|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 November 2008
doi: 10.1242/dev.028951
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Molecular and Human Genetics, Baylor College of Medicine,
Houston, TX 77030, USA.
2 Program in Developmental Biology, Baylor College of Medicine, Houston, TX
77030, USA.
3 Department of Pathology, Baylor College of Medicine, Houston, TX 77030,
USA.
4 Department of Neuroscience, Baylor College of Medicine, Houston, TX 77030,
USA.
5 Department of Ophthalmology, Baylor College of Medicine, Houston, TX 77030,
USA.
* Author for correspondence (e-mail: gmardon{at}bcm.edu)
Accepted 13 October 2008
| SUMMARY |
|---|
|
|
|---|
Key words: Drosophila, Eye, Lateral inhibition, Photoreceptor, Rough, Senseless
| INTRODUCTION |
|---|
|
|
|---|
Two models have been proposed to explain how a single R8 is selected from
an IG. The distinction between these models is important because they define
different populations of cells with equal potential to become R8 precursors.
One model is based on parallels between retinal differentiation and the early
development of other peripheral nervous system (PNS) organs (reviewed by
Bray, 2000
;
Ghysen and Dambly-Chaudiere,
1989
). In this model, IGs are considered roughly equivalent to
proneural clusters in PNS differentiation, R8 cells are considered analogous
to sensory organ precursors (SOPs), and Notch-mediated lateral inhibition is
necessary to select a single SOP or R8 precursor (reviewed by
Lai, 2004
;
Voas and Rebay, 2004
;
Baker et al., 1996
;
Baker and Yu, 1997
;
Baker and Zitron, 1995
;
Cagan and Ready, 1989
;
Lee et al., 1996
). Thus, if
lateral inhibition is disrupted, clusters of R8 precursors are predicted to
develop (Fig. 1C). However,
mutations in genes outside the lateral inhibition pathway, such as
rough (ro), which encodes a homeodomain transcription
factor, are also capable of generating additional R8 photoreceptors,
suggesting other mechanisms may be required
(Cagan, 1993
;
Rawlins et al., 2003
;
Spencer and Cagan, 2003
).
Therefore, a second model was introduced, the `R8 equivalence group' model
(Dokucu et al., 1996
). In this
model, nuclei of three cells at the posterior edge of an IG migrate apically
and continue to express Ato while in neighboring IG cells Ato expression is
lost (Dokucu et al., 1996
;
Sun et al., 1998
). Then, in
two of the three R8 equivalence group cells, Ro represses Ato, leading to the
selection of a single R8. Thus, in ro-null mutants up to three R8
precursors per ommatidium are predicted to develop
(Fig. 1D)
(Dokucu et al., 1996
;
Heberlein et al., 1991
).
Consistent with this model, ectopic Ro is capable of repressing Ato anterior
to the MF and Ro is expressed in a pattern complementary with the posterior
border of Ato expression in the MF (Chanut
et al., 2000
; Dokucu et al.,
1996
). Despite the differences between the two models, both are
based on the premise that ectopic R8s are formed when the initial pattern of
Ato expression is not refined to a single cell. In other words, an
undifferentiated cell can only develop as an R8 in the context of ongoing Ato
expression. Both models were proposed before sens was identified and
its pivotal role in R8 development explored.
|
In this work, we show that ro is not required for the initial selection of a single R8 precursor. We show that in ro-null mutants, the single R8 fate persists for several hours and that ectopic Sens-expressing R8s develop in the absence of ectopic Ato 6 hours after normal R8 specification. Furthermore, we show that Ro directly represses sens transcription in the R2,5 precursors. Together with our previous report that Sens repression of Ro is required for R8 differentiation, our current findings suggest that the R8 and R2,5 cell precursors comprise the R8 equivalence group and that a negative regulatory loop between sens and ro is required to select the R8 vs. R2,5 cell fate from among these cells. We also report the identification of an enhancer that is necessary and sufficient for R8-specific sens expression and characterize distinct elements within the enhancer responding to inductive and repressive signals during R8 selection. Our data suggest that a two-step process is required for R8 selection. Initially, Ato directly activates sens expression in the IG and lateral inhibition transiently selects a single R8 from the IG cells. Then, after the correct pattern of R8 precursors is established by lateral inhibition, Ro is required to maintain this pattern by direct repression of sens in the R2,5 precursors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
F2 genomic rescue construct was created by inducing
recombination between the sens-L genomic rescue and a mutagenic PCR
fragment that lacks the F2 region (see Fig. S1 in the supplementary material).
F2-sens was generated in the pCaSpeR-4 vector
(D'Avino and Thummel, 1999
For transgenic fly generation, embryo progeny of yw virgins
crossed to yw; Ki
2-3 males were injected with
pH-Stinger-based constructs. Third instar larvae heterozygous for
reporter constructs were dissected and stained (see
Pepple et al., 2007
).
Drosophila genetics, immunohistochemistry and microscopy
The following stocks were used: sensE1: roX63: RM104:
Dl6B: DlRF: sensE2 FRT80B/TM6B: FRT82D
ato1: FRT82D roX63: Fragment E1/CyO, hs-hid;
sensE2 FRT80B/TM6B: yw,hsflp; M(3),arm-lacZ,FRT80B/TM6B: yw,hsflp;
FRT82D arm-lacZ/TM6B. Clones were generated by standard protocols (see
Pepple et al., 2007
) with
minute heat shocks at 37°C for 1 hour 40-42 hours after egg laying.
Dlts is Dl6B/RF
(Baker and Zitron, 1995
).
Dlts animals were raised at 18°C until third instar then vials
were submersed in a 31°C water bath for 6 hours. Larvae were immediately
dissected and stained (see Pepple et al.,
2007
). Primary antibodies used were: rabbit anti-GFP (1:1000,
Molecular Probes); guinea-pig anti-Ato (1:1000, a gift from Hugo Bellen) for
DAB stains; rabbit anti-Ato (1:3000, a gift from Kwang Choi) for fluorescent
stains; guinea pig anti-Sens (1:2000, a gift from Hugo Bellen); and mouse
anti-β galactosidase (1:1000, Promega). Goat anti-rabbit Cy3 and goat
anti-guinea pig Cy5 secondary antibodies were obtained from Jackson
laboratories (West Grove, Pennsylvania, USA). Goat anti-mouse Alexa, goat
anti-guinea pig Alexa and goat anti-rabbit Alexa secondary antibodies were
obtained from Molecular Probes (Eugene, Oregon, USA). All secondary antibodies
used at a 1:500 dilution in PAXDG (PBS with 1% BSA, 0.3% Triton X-100, 0.3%
sodium deoxycholate and 5% NGS). Scanning electron microscopy was performed
(see Pepple et al., 2007
).
In Fig. 3I-J, Sens and Ato expression were counted only in ommatidia that could be unambiguously assigned a column designation. For each column, percentages of ommatidia containing single positive cells and multiple positive cells were determined. Ato data were generated from nine wild-type discs and 17 roX63 discs. Sens data were generated from 13 wild-type discs and 17 roX63 discs. An average percentage for each column was determined using the normalized percentage from each disc. Error bars represent the standard error of the mean. Student's t-tests were performed to determine P values.
Electrophoretic mobility shift assays
Ato/Da EMSAs were performed (see Jarman
et al., 1993b
). Wild-type probes for Ato/Da EMSAs are as follows:
E1, TTAGTACCGGACCGACATATGGTCAAAAAGCCGA; E2,
TTAAGCCGACGAAGACAGTTGCCAGAGTCCTTTG; E3,
TTAGTCACTGTTCTTCAGCTGTTTATGTATAAAA; and E4,
TTAATTCGTGCTTTACATCTGTTCACCATTGGAG. Italicized
thymidines were added to probe sequence for radiolabeling with
P32-dATP, core E-boxes sequence underlined. For all mutant
probes, CANNTG was mutated to
AANNTT. Ro EMSAs were performed (see
Heberlein et al., 1994
).
Probes for Ro EMSAs are as follows: wt,
ATTTATGTACAAATTACAATCATAATAATTT;
H1*,
ATTTATGTACAAGGGGCAATCATAATAATTT;
H2*,
ATTTATGTACAAATTACAATCATGGGGATTT;
H1,2*,
ATTTATGTACAAGGGGCAATCATGGGGATTT. Gels were
dried before autoradiography.
|
| RESULTS |
|---|
|
|
|---|
In contrast to the Dlts phenotype, in
rox63 null mutants only single Sens-expressing R8 cells
are found in columns 1 and 2 (Fig.
2D,H,I). This is not consistent with a previous report that in
ro mutants Ato expression is found in two or three cells in column 1,
owing to failure of resolution of the R8 equivalence group (Model 2)
(Dokucu et al., 1996
). To
evaluate this discrepancy, we closely re-examined Ato expression in
rox63 null mutants and found that 6±3% of ommatidia
in column 1 do have two Ato-staining cells (data not shown). However, this is
not significantly different (P=0.8) from wild-type discs, where two
Ato-positive cells are found in 6±2% of column 1 ommatidia (data not
shown). The occasional second Ato-expressing cell does not persist in either
genotype, and by column 2, only a single Ato staining cell is seen in all
ommatidia (data not shown). These data indicate that, although Ato expression
is not limited to a single cell in column 1, by column 2 in both wild-type and
rox63 mutant discs, expression of Ato and Sens is always
restricted to a single cell. Thus, ro is not required for selection
of a single Ato- or Sens-expressing R8 photoreceptor.
Rough represses ectopic R8 development and Sens expression three columns after selection of a single Ato/Sens-expressing R8 precursor
In rox63 null mutant discs, single Sens-expressing
cells are selected and persist for two columns, demonstrating that ro
is not required for selection of a single R8 precursor. However, in column 3,
Sens expression is occasionally found in multiple cells per ommatidium and by
column 5 many ommatidia have three Sens-positive cells
(Fig. 2I, asterisk). This
suggests that the ro phenotype may be due to a later effect on R8
differentiation than previously reported. To better characterize the
rox63 phenotype, we closely examined
rox63 discs using Ato and Sens expression as R8 cell
markers. Initially, expression patterns of Ato and Sens are the same in both
wild-type and rox63 discs
(Fig. 3A-H). In a subset of IG
cells, Ato and Sens are co-expressed (circled in
Fig. 3B-D,F-H) and in column 1
and 2 Ato and Sens colocalize to a single R8 precursor (open arrowhead in
Fig. 3B-D,F-H). The first
difference is found in column 3 where, in wild-type discs, Ato and Sens are
expressed in only one cell per ommatidium. By contrast, in
rox63 discs, 9±3% of ommatidia have multiple
Ato-positive cells and 21±5% have multiple Sens-positive cells
(Fig. 3I). The difference
between wild-type and rox63 mutants further increases
after column 4, where Sens is expressed in up to three cells per ommatidium in
more than 50% of ommatidia (Fig.
3F, white arrowhead; Fig.
3J). Although Sens is a specific and consistent R8 marker, it is
possible that not all extra Sens-positive cells in rox63
mutants are equivalent to wild-type R8s. Therefore, in
rox63 mutants, supernumerary cells expressing Sens are
considered putative R8s (`R8s'). To determine when extra `R8s' form, we
calculated the average percentage of ommatidia with extra Sens-expressing
`R8s' in the first seven columns of roX63 mutant discs
(Fig. 3J). We find that the
roX63 phenotype evolves gradually starting in column 3,
where 21±5% of ommatidia contain extra `R8' cells. By column 6, 60-70%
of ommatidia have multiple `R8s'. By contrast, in wild-type discs, a single R8
cell is found in every ommatidium. Therefore, in roX63
mutants, additional `R8s' develop from cells that begin to express Sens
starting in column 3.
Rough directly represses sens expression
Ro is a homeodomain-containing protein and has been shown to bind DNA at
two sites in its own enhancer containing an ATTA core sequence
(Heberlein et al., 1994
). To
explore the possibility that Ro directly represses sens, we
identified the R8 specific sens enhancer and characterized the
mechanisms regulating sens expression. A 645 bp fragment within the
second intron of the sens genomic locus named F2 was identified that
is sufficient to drive reporter expression specifically in photoreceptors of
the developing eye-antennal imaginal disc
(Fig. 4). To test whether the
F2 region is necessary for R8-specific sens expression, the 645 bp
region was specifically deleted from the sens-L genomic rescue
construct generating
F2 (see Fig. S1 in the supplementary
material). In sens-null mutants, one copy of
F2
rescues the null phenotype in all tissues except the eye (see Fig. S2 in the
supplementary material). Thus, F2 is the sens eye enhancer and is
necessary and sufficient for R8-specific sens expression.
|
|
Positive and negative regulation of sens expression in R8
In order to identify mechanisms activating sens expression in R8,
we performed binding site analysis and functional assays with subfragments of
F2 (Fig. 6). Sens expression in
the eye is dependent on the proneural bHLH protein Ato
(Frankfort et al., 2001
). To
activate target gene expression, Ato heterodimerizes with another bHLH
protein, Daughterless (Da), and binds to the minimal E-box consensus sequence
CANNTG (core nucleotides underlined)
(Brown et al., 1996
;
Jarman et al., 1993a
;
Murre et al., 1989a
;
Murre et al., 1989b
). Four
potential E-boxes are present in F2 (E1-E4, identified by green boxes in
Fig. 4B and green vertical
lines in Fig. 6A), suggesting
that Ato directly regulates sens. To test whether these potential
binding sites are required for reporter expression, we generated three
subfragments of F2 (fragments A, B and C). Fragment A lacks all E-box
sequences and does not express GFP in the eye
(Fig. 6F). Fragment B contains
two E-boxes, E1 and E2, and drives GFP expression strongly starting in column
1, but lacks significant IG expression
(Fig. 6L, IGs bounded by white
vertical lines). The lack of IG GFP expression with fragment B suggests that
E3 and E4 may also be required. Therefore, we predicted that fragment C, which
contains all four E-boxes, would recapitulate the complete F2-GFP expression
pattern. Owing to the deletion of the Ro-binding sites, additional expression
in the R2,5 was also anticipated. As predicted, C-GFP is expressed at high
levels in the IGs, suggesting that multiple E-boxes are required for the
earliest expression of sens (Fig.
6R). However, GFP expression also expands to nearly every cell
posterior to the IGs, suggesting that additional negative regulatory elements
other than the Ro-binding sites are missing from fragment C
(Fig. 6A, blue bracket).
|
To test for a direct interaction between Ato/Da heterodimers and the four
E-boxes present in the R8 enhancer, EMSAs were performed
(Fig. 7A). Ato/Da heterodimers
bind strongly to E1 with weaker binding detectable for E4. Binding is lost
with mutation of the core E-box sequence. No binding is detected to probes
containing E2 or E3. Da homodimers also bind to E1 and E4 (indicated by
arrowhead). This binding is lost with mutation of the E-box core sequence.
Interaction of Da homodimers with E-box sites has been described previously,
but the significance of this interaction in vivo is unknown
(Jarman et al., 1993b
;
Jarman et al., 1994
). These
data suggest that Ato/Da heterodimers directly regulate sens
expression by binding E1 and E4 in the R8 enhancer. This supports the
subfragment analysis that shows that both E1 and E4 are required in fragment
B-long for IG reporter expression.
Fragment B-short contains a single E-box, E1, and is sufficient for R8-specific expression starting in column 1. To determine whether E1 is necessary for expression in vivo, two base pairs in the E-box core sequence were mutated in B-short, generating E1* (Fig. 7G). Mutation of the E-box does not abolish all R8 reporter expression in vivo but delays the onset of GFP expression by three or four columns (Fig. 7G, bracket). Deletion of the entire E-box has the same effect on GFP expression (data not shown) and suggests an Ato-independent enhancer that is sufficient to maintain sens expression is present in fragment E1*. This is not an unexpected finding as Ato expression ends after column 3, whereas Sens continues to be expressed until early adult stages. No additional transcription factors with the ability to directly activate sens expression in an Ato-independent manner have been identified.
|
|
| DISCUSSION |
|---|
|
|
|---|
In a previously published report, we have shown that sens is
required for R8 differentiation to occur through repression of Ro in R8, and
that ectopic Sens is sufficient to repress endogenous Ro expression
(Frankfort et al., 2001
).
Thus, in the absence of sens, three R2,5 cells develop and in the
absence of ro up to three R8 cells form per ommatidium. This
reciprocal phenotype supports the existence of the three cell R8 equivalence
group and a mechanism of mutual repression between sens and
ro that specifies opposite cell types
(Fig. 8C). Although we have
shown that one mechanism regulating this mutual repression is the direct
repression of sens by Ro, other roles for Ro may exist. We observe
that the Ro-binding site mutations do not produce the same level of GFP
reporter protein expression elevation in R2,5 precursors that would be
predicted from the level of GFP expressed in ro mutants. This
suggests that Ro may also regulate sens by repressing an activator of
sens expression in R2,5 precursors.
Regardless of the mechanism, the negative-feedback loop between
sens and ro is secondary to the initial force driving R8
selection in which Ato and Sens are transiently repressed by lateral
inhibition in all but one cell within an IG. Thus, lateral inhibition
transiently represses neural differentiation in the eye, establishing the
patterned array of precisely spaced ommatidia while retaining the potential
for later recruitment of undifferentiated cells to the photoreceptor cell
fate. If the effects of lateral inhibition were to repress permanently the
potential for neuronal differentiation, further retinal development would be
blocked. Therefore, the effects of lateral inhibition must be limited and our
data indicate that column 3 is the boundary of its influence. As the effects
of lateral inhibition diminish, the negative-feedback loop between
sens and ro reinforces the pattern of selected R8s and
ensures that only one Sens-expressing cell from the R8 equivalence group
develops as an R8. This simple bistable loop translates the transient
developmental signal of lateral inhibition into a committed irreversible fate
(Ferrell, 2002
).
|
R8 cell fate potential is maintained despite transient repression by lateral inhibition
Proper patterning of the Drosophila eye requires precise selection
of R8 precursors in a highly ordered array. Previously, the potential to
assume the R8 fate was generally believed to reside in the single cell that
achieved the highest balance of proneural induction by ato and
escaped repression by lateral inhibition. This concept has influenced the
interpretation of mutants that exhibit multiple R8 phenotypes, such as
ro, by linking the extra R8s that form to cells that inappropriately
maintain Ato expression. However, our data show that the expression pattern of
Ato and Sens in a ro-null mutant is not altered in a manner
consistent with this model. Our re-evaluation of the ro phenotype
suggests the intriguing possibility that undifferentiated cells posterior to
the furrow retain the developmental plasticity to develop as R8s even in the
absence of ongoing Ato expression.
The ro phenotype demonstrates that, despite initial repression of the R8 cell fate by lateral inhibition, at least two additional cells have the potential to develop as R8s starting in column 3 if Sens expression is de-repressed. One of the subfragments of the sens eye enhancer, fragment C-GFP, is expressed in nearly all cells posterior to the MF, suggesting that sens could be de-repressed in cells other than the R2,5 cell precursors and initiate R8 development. The widespread expression of fragment C-GFP suggests that it lacks an important negative regulatory region distinct from Ro repression. One potential mechanism that may explain the fragment C-GFP expression pattern is that the stripe of Ato expression in the MF confers R8 potential to all cells and that this potential is only transiently repressed by lateral inhibition during patterning. Then, as the effects of lateral inhibition fade, secondary mechanisms repress sens expression and R8 differentiation in cells posterior to the MF. This model, demonstrated by the function of Ro and suggested by fragment C-GFP expression, is distinct from the previous concept that R8 cell fate is limited to cells of the IG.
The eye-specific senseless enhancer integrates positive and negative regulation of R8 differentiation
The minimal eye specific enhancer of sens, fragment B-long,
contains at least four potentially discreet regulatory elements that balance
the positive and negative inputs required to specify a single R8 precursor per
ommatidium. The first positively acting element is under the direct control of
Ato/Da heterodimers and contains E-boxes 1 and 4. This element is required for
Ato-dependent sens expression in the IGs and in columns 1-3. Although
ato is at the top of the genetic cascade required for eye
differentiation, sens is only the third direct target identified in
the eye after bearded (brd) and dacapo
(dap) (Powell et al.,
2004
; Sukhanova et al.,
2007
). We find that Ato/Da heterodimers bind to two E-boxes (E1
and E4) to drive early sens expression in R8. This is in contrast to
the previously described direct regulation of sens in SOPs of the
embryonic and developing adult PNS by Ato and Scute at a single E-box in their
common enhancer (Jafar-Nejad et al.,
2003
).
The second positively acting regulatory element resides within the
boundaries of fragment E1*, although we did not specifically
identify the minimal necessary sequence. This element responds to an
Ato-independent mechanism that is sufficient to maintain Sens expression in
selected R8 cells after column 3. Sens is known to respond to Ato-independent
inductive cues much later in R8 development (48 hours after pupation) when
Sens expression requires the spalt genes
(Domingos et al., 2004
).
However, larval expression of Sens is not disrupted in spalt mutants,
suggesting the existence of yet another unidentified positive regulator.
In addition to these two positively acting elements, there are also at least two negative regulatory elements. We specifically identified the Ro-binding element H2 that is responsible for repressing Sens expression in R2,5 cells. The second element was not specifically identified, but its presence is suggested by the nearly ubiquitous expression of fragment C-GFP. Together these positive and negative regulatory elements outline an elegant strategy for the multi-staged selection of a single R8 per ommatidium and highlights a model where blocking R8 cell fate potential with sequential, independent, repressive mechanisms is an important strategy for patterning and cell fate development in the Drosophila eye.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/24/4071/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Acar, M., Jafar-Nejad, H., Giagtzoglou, N., Yallampalli, S.,
David, G., He, Y., Delidakis, C. and Bellen, H. J. (2006).
Senseless physically interacts with proneural proteins and functions as a
transcriptional co-activator. Development
133,1979
-1989.
Baker, N. E. and Zitron, A. E. (1995).
Drosophila eye development-notch and delta amplify a neurogenic pattern
conferred on the morphogenetic furrow by scabrous. Mech.
Dev. 49,173
-189.[CrossRef][Medline]
Baker, N. E. and Yu, S. Y. (1997). Proneural
function of neurogenic genes in the developing Drosophila eye.
Curr. Biol. 7,122
-132.[CrossRef][Medline]
Baker, N. E., Yu, S. and Han, D. (1996).
Evolution of proneural atonal expression during distinct regulatory phases in
the developing Drosophila eye. Curr. Biol.
6,1290
-1301.[CrossRef][Medline]
Barolo, S., Carver, L. A. and Posakony, J. W.
(2000). GFP and beta-galactosidase transformation vectors for
promoter/enhancer analysis in Drosophila.
Biotechniques 29,726; 728; 730; 732
.
Bray, S. (2000). Specificity and promiscuity
among proneural proteins. Neuron
25, 1-2.[Medline]
Brown, N. L., Paddock, S. W., Sattler, C. A., Cronmiller, C.,
Thomas, B. J. and Carroll, S. B. (1996). daughterless is
required for Drosophila photoreceptor cell determination, eye morphogenesis,
and cell cycle progression. Dev. Biol.
179, 65-78.[CrossRef][Medline]
Cagan, R. (1993). Cell fate specification in
the developing Drosophila retina. Development Suppl.19
-28.
Cagan, R. and Ready, D. (1989). Notch is
required for successive cell decisions in the developing Drosophila retina.
Genes Dev. 8,1099
-1112.
Chanut, F., Luk, A. and Heberlein, U. (2000). A
screen for dominant modifiers of ro(Dom), a mutation that disrupts
morphogenetic furrow progression in Drosophila, identifies groucho and
hairless as regulators of atonal expression. Genetics
156,1203
-1217.
D'Avino, P. P. and Thummel, C. S. (1999).
Ectopic expression systems in Drosophila. Methods
Enzymol. 306,129
-142.[Medline]
Dokucu, M. E., Zipursky, S. L. and Cagan, R. L.
(1996). Atonal, rough and the resolution of proneural clusters in
the developing Drosophila retina. Development
122,4139
-4147.[Abstract]
Domingos, P. M., Brown, S., Barrio, R., Ratnakumar, K.,
Frankfort, B. J., Mardon, G., Steller, H. and Mollereau, B.
(2004). Regulation of R7 and R8 differentiation by the spalt
genes. Dev. Biol. 273,121
-133.[CrossRef][Medline]
Dominguez, M. (1999). Dual role for Hedgehog in
the regulation of the proneural gene atonal during ommatidia development.
Development 126,2345
-2353.[Abstract]
Dominguez, M., Wasserman, J. D. and Freeman, M.
(1998). Multiple functions of the EGF receptor in Drosophila eye
development. Curr. Biol.
8,1039
-1048.[CrossRef][Medline]
Ferrell, J. E. (2002). Self-perpetuating states
in signal transduction: positive feedback, double-negative feedback and
bistability. Curr. Opin. Cell Biol.
14,140
-148.[CrossRef][Medline]
Frankfort, B. J. and Mardon, G. (2002). R8
development in the Drosophila eye: a paradigm for neural selection and
differentiation. Development
129,1295
-1306.[Medline]
Frankfort, B. J., Nolo, R., Zhang, Z., Bellen, H. and Mardon,
G. (2001). senseless repression of rough is required for R8
photoreceptor differentiation in the developing Drosophila eye.
Neuron 32,403
-414.[CrossRef][Medline]
Freeman, M. (1994). The spitz gene is required
for photoreceptor determination in the Drosophila eye where it interacts with
the EGF receptor. Mech. Dev.
48, 25-33.[CrossRef][Medline]
Freeman, M. (1996). Reiterative use of the EGF
receptor triggers differentiation of all cell types in the Drosophila eye.
Cell 87,651
-660.[CrossRef][Medline]
Ghysen, A. and Dambly-Chaudiere, C. (1989).
Genesis of the Drosophila peripheral nervous system. Trends
Genet. 5,251
-255.[CrossRef][Medline]
Heberlein, U., Mlodzik, M. and Rubin, G. M.
(1991). Cell-fate determination in the developing Drosophila eye:
role of the rough gene. Development
112,703
-712.[Abstract]
Heberlein, U., Wolff, T. and Rubin, G. M.
(1993). The TGF beta homolog dpp and the segment polarity gene
hedgehog are required for propagation of a morphogenetic wave in the
Drosophila retina. Cell
75,913
-926.[CrossRef][Medline]
Heberlein, U., Penton, A., Falsafi, S., Hackett, D. and Rubin,
G. M. (1994). The C-terminus of the homeodomain is required
for functional specificity of the Drosophila rough gene. Mech.
Dev. 48,35
-49.[CrossRef][Medline]
Hsiung, F. and Moses, K. (2002). Retinal
development in Drosophila: specifying the first neuron. Hum. Mol.
Genet. 11,1207
-1214.
Jafar-Nejad, H., Acar, M., Nolo, R., Lacin, H., Parkhurst, S. M.
and Bellen, H. J. (2003). Senseless acts as a binary switch
during sensory organ precursor selection. Genes Dev.
17,2966
-2978.
Jarman, A. P., Brand, M., Jan, L. Y. and Jan, Y. N.
(1993a). The regulation and function of the helix-loop-helix
gene, asense, in Drosophila neural precursors.
Development 119,19
-29.[Abstract]
Jarman, A. P., Grau, Y., Jan, L. Y. and Jan, Y. N.
(1993b). atonal is a proneural gene that directs chordotonal
organ formation in the Drosophila peripheral nervous system.
Cell 73,1307
-1321.[CrossRef][Medline]
Jarman, A. P., Grell, E. H., Ackerman, L., Jan, L. Y. and Jan,
Y. N. (1994). Atonal is the proneural gene for Drosophila
photoreceptors. Nature
369,398
-400.[CrossRef][Medline]
Jarman, A. P., Sun, Y., Jan, L. Y. and Jan, Y. N.
(1995). Role of the proneural gene, atonal, in formation of
Drosophila chordotonal organs and photoreceptors.
Development 121,2019
-2030.[Abstract]
Lai, E. C. (2004). Notch signaling: control of
cell communication and cell fate. Development
131,965
-973.
Lee, E. C., Hu, X., Yu, S. Y. and Baker, N. E.
(1996). The scabrous gene encodes a secreted glycoprotein dimer
and regulates proneural development in Drosophila eyes. Mol. Cell.
Biol. 16,1179
-1188.[Abstract]
Ma, C. Y., Zhou, Y., Beachy, P. A. and Moses, K.
(1993). The segment polarity gene hedgehog is required for
progression of the morphogenetic furrow in the developing Drosophila eye.
Cell 75,927
-938.[CrossRef][Medline]
Mikeladze-Dvali, T., Wernet, M. F., Pistillo, D., Mazzoni, E.
O., Teleman, A. A., Chen, Y. W., Cohen, S. and Desplan, C.
(2005). The growth regulators warts/lats and melted interact in a
bistable loop to specify opposite fates in Drosophila R8 photoreceptors.
Cell 122,775
-787.[CrossRef][Medline]
Murre, C., McCaw, P. S. and Baltimore, D.
(1989a). A new DNA binding and dimerization motif in
immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins.
Cell 56,777
-783.[CrossRef][Medline]
Murre, C., McCaw, P. S., Vaessin, H., Caudy, M., Jan, L. Y.,
Jan, Y. N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B. et
al. (1989b). Interactions between heterologous
helix-loop-helix proteins generate complexes that bind specifically to a
common DNA sequence. Cell
58,537
-544.[CrossRef][Medline]
Nolo, R., Abbot, L. A. and Bellen, H. J.
(2000). Senseless, a Zn finger transcription factor, is necessary
and sufficient for sensory organ development in Drosophila.
Cell 102,349
-362.[CrossRef][Medline]
Pepple, K. L., Anderson, A. E., Frankfort, B. J. and Mardon,
G. (2007). A genetic screen in Drosophila for genes
interacting with senseless during neuronal development identifies the importin
moleskin. Genetics 175,125
-141.
Powell, L. M., Zur Lage, P. I., Prentice, D. R., Senthinathan,
B. and Jarman, A. P. (2004). The proneural proteins Atonal
and Scute regulate neural target genes through different E-box binding sites.
Mol. Cell. Biol. 24,9517
-9526.
Rawlins, E. L., White, N. M. and Jarman, A. P.
(2003). Echinoid limits R8 photoreceptor specification by
inhibiting inappropriate EGF receptor signalling within R8 equivalence groups.
Development 130,3715
-3724.
Ready, D., Hanson, T. and Benzer, S. (1976).
Development of the Drosophila retina, a neurocrystalline lattice.
Dev. Biol. 53,217
-240.[CrossRef][Medline]
Spencer, S. A. and Cagan, R. L. (2003).
Echinoid is essential for regulation of Egfr signaling and R8 formation during
Drosophila eye development. Development
130,3725
-3733.
Sprecher, S. G. and Desplan, C. (2008). Switch
of rhodopsin expression in terminally differentiated Drosophila sensory
neurons. Nature 454,533
-537.[CrossRef][Medline]
Sukhanova, M. J., Deb, D. K., Gordon, G. M., Matakatsu, M. T.
and Du, W. (2007). Proneural basic helix-loop-helix proteins
and epidermal growth factor receptor signaling coordinately regulate cell type
specification and cdk inhibitor expression during development. Mol.
Cell. Biol. 27,2987
-2996.
Sun, Y., Jan, L. Y. and Jan, Y. N. (1998).
Transcriptional regulation of atonal during development of the Drosophila
peripheral nervous system. Development
125,3731
-3740.[Abstract]
Tio, M. and Moses, K. (1997). The Drosophila
TGF alpha homolog Spitz acts in photoreceptor recruitment in the developing
retina. Development 124,343
-351.[Abstract]
Tio, M., Ma, C. and Moses, K. (1994). spitz, a
Drosophila homolog of transforming growth factor-alpha, is required in the
founding photoreceptor cells of the compound eye facets. Mech.
Dev. 48,13
-23.[CrossRef][Medline]
Tomlinson, A. and Ready, D. F. (1987). Neuronal
differentiation in the Drosophila ommatidium. Dev.
Biol. 120,366
-376.[CrossRef][Medline]
Venken, K. J. T., He, Y. C., Hoskins, R. A. and Bellen, H.
J. (2006). P[acman]: A BAC transgenic platform for targeted
insertion of large DNA fragments in D. melanogaster.
Science 314,1747
-1751.
Voas, M. G. and Rebay, I. (2004). Signal
integration during development: insights from the Drosophila eye.
Dev. Dyn. 229,162
-175.[CrossRef][Medline]
White, N. M. and Jarman, A. P. (2000).
Drosophila atonal controls photoreceptor R8-specific properties and modulates
both receptor tyrosine kinase and Hedgehog signalling.
Development 127,1681
-1689.[Abstract]
Wolff, T. and Ready, D. F. (1991). The
beginning of pattern formation in the Drosophila compound eye: the
morphogenetic furrow and the second mitotic wave.
Development 113,841
-850.[Abstract]
Xie, B., Charlton-Perkins, M., McDonald, E., Gebelein, B. and
Cook, T. (2007). Senseless functions as a molecular switch
for color photoreceptor differentiation in Drosophila.
Development 134,4243
-4253.
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||