|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 November 2008
doi: 10.1242/dev.023556
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Developmental Biochemistry, Center for Molecular Physiology of the Brain (CMPB), GZMB, University of Goettingen, Justus-von-Liebig-Weg 11, 37077 Goettingen, Germany.
* Author for correspondence (e-mail: annette.borchers{at}gmail.com)
Accepted 7 October 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Planar cell polarity, Neural crest migration, Xenopus, dsh, fz7
| INTRODUCTION |
|---|
|
|
|---|
The Wnt signaling pathway is highly conserved among all metazoans. Wnt
ligands bind to frizzled (fz) transmembrane receptors leading to accumulation
and nuclear localization of β-catenin, which serves as a transcriptional
co-activator for TCF/Lef transcription factors
(Logan and Nusse, 2004
;
Wodarz and Nusse, 1998
). In
addition to this so called `canonical' Wnt signaling pathway, fz receptors
also activate alternative signaling pathways like the planar cell polarity
(PCP) pathway, which defines the orientation of cells in the plane of an
epithelium (Klein and Mlodzik,
2005
; Seifert and Mlodzik,
2007
). PCP signaling has been best characterized in
Drosophila, where it determines for example the ommatidia
organization in the eye and the bristle hair orientation in the wing
(Axelrod and McNeill, 2002
;
Klein and Mlodzik, 2005
). In
vertebrates, PCP signaling is necessary for the orientation of the stereocilia
bundles in the neurosensory epithelium of the inner ear, and dynamic
convergent extension movements during gastrulation and neurulation
(Wallingford et al., 2002
;
Wang and Nathans, 2007
).
Dishevelled (dsh) is a key regulator of both the canonical as well as the
PCP signaling pathway and regulates cell fate specification as well as cell
movements such as convergent extension. Dsh consists of three major conserved
domains, the DIX, PDZ and DEP domain, that have been implicated in different
downstream signaling events (Boutros and
Mlodzik, 1999
; Wallingford and
Habas, 2005
). The DIX domain is used for canonical Wnt signaling,
whereas the DEP domain is involved in PCP signaling
(Boutros et al., 1998
;
Habas et al., 2003
;
Itoh et al., 2000
;
Rothbacher et al., 2000
). By
contrast, the PDZ domain is shared by both pathways. As downstream effectors
of dsh are distinct for canonical and PCP signaling, it remains unclear how
dsh selectively activates one or the other pathway. In the vertebrate PCP
pathway, the signaling mechanisms affecting the subcellular localization and
choice of effectors proteins of dsh are not well defined.
PTK7 (protein tyrosine kinase 7) is a regulator of PCP signaling that could
modulate the dsh localization as well as the interaction with pathway-specific
effector proteins. PTK7 regulates PCP in the inner ear hair cells and during
neural tube closure in mice (Lu et al.,
2004
). In Xenopus, PTK7 is required for neural convergent
extension (Lu et al., 2004
).
PTK7 is a transmembrane protein containing seven extracellular immunoglobulin
domains and a kinase homology domain. Although the kinase domain lacks the DFG
triplet necessary for catalytic activity, its overall structure is
evolutionary conserved from Hydra to humans
(Kroiher et al., 2001
;
Miller and Steele, 2000
). The
signaling mechanism of PTK7 has not been characterized, but considering the
structure and function of PTK7, it could affect the localization of dsh as
well as its downstream signaling.
Neural crest migration is a new system to analyze the mechanistic role of
PTK7 in vertebrate PCP signaling. Neural crest cells are induced at the border
region of the neural plate and migrate on defined routes throughout the
embryo, where they give rise to a variety of derivatives ranging from neurons
and glia cells of the peripheral nervous system, to cartilage and pigment
cells. Although canonical Wnt signaling plays a role in the induction,
delamination and differentiation of neural crest cells
(Schmidt and Patel, 2005
;
Yanfeng et al., 2003
), PCP
signaling seems to be required for neural crest migration. De Calisto et al.
have shown that a dsh mutant lacking PCP activity inhibits neural crest
migration. Conversely, inhibition of neural crest migration by loss of Wnt11
function can be rescued by expressing a dsh mutant, which activates PCP
signaling in neural crest cells (De
Calisto et al., 2005
). Furthermore, `core-PCP signals' such as Van
Gogh/strabismus, prickle and daam are expressed in cranial neural crest cells
(Bekman and Henrique, 2002
;
Darken et al., 2002
;
Goto and Keller, 2002
;
Nakaya et al., 2004
),
indicating that the PCP signaling cascade is active during neural crest
migration.
Here, we identify a new function for PTK7 in neural crest migration. By analyzing the signaling mechanism of Xenopus PTK7 in vitro in animal cap explants and in vivo in migrating neural crest cells, we provide evidence that PTK7 localizes dsh to the plasma membrane and that this function is required for neural crest migration.
| MATERIALS AND METHODS |
|---|
|
|
|---|
kPTK7-myc) was introduced by PCR
amplification of PTK7-myc using the following primers: forward,
5'CTTGTCGCCAGAGCTGTGTC3'; reverse,
5'TCTTCTGGCAGCAAGACACAAG3'. RNA transcribed from PTK7 constructs
cloned in pCS2 is significantly more potent than RNA generated from the
constructs published by Lu et al. (Lu et
al., 2004
For neural crest-specific expression, a minimal slug promoter,
a700BA (Vallin et al., 2001
),
was excised with SpeI/BamHI from a700BA-GFP
(Vallin et al., 2001
) and
ligated into the SpeI/BamHI sites of BS-I-Sce-II KS
(Pan et al., 2006
) generating
slug-BS-I-Sce-II KS. To express PTK7 under the control of the slug
promoter, full-length PTK7 was excised using Sal/BspE1,
blunted and ligated into the BamHI site of slug-BS-I-Sce-II
KS generating slug-PTK7. For cloning of the kinase deletion mutant
(slug-
kPTK7), full-length PTK7 was cut with
SalI/Bsu361, blunted and ligated into the BamHI
site of slug-BS-I-Sce-II KS. To express GFP in neural crest cells,
the minimal slug promoter and the GFP-coding sequence were excised
with SpeI/NotI from a700BA-GFP
(Vallin et al., 2001
) and
inserted into the SpeI/NotI sites of BS-I-Sce-II KS. All
constructs cloned in slug-BS-I-Sce-II KS were purified using QIAprep
Spin Miniprep Kit (Qiagen) previous to injection in Xenopus
embryos.
Xenopus injection and neural crest transplantation
Xenopus injection experiments were performed as previously
described (Borchers et al.,
2001
). The PTK7 MO sequences were published elsewhere
(Lu et al., 2004
). Here, a 1:1
mixture of MO2 and MO3 was used at total concentrations indicated in the text.
As a toxicity control, identical concentrations of control MO (Gene Tools)
were used. To evaluate neural crest migration independently of earlier neural
tube closure defects, PTK7 MO injected embryos with severe neural tube closure
phenotypes were excluded.
For RNA injection experiments, capped mRNA was synthesized using the
mMESSAGE mMACHINE Kit (Ambion) according to the manufacturer's instructions.
The following published plasmids were used to synthesize RNA for dsh-GFP
(Yang-Snyder et al., 1996
),
dsh
DIX-GFP, dsh
PDZ-GFP, dsh
DEP-GFP
(Miller et al., 1999
), dsh-myc
(Sokol, 1996
), fz7-myc
(Winklbauer et al., 2001
) and
lacZ (Smith and Harland,
1991
). For in situ hybridization, embryos were injected with RNA,
plasmids or MO in one blastomere at the two-cell stage. GFP or
lacZ RNA were used as lineage tracers as indicated in the text. To
analyze protein localization in animal cap assays, embryos were injected in
the animal pole at the one-cell stage.
Transplantation of neural crest cells was carried out as previously
described (Borchers et al.,
2000
). Images were taken using a Leica MZFLIII microscope and a
Leica DC500 camera (Leica Fire Cam 1.2.0 software for Macintosh).
Whole-mount in situ hybridization and immunostaining
β-Galactosidase staining and whole-mount in situ hybridization were
performed as previously described (Borchers
et al., 2002
; Harland,
1991
). Antisense probes were synthesized from the following
published plasmids using a DIG-RNA labeling kit (Roche): AP-2
(Winning et al., 1991
),
engrailed (Brivanlou and Harland,
1989
), twist (Hopwood
et al., 1989
) and Sox10
(Aoki et al., 2003
). The PTK7
antisense probe was generated from full-length PTK7 (RZPD, IMAGp998I099552)
linearized with SexA1.
For immunostaining on vibratome sections, embryos were fixed for 1 hour in
MEMFA (3.7% formaldehyde, 0.1 M MOPS, 2 mM EGTA, 1 mM MgSO4).
Sectioning and immunostaining was performed as previously described
(Borchers et al., 2000
).
Myc-tagged PTK7 was detected with anti-c-myc-Cy3 antibody (C6594, Sigma) and
sections were imaged using an Axioplan 2 microscope (Zeiss) equipped with an
AxioCam HRc digital camera.
Animal cap localization experiment
Ectodermal explants (animal caps) were prepared as described by Wallingford
and Harland (Wallingford and Harland,
2001
). At stage 10.5-11, animal caps were fixed in MEMFA and
processed for immunostaining. Antibodies were used in the following dilutions:
anti-c-myc-Cy3 (Sigma, C6594) 1:100, anti-HA (MMS-101P, Covance) 1:150,
anti-GFP (AB290, Abcam) 1:1000, goat anti-mouse Alexa-fluor 488 nm (A11029,
Invitrogen) 1:200, goat anti-mouse Cy5 (AB6563, Abcam) 1:200, and goat
anti-rabbit IgG fluorescein isothiocyanate (FITC) (F7367, Sigma) 1:200. After
immunostaining, protein localization was imaged by confocal microscopy using a
LSM510 META confocal microscope with LSM510 META software (Carl Zeiss,
MicroImaging).
Immunoprecipitation
For immunoprecipitation, 50 stage 11 embryos were homogenized in 500 µl
NOP buffer (10 mM TrisHCl pH 7.8, 150 mM NaCl, 5% NP40) supplemented with
protease and phosphatase inhibitors to a final concentration of 1 mM PMSF, 0.1
mM NaVO4, 1 mM NaF and 1 mM β-glycerolphosphate. Inhibitor
tablets (Roche) were added according to the manufacturer's instructions.
Lysates were centrifuged at 16,000 g for 20 minutes at 4°C
and the supernatant was pre-cleaned by a 30 minute incubation with Protein A
sepharose (Amersham). After incubation with anti-myc antibodies (9E10, Sigma)
for 1.5 hours at 4°C, protein A sepharose (15 µl of the bead volume)
was added for 1 hour and protein complexes were precipitated by low-speed
centrifugation (400 g). Sepharose beads were washed three
times with NOP buffer, boiled in Laemmli sample buffer and analyzed by western
blotting using anti-HA antibodies (Covance).
| RESULTS |
|---|
|
|
|---|
|
kPTK7) was not able to translocate dsh to the plasma membrane
(Fig. 1F,G). Furthermore, this
mutant also failed to shift dsh to higher molecular weight fractions in
Xenopus lysates separated by glycerol gradient centrifugation (see
Fig. S1C,D in the supplementary material). Taken together, this indicates that
the kinase motif of PTK7 is required for dsh recruitment to the plasma
membrane.
Dsh contains different functional domains that are involved in canonical
and non-canonical Wnt signaling, respectively
(Wallingford and Habas, 2005
).
To identify which of these domains are necessary for the PTK7-dependent
dsh-translocation, we expressed GFP-tagged deletion mutants of the DIX, the
PDZ and the DEP domain of dsh (Fig.
2A) in animal caps. In the absence of PTK7 expression, all mutant
dsh proteins were mainly localized in the cytoplasm
(Fig. 2B,D,F,H). However,
co-expression of PTK7 transferred
DIX- as well as
DEP-dsh to the
membrane (Fig. 2C,G,H). In the
case of the
DIX-dsh-injected caps, a residual cytoplasmic staining
remained that was not apparent in
DEP-dsh injected caps. By contrast,
PDZ-dsh was not translocated to the plasma membrane in the presence of
PTK7 (Fig. 2E,H), indicating
that the PDZ domain is required for function. In summary, these data show that
the tyrosine kinase domain of PTK7 as well as the PDZ domain of dsh are
necessary for the translocation of dsh to the plasma membrane.
PTK7 is part of a fz7/dsh complex and is required for fz7-mediated dsh localization
The ability of PTK7 to control dsh localization suggests that the two
proteins might interact. We tested for binding by co-expressing HA-tagged PTK7
with myc-tagged dsh and immunoprecipitating with either myc- or HA-antibodies.
Independent of the antibodies used, we could not detect co-immunoprecipitation
of PTK7 and dsh (data not shown), indicating that additional molecules are
required for PTK7-mediated dsh localization. A likely candidate is fz7, which,
like PTK7, is also able to recruit dsh to the plasma membrane. To test whether
PTK7 forms a complex with dsh and fz7, we expressed HA-tagged PTK7 with either
myc-tagged dsh or myc-tagged fz7, or a combination of the two (see Fig. S2 in
the supplementary material). Although HA-tagged PTK7 was co-precipitated with
myc-tagged fz7 in one out of three experiments, we detected only robust
co-precipitation in combination with myc-tagged dsh and myc-tagged fz7 (see
Fig. S2 in the supplementary material), indicating that PTK7 is part of a
protein complex that includes fz7 and dsh.
|
As fz-mediated dsh membrane localization correlates with
hyperphosphorylation of dsh (Rothbacher et
al., 2000
), we further examined whether PTK7 loss of function also
affects the phosphorylation status of dsh. Animal caps expressing myc-tagged
dsh alone or in combination with PTK7 show only a single band in western blots
using anti-myc antibodies. However, an additional high molecular weight band
representing hyperphosphorylated dsh is detected in lysates expressing dsh
with fz7 (Fig. 3E).
Interestingly, this fz7-mediated hyperphosphorylation of dsh is inhibited by
the PTK7 MO, indicating that PTK7 is required for the fz7-mediated dsh
hyperphosphorylation. Thus, these data support that PTK7 is part of a dsh-fz7
complex required for dsh localization and phosphorylation.
PTK7 functions in cranial neural crest migration
To further evaluate the in vivo relevance of the PTK7-mediated dsh membrane
localization, we focused on Xenopus neural crest migration. Recently,
PCP signaling has been implicated in the regulation of neural crest migration
(De Calisto et al., 2005
). As
PTK7 is expressed in premigratory (Fig.
4A,B) as well as migratory cranial neural crest cells
(Fig. 4C), we analyzed whether
PTK7 also functions in neural crest development. Xenopus laevis
embryos were injected with PTK7 MO and GFP RNA as a lineage tracer in
one blastomere at the two-cell stage and neural crest migration was analyzed
at neurula and tadpole stages using in situ hybridization for different neural
crest markers. Starting at the neurula stage, injection of the PTK7 MO
inhibited neural crest migration. Although twist-positive cells were
induced, they failed to migrate in PTK7 MO-injected embryos
(Fig. 4H), whereas induction
and migration of twist-positive cells was normal in embryos injected
with the control MO (Fig. 4F).
At tadpole stages, a few migrating neural crest cells are found in the PTK7
MO-injected embryos; however, their number as well as their migration distance
is dramatically reduced compared with the control
(Fig. 4J,K). Similar migration
defects are also seen with other neural crest markers such as AP-2
(Fig. 4L,M) and Sox10 (data not
shown), whereas the expression of the midbrain-hindbrain marker engrailed is
not affected at these MO concentrations
(Fig. 4I, right embryo). Thus,
the PTK7 MO does not lead to morphological changes, but rather seems to
specifically affect neural crest development.
|
In contrast to loss of PTK7 function, overexpression of PTK7 did not affect neural crest migration (Fig. 5). Different concentrations of myc-tagged and untagged PTK7 RNA were injected in one blastomere at the two-cell stage and neural crest migration was analyzed at neurula and tadpole stages. Neither neural crest induction nor neural crest migration were affected by overexpression of PTK7 (Fig. 5A-D), although the tagged PTK7 protein was detected by western blotting and immunostaining (Fig. 5E,F). Thus, PTK7 is required for neural crest migration; however, an excess of the protein seems not to disturb neural crest development. In summary, these data show that PTK7 is expressed and probably directly required in neural crest cells to enable their migration.
Transplanted neural crest cells require PTK7 for migration
To address the function of PTK7 specifically in migrating neural crest
cells, we used neural crest transplantation assays
(Borchers et al., 2000
).
Embryos were co-injected with PTK7 MO and GFP RNA in one blastomere
at the two-cell stage. At early neurula stages (14-16), the fluorescent neural
crest was removed and transplanted into control embryos from which the local
neural crest had been removed (Fig.
6A). To distinguish `non-migrating' grafts
(Fig. 6D) from `migrating'
grafts (Fig. 6B) the GFP
fluorescence of the transplanted cells was monitored at different time points.
Five hours after transplantation, grafts injected with the control MO showed
streams of migrating neural crest cells
(Fig. 6B,F). However, most
grafts injected with the PTK7 MO did not migrate
(Fig. 6D,F). Twelve hours after
grafting, the number of migrating PTK7 MO grafts
(Fig. 6E) increased, but was
still significantly lower compared with control MO grafts
(Fig. 6F). Furthermore, even if
PTK7 MO grafts migrated, they showed fewer migrating cells and did not migrate
as far to the ventral side as did control grafts
(Fig. 6C,E). The PTK7 MO
phenotype is rescued by co-injection of wild-type PTK7 RNA lacking
the MO binding sites (Fig. 6F),
although the rescue effect is not as pronounced as in whole embryo injection
experiments, which is probably due to the more challenging experimental
procedure. In summary, the transplantation assay shows that transplanted
neural crest cells require PTK7 for migration.
Neural-crest-specific expression of
kPTK7 inhibits neural crest migration
To study the function of PTK7 in neural crest migration isolated from
earlier developmental defects, we targeted the expression of PTK7 to neural
crest cells. PTK7 constructs were expressed under the control of the neural
crest-specific slug promoter, so that only the cells that are already
specified to become neural crest cells are affected. Regions of the
slug promoter that are sufficient to drive neural-crest-specific
expression (Vallin et al.,
2001
) were used to express GFP
(Fig. 7A,B), full-length PTK7
(Fig. 7C,D) and a deletion
mutant of the kinase motif,
kPTK7
(Fig. 7E,F).
kPTK7 was
used as a PTK7 antimorph, as it failed to recruit dsh to the plasma membrane
in animal cap assays (Fig. 1F)
and caused similar neural crest migration defects as the PTK7 MO in whole
embryos (injection of 50 pg
kPTK7 RNA caused 44% neural crest
migration defect, n=122). Plasmids were injected together with
lacZ RNA as a lineage tracer in one blastomere at the two-cell stage
and embryos were analyzed for twist expression at neurula and tadpole stages.
As plasmid injections result in mosaic expression, the effects are generally
not as strong as MO or RNA injections. Nevertheless, neural crest-specific
expression of
kPTK7 significantly inhibited the migration of
twist-expressing neural crest cells (Fig.
7E,F), whereas the expression of GFP or PTK7 rarely affected
neural crest migration (Fig.
7A-D,G). Although we cannot completely rule out the possibility
that PTK7 does also affect neural crest induction, these data demonstrate that
PTK7 has an independent function in neural crest migration.
|
kPTK7, to neural crest cells, we have already demonstrated that failure
of dsh localization (Fig. 1F,G)
inhibits neural crest migration (Fig.
7F,P). Next, to characterize the genetic interaction of PTK7 with
dsh in migrating neural crest cells, we targeted the expression of PTK7, as
well as of different dsh mutants, to neural crest cells using the
slug promoter system. First, we analyzed how dsh,
PDZ dsh and
DEP dsh affect neural crest migration. We used
PDZ dsh, because
this mutant abolishes the PTK7-mediated translocation, and
DEP dsh,
because the DEP domain is required for PCP activity and affects neural crest
migration (De Calisto et al.,
2005
PDZ (Fig.
7L-P). However, the combination of slug-PTK7 with
slug-
DEP inhibited neural crest migration to an extent that is
comparable with expression of slug-
kPTK7
(Fig. 7J,K,P), which cannot
recruit dsh to the plasma membrane. This suggests that, although
DEP
dsh can be recruited by PTK7, its lack of PCP activity inhibits neural crest
migration. Co-expression of wild-type dsh, which can be translocated but does
not lack the DEP domain, does not affect neural crest migration. The same
holds true for
PDZ, which is not translocated by PTK7. Thus, these data
indicate that PTK7 is required to localize a functional DEP domain to the
plasma membrane to enable neural crest migration.
|
|
| DISCUSSION |
|---|
|
|
|---|
Neural crest cells migrate extensively on defined routes throughout the
embryo to give rise to a range of derivatives. However, the signaling
mechanisms guiding these organized cell movements are not well characterized.
As overexpression of dsh mutants, which are defective in PCP signaling,
inhibits neural crest migration in Xenopus, this indicates that PCP
signaling plays a role (De Calisto et al.,
2005
). Although, most PCP effectors are expressed at the right
time and location for a function in neural crest migration
(Bekman and Henrique, 2002
;
Darken et al., 2002
;
Goto and Keller, 2002
;
Nakaya et al., 2004
), their
function in this process has so far not been analyzed. Here, we identify PTK7
as the first regulator of PCP with a function in neural crest migration. Loss
of function of PTK7 inhibits neural crest migration, and transplantation
assays show that neural crest cells directly require PTK7 for migration.
Furthermore, this function is independent of the role of PTK7 in neural tube
closure, as demonstrated by neural crest-specific expression.
|
In vivo evidence supports a model in which PTK7 recruits dsh to the plasma
membrane, thereby regulating neural crest migration
(Fig. 8A). This is
experimentally supported by two observations. First, the PTK7 MO as well as
kPTK7, which both abolish PTK7-dependent dsh-recruitment, inhibit
neural crest migration (Fig.
8B). Second, overexpression of wild-type slug-PTK7
together with slug-
DEP dsh, which is deficient in PCP
activity, but can be recruited to the membrane, inhibits neural crest
migration to the same extent as slug-
kPTK7
(Fig. 8C). Hence, if the DEP
domain is missing or dsh cannot be localized to the plasma membrane, neural
crest migration is inhibited (Fig.
8B,C). In contrast to RNA injection experiments, slug-driven
expression of single dsh mutants did not affect neural crest migration. This
could be caused by the late onset as well as the mosaic nature of the
expression. Thus, overexpressed dsh proteins cannot effectively compete with
endogenous dsh, unless ectopic PTK7 is simultaneously provided. Conversely,
excess PTK7 does not affect neural crest migration unless it translocates
DEP dsh to the plasma membrane. Thus, PTK7 may function by anchoring
dsh to the plasma membrane, which then regulates neural crest migration via
its DEP domain probably by activating JNK signaling.
The mechanism by which PTK7 mediates dsh recruitment is unclear. Our data
suggest that PTK7 is part of the fz-dsh complex that localizes dsh to the
plasma membrane. First, PTK7 is co-precipitated with fz7/dsh in
Xenopus lysates and HEK293 cells (data not shown). Second, PTK7 loss
of function inhibits the fz7-mediated dsh recruitment and
hyperphosphorylation. Alternatively, as the binding activity of PTK7/fz7/dsh
is weak, PTK7 may contribute to the fz/dsh interaction at the signaling level
possibly by promoting dsh phosphorylation. As the kinase domain of PTK7 lacks
amino acid residues crucial for kinase activity
(Kroiher et al., 2001
;
Miller and Steele, 2000
), this
scenario could involve additional PTK7-binding partners that mediate dsh
phosphorylation. Independent of the molecular nature of the PTK7 interaction
with fz/dsh - be it binding, signaling or both - it also remains to be seen
whether PTK7 exclusively interacts with fz7 or whether other fz family members
can replace it. The latter is supported by the finding that animal caps
express other fz family members, including fz8 (see Fig. S3 in the
supplementary material), which, like fz7, recruits dsh to the plasma membrane
(Rothbacher et al., 2000
).
Furthermore, loss of function of fz7 does not affect the PTK7-mediated dsh
localization in animal caps (data not shown), suggesting that either PTK7 can
recruit dsh independently of fz7 or indeed that other fz family members can
also interact with PTK7. As fz7 is expressed at the right time and place for a
function in neural crest migration (De
Calisto et al., 2005
), it probably takes part in the in vivo
PTK7-fz-dsh interaction. Future experiments will be needed to address the
molecular composition, as well as the function, of the PTK7-fz-dsh interaction
in neural crest migration.
|
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/24/4015/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aoki, Y., Saint-Germain, N., Gyda, M., Magner-Fink, E., Lee, Y. H., Credidio, C. and Saint-Jeannet, J. P. (2003). Sox10 regulates the development of neural crest-derived melanocytes in Xenopus. Dev. Biol. 259,19 -33.[CrossRef][Medline]
Axelrod, J. D. and McNeill, H. (2002). Coupling planar cell polarity signaling to morphogenesis. Scientific World J. 2,434 -454.
Axelrod, J. D., Miller, J. R., Shulman, J. M., Moon, R. T. and
Perrimon, N. (1998). Differential recruitment of Dishevelled
provides signaling specificity in the planar cell polarity and Wingless
signaling pathways. Genes Dev.
12,2610
-2622.
Bekman, E. and Henrique, D. (2002). Embryonic expression of three mouse genes with homology to the Drosophila melanogaster prickle gene. Mech. Dev. 119Suppl. 1, S77-S81.[CrossRef][Medline]
Borchers, A., Epperlein, H. H. and Wedlich, D. (2000). An assay system to study migratory behavior of cranial neural crest cells in Xenopus. Dev. Genes Evol. 210,217 -222.[CrossRef][Medline]
Borchers, A., David, R. and Wedlich, D. (2001).
Xenopus cadherin-11 restrains cranial neural crest migration and influences
neural crest specification. Development
128,3049
-3060.
Borchers, A. G., Hufton, A. L., Eldridge, A. G., Jackson, P. K., Harland, R. M. and Baker, J. C. (2002). The E3 ubiquitin ligase GREUL1 anteriorizes ectoderm during Xenopus development. Dev. Biol. 251,395 -408.[CrossRef][Medline]
Boutros, M. and Mlodzik, M. (1999). Dishevelled: at the crossroads of divergent intracellular signaling pathways. Mech. Dev. 83,27 -37.[CrossRef][Medline]
Boutros, M., Paricio, N., Strutt, D. I. and Mlodzik, M. (1998). Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94,109 -118.[CrossRef][Medline]
Brivanlou, A. H. and Harland, R. M. (1989). Expression of an engrailed-related protein is induced in the anterior neural ectoderm of early Xenopus embryos. Development 106,611 -617.[Abstract]
Darken, R. S., Scola, A. M., Rakeman, A. S., Das, G., Mlodzik, M. and Wilson, P. A. (2002). The planar polarity gene strabismus regulates convergent extension movements in Xenopus. EMBO J. 21,976 -985.[CrossRef][Medline]
De Calisto, J., Araya, C., Marchant, L., Riaz, C. F. and Mayor,
R. (2005). Essential role of non-canonical Wnt signalling in
neural crest migration. Development
132,2587
-2597.
Gammill, L. S., Gonzalez, C., Gu, C. and Bronner-Fraser, M.
(2006). Guidance of trunk neural crest migration requires
neuropilin 2/semaphorin 3F signaling. Development
133,99
-106.
Gammill, L. S., Gonzalez, C. and Bronner-Fraser, M. (2007). Neuropilin 2/semaphorin 3F signaling is essential for cranial neural crest migration and trigeminal ganglion condensation. Dev. Neurobiol. 67,47 -56.[CrossRef][Medline]
Goto, T. and Keller, R. (2002). The planar cell polarity gene strabismus regulates convergence and extension and neural fold closure in Xenopus. Dev. Biol. 247,165 -181.[CrossRef][Medline]
Habas, R., Dawid, I. B. and He, X. (2003).
Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for
vertebrate gastrulation. Genes Dev.
17,295
-309.
Harland, R. M. (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36,685 -695.[Medline]
Hopwood, N. D., Pluck, A. and Gurdon, J. B. (1989). A Xenopus mRNA related to Drosophila twist is expressed in response to induction in the mesoderm and the neural crest. Cell 59,893 -903.[CrossRef][Medline]
Itoh, K., Antipova, A., Ratcliffe, M. J. and Sokol, S.
(2000). Interaction of dishevelled and Xenopus axin-related
protein is required for wnt signal transduction. Mol. Cell.
Biol. 20,2228
-2238.
Klein, T. J. and Mlodzik, M. (2005). Planar cell polarization: an emerging model points in the right direction. Annu. Rev. Cell Dev. Biol. 21,155 -176.[CrossRef][Medline]
Kroiher, M., Miller, M. A. and Steele, R. E. (2001). Deceiving appearances: signaling by `dead' and `fractured' receptor protein-tyrosine kinases. BioEssays 23,69 -76.[CrossRef][Medline]
Kuriyama, S. and Mayor, R. (2008). Molecular
analysis of neural crest migration. Philos. Trans. R. Soc. Lond. B
Biol. Sci. 363,1349
-1362.
Li, L., Yuan, H., Xie, W., Mao, J., Caruso, A. M., McMahon, A.,
Sussman, D. J. and Wu, D. (1999). Dishevelled proteins lead
to two signaling pathways: regulation of LEF-1 and c-Jun N-terminal kinase in
mammalian cells. J. Biol. Chem.
274,129
-134.
Logan, C. Y. and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 20,781 -810.[CrossRef][Medline]
Lu, X., Borchers, A. G., Jolicoeur, C., Rayburn, H., Baker, J. C. and Tessier-Lavigne, M. (2004). PTK7/CCK-4 is a novel regulator of planar cell polarity in vertebrates. Nature 430,93 -98.[CrossRef][Medline]
Medina, A. and Steinbeisser, H. (2000). Interaction of Frizzled 7 and Dishevelled in Xenopus. Dev. Dyn. 218,671 -680.[CrossRef][Medline]
Medina, A., Reintsch, W. and Steinbeisser, H. (2000). Xenopus frizzled 7 can act in canonical and non-canonical Wnt signaling pathways: implications on early patterning and morphogenesis. Mech. Dev. 92,227 -237.[CrossRef][Medline]
Miller, J. R., Rowning, B. A., Larabell, C. A., Yang-Snyder, J.
A., Bates, R. L. and Moon, R. T. (1999). Establishment of the
dorsal-ventral axis in Xenopus embryos coincides with the dorsal enrichment of
dishevelled that is dependent on cortical rotation. J. Cell
Biol. 146,427
-437.
Miller, M. A. and Steele, R. E. (2000). Lemon encodes an unusual receptor protein-tyrosine kinase expressed during gametogenesis in Hydra. Dev. Biol. 224,286 -298.[CrossRef][Medline]
Moon, R. T., Brown, J. D. and Torres, M. (1997). WNTs modulate cell fate and behavior during vertebrate development. Trends Genet. 13,157 -162.[CrossRef][Medline]
Nakaya, M. A., Habas, R., Biris, K., Dunty, W. C., Jr, Kato, Y., He, X. and Yamaguchi, T. P. (2004). Identification and comparative expression analyses of Daam genes in mouse and Xenopus. Gene Expr. Patterns 5,97 -105.[CrossRef][Medline]
Pan, F. C., Chen, Y., Loeber, J., Henningfeld, K. and Pieler, T. (2006). I-SceI meganuclease-mediated transgenesis in Xenopus. Dev. Dyn. 235,247 -252.[CrossRef][Medline]
Polakis, P. (2007). The many ways of Wnt in cancer. Curr. Opin. Genet. Dev. 17, 45-51.[CrossRef][Medline]
Pulido, D., Campuzano, S., Koda, T., Modolell, J. and Barbacid, M. (1992). Dtrk, a Drosophila gene related to the trk family of neurotrophin receptors, encodes a novel class of neural cell adhesion molecule. EMBO J. 11,391 -404.[Medline]
Raible, D. W. and Ragland, J. W. (2005). Reiterated Wnt and BMP signals in neural crest development. Semin. Cell Dev. Biol. 16,673 -682.[CrossRef][Medline]
Rothbacher, U., Laurent, M. N., Deardorff, M. A., Klein, P. S., Cho, K. W. and Fraser, S. E. (2000). Dishevelled phosphorylation, subcellular localization and multimerization regulate its role in early embryogenesis. EMBO J. 19,1010 -1022.[CrossRef][Medline]
Schmidt, C. and Patel, K. (2005). Wnts and the neural crest. Anat. Embryol. 209,349 -355.[CrossRef][Medline]
Seifert, J. R. and Mlodzik, M. (2007). Frizzled/PCP signalling: a conserved mechanism regulating cell polarity and directed motility. Nat. Rev. Genet. 8, 126-138.[CrossRef][Medline]
Sheldahl, L. C., Park, M., Malbon, C. C. and Moon, R. T. (1999). Protein kinase C is differentially stimulated by Wnt and Frizzled homologs in a G-protein-dependent manner. Curr. Biol. 9,695 -698.[CrossRef][Medline]
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to promote formation of a vegetal dorsalizing center. Cell 67,753 -765.[CrossRef][Medline]
Sokol, S. Y. (1996). Analysis of Dishevelled signalling pathways during Xenopus development. Curr. Biol. 6,1456 -1467.[CrossRef][Medline]
Tahinci, E., Thorne, C. A., Franklin, J. L., Salic, A.,
Christian, K. M., Lee, L. A., Coffey, R. J. and Lee, E.
(2007). Lrp6 is required for convergent extension during Xenopus
gastrulation. Development
134,4095
-4106.
Teddy, J. M. and Kulesa, P. M. (2004). In
vivo evidence for short- and long-range cell communication in cranial
neural crest cells. Development
131,6141
-6151.
Vallin, J., Thuret, R., Giacomello, E., Faraldo, M. M., Thiery,
J. P. and Broders, F. (2001). Cloning and characterization of
three Xenopus slug promoters reveal direct regulation by Lef/beta-catenin
signaling. J. Biol. Chem.
276,30350
-30358.
Wallingford, J. B. and Harland, R. M. (2001).
Xenopus Dishevelled signaling regulates both neural and mesodermal convergent
extension: parallel forces elongating the body axis.
Development 128,2581
-2592.
Wallingford, J. B. and Habas, R. (2005). The
developmental biology of Dishevelled: an enigmatic protein governing cell fate
and cell polarity. Development
132,4421
-4436.
Wallingford, J. B., Fraser, S. E. and Harland, R. M. (2002). Convergent extension: the molecular control of polarized cell movement during embryonic development. Dev. Cell 2, 695-706.[CrossRef][Medline]
Wang, J., Hamblet, N. S., Mark, S., Dickinson, M. E., Brinkman,
B. C., Segil, N., Fraser, S. E., Chen, P., Wallingford, J. B. and
Wynshaw-Boris, A. (2006). Dishevelled genes mediate a
conserved mammalian PCP pathway to regulate convergent extension during
neurulation. Development
133,1767
-1778.
Wang, Y. and Nathans, J. (2007). Tissue/planar
cell polarity in vertebrates: new insights and new questions.
Development 134,647
-658.
Winberg, M. L., Tamagnone, L., Bai, J., Comoglio, P. M., Montell, D. and Goodman, C. S. (2001). The transmembrane protein Off-track associates with Plexins and functions downstream of Semaphorin signaling during axon guidance. Neuron 32, 53-62.[CrossRef][Medline]
Winklbauer, R., Medina, A., Swain, R. K. and Steinbeisser, H. (2001). Frizzled-7 signalling controls tissue separation during Xenopus gastrulation. Nature 413,856 -860.[CrossRef][Medline]
Winning, R. S., Shea, L. J., Marcus, S. J. and Sargent, T.
D. (1991). Developmental regulation of transcription factor
AP-2 during Xenopus laevis embryogenesis. Nucleic Acids
Res. 19,3709
-3714.
Witzel, S., Zimyanin, V., Carreira-Barbosa, F., Tada, M. and
Heisenberg, C. P. (2006). Wnt11 controls cell contact
persistence by local accumulation of Frizzled 7 at the plasma membrane.
J. Cell Biol. 175,791
-802.
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14,59 -88.[CrossRef][Medline]
Yamanaka, H., Moriguchi, T., Masuyama, N., Kusakabe, M., Hanafusa, H., Takada, R., Takada, S. and Nishida, E. (2002). JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates. EMBO Rep. 3, 69-75.[CrossRef][Medline]
Yanagawa, S., van Leeuwen, F., Wodarz, A., Klingensmith, J. and
Nusse, R. (1995). The dishevelled protein is modified by
wingless signaling in Drosophila. Genes Dev.
9,1087
-1097.
Yanfeng, W., Saint-Jeannet, J. P. and Klein, P. S. (2003). Wnt-frizzled signaling in the induction and differentiation of the neural crest. BioEssays 25,317 -325.[CrossRef][Medline]
Yang-Snyder, J., Miller, J. R., Brown, J. D., Lai, C. J. and Moon, R. T. (1996). A frizzled homolog functions in a vertebrate Wnt signaling pathway. Curr. Biol. 6,1302 -1306.[CrossRef][Medline]
Yu, H. H. and Moens, C. B. (2005). Semaphorin signaling guides cranial neural crest cell migration in zebrafish. Dev. Biol. 280,373 -385.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
W. W. Yen, M. Williams, A. Periasamy, M. Conaway, C. Burdsal, R. Keller, X. Lu, and A. Sutherland PTK7 is essential for polarized cell motility and convergent extension during mouse gastrulation Development, June 15, 2009; 136(12): 2039 - 2048. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||