DEV023556 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure S1 -

  Fig. S1. PTK7 and dsh colocalization is detected by glycerol-gradient centrifugation. Embryos were injected with 200 pg dsh-myc RNA alone (A) or in combination with either 1 ng PTK7-myc RNA (B) or 1 ng ΔkPTK7-myc RNA (C,D). Stage 10.5-11 embryos were homogenized in hypotonic lysis buffer, containing 5% glycerol, 50 mM Tris pH 8, 50 mM KCl, 0.1 mM EDTA and protease inhibitor cocktail (Roche) supplemented with 0.1 mM PMSF. The supernatant was loaded on a 5-60% glycerol gradient, centrifuged and split into ten fractions. Proteins were precipitated and analyzed by SDS-PAGE and Western blotting. The figure represents one of three independent experiments, showing the same result. Dsh shifts to higher molecular weight fractions (9,10) if PTK7 is co-expressed (B), indicating complex formation. By contrast, ΔkPTK7 fails to shift dsh (C,D). The image in D represents the same western blot as in C, but taken at a lower exposure time, to distinguish between ΔkPTK7 and dsh protein bands.

• Supplemental Figure S2 -

  Fig. S2. Fz7 and dsh are both required to co-precipitate PTK7. Embryos were injected with 1 ng PTK7-HA, 0.2 ng dsh-myc and 0.2 ng fz7-myc RNA in the combinations indicated. Protein complexes were precipitated using anti-myc antibodies (IP). Immunoprecipitated HA-tagged PTK7 protein was detected by western blotting using anti-HA antibody (upper panel). The middle panel shows the PTK7 input detected by western blotting (WB) using anti-HA antibodies. The lower panel shows the dsh/fz inputs detected by anti-myc antibodies.

• Supplemental Figure S3 -

  Fig. S3. Animal caps endogenously express PTK7 and different members of the frizzled family. Animal caps were isolated at stage 9, cultured until stage 12 and analyzed by RT-PCR. cDNA was isolated from 20 animal caps (AC) or from one stage 12 embryo of the same batch. Half of the isolated embryo RNA was processed with reverse transcriptase (E) and half without (−RT). The following primers were used: PTK7 (forward, 5′ CCTGGTCAGCTTCAAGATAG3′; reverse, 5′ATGTAGTGTGGTTCTGCCTC3′); fz4 (forward, 5′AGATCGCTGACCTTGTTGTAC3′; reverse, 5′CTTCACAGAAGGCACATCC3′); fz7 (forward, 5′ATGTCCTCTACAGTCTCGCTG3′; reverse, 5′AAGCCGAACTTGTTCATGAG3′); fz8 (forward, 5′AACTGTCCTGCCAAGAGATC3′; reverse, 5′GTAGTAGTCCATACACAGGGTGTC3′); ODC (forward, 5′GCCATTGTGAAGACTCTCTCCATTC3′; reverse, 5′TTCGGGTGATTCCTTGCCAC3′). For PTK7, fz7, fz8 and ODC, 25 PCR cycles were used and for fz4 33 PCR cycles.

• Supplemental Figure S4 -

  Fig. S4. Overexpression of PTK7 activates JNK signaling. Embryos were injected with 100 pg dsh or 500 pg PTK7-myc RNA. As it is known that JNK is phosphorylated and localized to the nucleus in animal caps injected with dsh (Tahinci et al., 2007), dsh is used here as a positive control. Animal caps were cut at blastula stages and analyzed for the presence of phosphorylated JNK by immunostaing using the p-JNK antibody (sc-6254, Santa Cruz). Although control caps show only rarely a p-JNK signal (red) (A), dsh (B) and PTK7-injected cells (C) exhibit nuclear phospho-JNK staining, indicating activation of the JNK signaling pathway.