L. and Boucaut, J.-C.
(1996). A truncated FGF receptor blocks neural induction by
endogenous Xenopus inducers. Development
122,869
-880.[Abstract]
Le Douarin, N. M., Creuzet, S., Couly, G. and Dupin, E.
(2004). Neural crest cell plasticity and its limits.
Development 131,4637
-4650.
Lewis, J. L., Bonner, J., Modrell, M., Ragland, J. W., Moon, R.
T., Dorsky, R. I. and Raible, D. W. (2004). Reiterated Wnt
signaling during zebrafish neural crest development.
Development 131,1299
-1308.
Luo, T., Lee, Y.-H., Saint-Jeannet, J.-P. and Sargent, T. D.
(2003). Induction of neural crest in Xenopus by transcription
factor AP2. Proc. Natl. Acad. Sci. USA
100,532
-537.
Marchant, L., Linker, C., Ruiz, P., Guerrero, N. and Mayor,
R. (1998). The inductive properties of mesoderm suggest that
the neural crest cells are specified by a BMP gradient. Dev.
Biol. 198,319
-329.[Medline]
Mayor, R., Morgan, R. and Sargent, M. G.
(1995). Induction of the prospective neural crest of Xenopus.
Development 121,767
-777.[Abstract]
Mayor, R., Guerrero, N. and Martinez, C.
(1997). Role of FGF and noggin in neural crest induction.
Dev. Biol. 189,1
-12.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai,
Y. (1998). Xenopus Zic-related-1 and Sox-2, two factors
induced by chordin, have distinct activities in the initiation of neural
induction. Development
125,579
-587.[Abstract]
Monsoro-Burq, A. H., Fletcher, R. B. and Harland, R. M.
(2003). Neural crest induction by paraxial mesoderm in Xenopus
embryos requires FGF signals. Development
130,3111
-3124.
Monsoro-Burq, A. H., Wang, E. and Harland, R.
(2005). Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals
during Xenopus neural crest induction. Dev. Cell
8, 167-178.[CrossRef][Medline]
Nguyen, V. H., Schmid, B., Trout, J., Connors, S. A., Ekker, M.
and Mullins, M. C. (1998). Ventral and lateral regions of the
zebrafish gastrula, including the neural crest progenitors, are established by
a bmp2b/swirl pathway of genes. Dev. Biol.
199,93
-110.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1967).
Normal table of Xenopus Laevis (Daudin). Amsterdam:
North-Holland Publishing Company.
O'Donnell, M., Hong, C. S., Huang, X., Delnicki, R. J. and
Saint-Jeannet, J. P. (2006). Functional analysis of Sox8
during neural crest development in Xenopus.
Development 133,3817
-3826.
Park, B.-Y. and Saint-Jeannet, J.-P. (2008).
Hindbrain-derived Wnt and Fgf signals cooperate to specify the otic placode in
Xenopus. Dev. Biol. (in press).
Saint-Jeannet, J.-P., He, X., Varmus, H. E. and Dawid, I. B.
(1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and
Wnt-3a. Proc. Natl. Acad. Sci. USA
94,13713
-13718.
Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K.
and De Robertis, E. M. (1994). Xenopus chordin: a novel
dorsalizing factor activated by organizer-specific homeobox genes.
Cell 79,779
-790.[CrossRef][Medline]
Sato, T., Sasai, N. and Sasai, Y. (2005).
Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus
ectoderm. Development
132,2355
-2363.
Schohl, A. and Fagotto, F. (2002).
Beta-catenin, MAPK and Smad signaling during early Xenopus development.
Development 129,37
-52.
Smith, W. C. and Harland, R. M. (1991).
Injected Xwnt-8 mRNA acts early in Xenopus embryos to promote formation of
vegetal dorsalizing center. Cell
67,735
-765.
Smith, J. C., Price, B. M., Green, J. B., Weigel, D., Herrmann,
B. G. (1991). Expression of a Xenopus homolog of Brachyury
(T) is an immediate-early response to mesoderm induction.
Cell 67,79
-87.[CrossRef][Medline]
Tamai, K., Semenov, M., Kato, Y., Spokony, R. F., Liu, C.,
Katsuyama, Y., Hess, F., Saint-Jeannet, J.-P. and He, X.
(2000). LDL receptor-related proteins in Wnt signal transduction.
Nature 407,530
-535.[CrossRef][Medline]
Tribulo, C., Ayba, M. J., Nguyen, V. H., Mullins, M. C. and
Mayor, R. (2003). Regulation of Msx genes by a Bmp gradient
is essential for neural crest specification.
Development 130,6441
-6452.
Vallin, J., Thuret, R., Giacomello, E., Faraldo, M. M., Thiery,
J. P. and Broders, F. (2001). Cloning and characterization of
three Xenopus slug promoters reveal direct regulation by Lef/beta-catenin
signaling. J. Biol. Chem.
276,30350
-30358.
Villanueva, S., Glavic, A., Ruiz, P. and Mayor, R.
(2002). Posteriorization by FGF, Wnt, and retinoic acid is
required for neural crest induction. Dev. Biol.
241,289
-301.[CrossRef][Medline]
Voigt, J. and Papalopulu, N. (2006). A
dominant-negative form of the E3 ubiquitinligase Cullin-1 disrupts the correct
allocation of cell fate in the neural crest lineage.
Development 133,559
-568.
Wolda, S. L., Moody, C. J. and Moon, R. T.
(1993). Overlapping expression of Xwnt-3a and Xwnt-1 in neural
tissue of Xenopus laevis embryos. Dev. Biol.
155, 46-57.[CrossRef][Medline]
Wu, J., Saint-Jeannet, J.-P. and Klein, P. S.
(2003). Wnt-frizzled signaling in neural crest formation.
Trends Neurosci. 26,40
-45.[CrossRef][Medline]
Wu, J., Yang, J. and Klein, P. S. (2004).
Neural crest induction by the canonical Wnt pathway can be dissociated from
anterior-posterior neural patterning in Xenopus. Dev.
Biol. 279,220
-232.[CrossRef]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
This article has been cited by other articles:
|
|
 |
|
  T. Kalkan, Y. Iwasaki, C. Y. Park, and G. H. Thomsen Tumor Necrosis Factor-Receptor-associated Factor-4 Is a Positive Regulator of Transforming Growth Factor-{beta} Signaling That Affects Neural Crest Formation Mol. Biol. Cell, July 15, 2009; 20(14): 3436 - 3450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Steventon, C. Araya, C. Linker, S. Kuriyama, and R. Mayor Differential requirements of BMP and Wnt signalling during gastrulation and neurulation define two steps in neural crest induction Development, March 1, 2009; 136(5): 771 - 779. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
