DEV028951 Supplementary Material

Files in this Data Supplement:

• Supplemental Figure S1 -

  Fig. S1. Recombineering to specifically delete the R8 enhancer of sens. (A) An 18 kb genomic region containing the sens locus was incorporated into the Pacman transposable element by recombineering from BACR17E13 (Venken et al., 2006). The F2 deletion was created by inducing recombination between the sens-L genomic rescue and a mutagenic PCR fragment that lacks the F2 region. (B) A mutagenic PCR fragment was generated to delete the F2 region (in green) in two PCR steps. The first step generated two short products (Left Arm in red, Right Arm in blue) located on either side of the R8 enhancer. 40 bp of overlap was engineered with tails on primers 2 and 3. In the second step, the left and right products were mixed together to generate the mutagenic template. PCR with primers 1 and 4 generate a mutagenic product that lacks the 645 base pair F2 region (purple). Primer sequences: 1 AGCGGCAGGAATTTCCAGGTA, 2 TGACAACGGAACGGAAGTTGGAAATTGAAAGTGGTATTGGT, 3 ACCAATACCACTTTCAATTTCCAACTTCCGTTCCGTTGTCA, 4 CGCATGGTCTACGCGTAATTGT. Underlined sequences indicate the region of overlap generated in LA and RA. (C) The product of PCR 2 (mutagenic product) was used with the recombineering technique to specifically delete the F2 region from the sens-L genomic rescue in Pacman and generated ΔF2 genomic rescue. Briefly, The sens-L rescue construct was electroporated into DY380 cells (Lee et al., 2001). The sens-L containing DY380 cells were induced to express recombination proteins, then made electrocompetent (Venken et al., 2006). Mutagenic product (2 µl) was added to 60 µl of the DY380/sens-L cells and electroporated in a 1 mm cuvette at 1.8 kV, 200 Ohm, 25 µFD. Four-hundred and eighty individual colonies were screened in pools of five with test primers 5-GCATCAGCAGCAACATCCTGA and 6-CAACGGAACGGAAGTTGGAAAT. Putative recombinants were identified by a positive PCR. From positive pools single colonies were identified, and ΔF2 genomic rescue DNA was recovered by miniprep. The final ΔF2 construct was verified by sequencing and transgenics generated by injecting yw; Ki, Δ2-3/+ embryos with the ΔF2 genomic rescue.

  Reference

  Lee, E. C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D. A., Court, D. L., Jenkins, N. A. and Copeland, N. G. (2001). A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73, 56-65.

• Supplemental Figure S2 -

  Fig. S2. F2 is necessary and sufficient for photoreceptor-specific expression of sens and R8 development. (A) In a wild-type (wt) larval disc, Sens is expressed in the SOPs of the antennae (asterisk), the ocelli (arrow) and in R8 photoreceptors (bracket). (B) Sens and Elav expression demonstrate the ordered differentiation of wild-type photoreceptors. (C,D) The adult wild-type eye arranged in a neurocrystalline array of ommatidia as seen by SEM at (C) 200× and (D) 1000× magnification. (E) Section of a wild-type retina at the apical R7 level. The small central rhabdomere projects from R7. (E′) A wild-type ommatidium in a more basal section where the small central rhabdomere represents the R8 photoreceptor. (F-J′) In a normally lethal sens^E1 null animal, the sens-L genomic rescue construct restores viability and wild-type eye differentiation as seen by Sens expression (F) and Elav (G). The adult eye also appears wild-type at both 200× (H) and 1000× (I). Sections of sens-L rescue animals reveal a normal arrangement and number of photoreceptors at the R7 (J) and R8 levels (J′). (K-O) Deletion of the F2 enhancer from the sens-L genomic rescue generates the ΔF2 rescue construct. (K) ΔF2 does not rescue photoreceptor expression of Sens (bracket) in a sens^E1 mutant background but ocellar (arrow) and antennal SOPs (asterisk) express Sens normally. (L) Elav expression is disorganized and the adult ΔF2/+;sens^E1 eye (M,N) is small with abnormal ommatidial sizes and arrangement. (O) ΔF2/+;sens^E1 adult sections reveal the loss of all small rhabdomeres (R7 and R8). Small rhabdomeres are absent through the entire retina, so separate apical and basal sections are not shown. (P-T′) Driving sens cDNA expression with the F2 enhancer (F2-sens) in the ΔF2/+;sens^E1 background restores Sens expression in photoreceptors (bracket) and wild-type ELAV expression. (Q) Adult eye morphology is also rescued except for some sporadic loss of bristles (R,S). Sections reveal that R7 (T) and R8 (T′) development are rescued by F2-sens in a ΔF2/+;sens^E1 background.

• Supplemental Figure S3 -

  Fig. S3. Mutation of Ro binding site leads to expanded GFP. Simultaneous mutation of the H1 and H2 binding sites in B-short (H1,2*) causes expansion of GFP expression to two additional cells per ommatidium. (A) Sens staining in R8. (B) GFP is observed in three cells per ommatidium with the H1,2* mutant construct. (C) Merge of A and B.