|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 November 2008
doi: 10.1242/dev.029330
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Neurobiology, Harvard Medical School, Boston, MA 02115, USA.
* Author for correspondence (e-mail: lisa_goodrich{at}hms.harvard.edu)
Accepted 14 October 2008
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Inner ear, Morphogenesis, Vestibular system, Netrin, Lrig, Basement membrane, Mouse
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Sando et al., 1984).
Morphogenesis of the inner ear is set in motion by early patterning events,
which result in the expression of key cell fate determinants within discrete
domains of a primordial structure. The inner ear is sculpted from a simple
ball of epithelium called the otic vesicle
(Fig. 1)
(Fekete, 1999). The
semicircular canals are derived from two outpocketings, the canal pouches,
which are specified by transcription factors such as Otx1 and Dlx5
(Merlo et al., 2002;
Morsli et al., 1999). A
crucial event in canal development is the formation of the fusion plate in the
center of the pouch. During this process, the basement membrane breaks down,
allowing signaling molecules to induce proliferation in the surrounding
mesenchyme and the two epithelial walls to come together
(Martin and Swanson, 1993;
Pirvola et al., 2004;
Salminen et al., 2000;
Streeter, 1907). At the same
time, fusion plate cells lose their columnar morphology and intercalate to
form a single layer of cells (Martin and
Swanson, 1993). Importantly, these changes in cell morphology and
basal lamina integrity occur only in the vicinity of the fusion plate. By
contrast, the epithelium in the perimeter of the pouch remains intact and will
eventually form the walls of the mature canal. Hence, the final shape of each
canal is determined by when and where fusion occurs.
A key regulator of fusion is the laminin-related molecule netrin 1 (Ntn1).
In Ntn1 mutant mice, the inner ear fails to acquire its mature shape
due to an arrest in canal morphogenesis
(Salminen et al., 2000).
Although best characterized for its function as a secreted chemoattractant for
axons during neuronal development (Moore
et al., 2007), Ntn1 is also crucial for many aspects of tissue
morphogenesis, including cell migration and local cell adhesion
(Srinivasan et al., 2003;
Yebra et al., 2003). In the
inner ear, Ntn1 is required for breakdown of the basement membrane
surrounding the fusion plate (Salminen et
al., 2000). Ntn proteins are localized to the basal lamina
(Salminen et al., 2000;
Schneiders et al., 2007) and
can bind to collagen and laminin in vitro
(Schneiders et al., 2007;
Yebra et al., 2003), but how
Ntn1 signaling promotes basal lamina breakdown remains unclear
(Matilainen et al., 2007).
Despite abundant evidence that Ntn1 is a powerful morphogen, little is
known about the pathways that restrict Ntn1 expression to highly
limited spatiotemporal domains in any developing system
(Kennedy, 2000). In addition
to its functions during development, Ntn1 is overexpressed in several human
cancers (Fitamant et al., 2008;
Link et al., 2007),
underscoring the importance of understanding how expression of Ntn1
is regulated. Here, we demonstrate that Ntn1 expression is controlled
by cross-repressive interactions with the Ig superfamily protein Lrig3 that
define the boundary between the fusing and non-fusing regions of the lateral
canal pouch. This novel feedback loop dictates when and where basement
membrane breakdown occurs, thereby ensuring that the inner ear acquires its
precise three-dimensional shape.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Mitchell et al., 2001). The
mice have been maintained for over five generations on the C57Bl6/J
background. Genotyping was performed using the following primers: LST016F
(GAGGTGCCTGATGCTTAAGTTTCG); LST016R (TTCAACCTTGGCTTCCAATGTCCA); and GTR7
(CAAGTCTATCCTAGGGAAAGGGTC), which is specific to the
Lrig3LST016 gene trap vector pGT2TMPFS. The
Lrig3flox conditional allele was produced via homologous
recombination using a targeted construct with LoxP sites surrounding the
ATG-containing exon 1. Heterozygous mice were produced by germline
Cre-excision using a global deleter line
(Schwenk et al., 1995).
Genotyping was performed using the following primers: VEA303
(CGGAATTTCCTACAATCTCAGC); VEA304 (GTGCTCCTGGTGGCTCAGT); VEA305
(CCCCCTCCAATTTTAACAAA). The Ntn1 gene trap line has been previously
reported (Serafini et al.,
1996). The mice have been maintained for over five generations on
the C57Bl6/J background. Genotyping was performed using the following primers:
pGT1_8TM3021R (GTTGCACCACAGATGAAACG); pGTEn2_1723 (TCCCGAAAACCAAAGAAGAAG); and
pGT1_8TM1743 (GAACCCTAACAAAGAGGACAAG). The described genotyping screen allows
for the detection of the Ntn1-specific gene trap vector
pGT1.8TM. Heterozygous and mutant genotypes were confirmed by
evaluating the thickness of the ventral commissure in the neural tube
following βIII-Tubulin and Neurofilament immunostaining on cryosectioned
embryos. These two gene trap lines are annotated as
Lrig3+/- or Ntn1+/- for the
heterozygous condition and Lrig3-/- or
Ntn1-/- for the mutant condition. Unc5hb mutant
mice were maintained on a CD1 background and genotyped as described
(Lu et al., 2004). The
integrin 
6 gene trap mice (Mitchell
et al., 2001) were maintained on a C57Bl6/J background and were
genotyped using the following primers: LST045F5 (GCCCAAATCCCTTGTGTATG);
LST045R1 (ACCCACAGCAACCTTTGTTC); and GTR3 (TCTA GGACAAGAGGGCGAGA). The mice
were maintained in accordance with institutional and NIH guidelines approved
by the IACUC at Harvard Medical School and the University of Virginia.
|
) with
SYBR Green Supermix (BioRad) and primers flanking the Lrig3 exon3/4
boundary: VEA48 (GAACAACAATGAATTAGAGACCATTC) and VEA49 (AGGGTGGAAAGGCAGTTCTC).
Levels were normalized based on amplification of GAPDH from the same samples:
GAPDHe-F (CTCATGACCACAGTCCATGC) and GAPDHe-R (GCACGTCAGATCCACGAC). Loss of
Lrig3 message from Lrig3 null mice was confirmed by RT-PCR
amplification of E12.5 embryonic cDNA using primers VEA48 and VEA49.
Paintfilling
E12-E14.5 embryos were fixed overnight at 4°C with Bodian's Fix,
dehydrated overnight at room temperature with 100% ethanol, then cleared
overnight at room temperature with methyl salicylate. Heads were hemisected,
and white latex paint (Benjamin Moore) diluted to 0.025% in methyl salicylate
was injected into the cochlea with a pulled glass pipette and a Hamilton
syringe filled with glycerol.
In situ hybridization
Non-radioactive in situ hybridization was performed on 10-12 µm
cryosections using the following probes: Ntn1 (NM_008744),
Otx1 (NM_011023), Otx2 (NM_144841), Dlx5
(NM_010056) and Hmx3 (NM_008257). A detailed protocol is available at
http://neuro.med.harvard.edu/site/goodrichweb/.
X-gal and PLAP staining
Staining for β-galactosidase and alkaline phosphatase activity was
performed as described (Leighton et al.,
2001) except that 10-20 µm frozen sections were used, and the
tissue was fixed for 1 hour at 4°C.
Immunohistochemistry
E12 embryos were collected and fixed for 1-2 hours at 4°C in 4% PFA/PBS
and then dehydrated in 30% sucrose/PBS overnight at 4°C. Embryos were then
embedded in Neg50 (Richard-Allan Scientific). Cryosections (5-10 µm) were
blocked and permeabilized in 5% normal donkey serum + 2% BSA + 0.1% Triton
X-100 for 1 hour at room temperature. Primary antibodies were added into the
above block, without Triton X-100, overnight at 4°C at the following
concentrations: collagen IV (1:200, Abcam, ab6586); pan-mouse laminin (1:250,
Chemicon, AB2034); βIII-tubulin (1:1000, Covance, PRB-435P); and
neurofilament (1:500, DSHB, SH3). The following day, the sections were
incubated in secondary antibody (1:2000, Alexa Fluor488 or 568, Jackson
Immunoresearch) in block, without Triton X-100. All sections were
counterstained with DAPI (1:10,000).
Histology and electron microscopy
Plastic semi-thin (1 µm) and ultra-thin (90 nm) sections for light and
electron microscopy studies were obtained with help from the Harvard Medical
School Electron Microscopy Facility
(cellbio.med.harvard.edu/research_facilities).
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Mitchell et al., 2001). Upon
insertion into the intron of a gene, the gene trap vector simultaneously
blocks transcription and reports the normal expression pattern of that gene
through a β-galactosidase reporter
(Fig. 2A). X-gal-stained
heterozygous embryos were examined to find genes expressed in restricted
domains of the otic vesicle prior to morphogenesis, and then homozygous
mutants for the best candidate genes were assessed for defects in hearing and
balance.
In this screen, we identified a strain of mice, LST016, with
β-galactosidase activity in the lateral wall of the otic vesicle
(Fig. 2B,C), a region fated to
give rise to the lateral semicircular canal
(Fekete and Wu, 2002).
Homozygous mutants exhibit circling and head tossing behaviors, consistent
with the presence of an inner ear defect
(Fig. 2D). Visualization of the
three-dimensional structure of the vestibular apparatus revealed a fully
penetrant truncation of the lateral semicircular canal in homozygotes
(Fig. 2G-J). Histological
studies confirmed that the canal epithelium is missing as early as E13 (data
not shown). The lateral ampulla is unaffected, and the sensory epithelium is
properly innervated, as determined by myosin VIIa and neurofilament
immunostaining (Fig. 2I,J; data
not shown). Although the reporter is also active in the developing cochlea
(see Fig. S1H in the supplementary material), the mice develop normal hearing
as assessed by auditory brainstem response (ABR) assays (see Fig. S2 in the
supplementary material). All mutants also display craniofacial deformities and
a dramatically shortened snout (Fig.
2E,F).
|
). Lrig3
is one of three members in a family of single-pass transmembrane proteins
containing 15 leucine-rich repeats (LRR) and three immunoglobulin (Ig) domains
in the extracellular domain and intracellular tails that vary in length and
composition (Guo et al., 2004;
Hedman and Henriksson, 2007).
Quantitative RT-PCR of homozygous Lrig3 tissue (n=4 embryos)
detected only 3.05±1.59% of the wild-type transcript, indicating that
the phenotype is severely hypomorphic. To confirm that the phenotype is due to
a loss of Lrig3, a null allele was made by flanking the ATG-bearing
exon of Lrig3 with LoxP sites
(Fig. 2A). After germline
Cre-mediated excision, no Lrig3 messenger RNA remained (data not
shown). Null mutant mice exhibit the same lateral canal and craniofacial
defects evident in the gene trap allele (data not shown), demonstrating that
the phenotypes reflect a complete loss of Lrig3 function.
Truncation of the lateral semicircular canal in Lrig3 homozygotes is due to early and ectopic fusion
The semicircular canals develop from two epithelial outpocketings called
canal pouches, with the anterior and posterior canals arising from the dorsal
pouch and the lateral canal forming from the lateral pouch
(Fig. 1). Early patterning
events that define the axes of the otic vesicle result in restricted
expression of transcription factors that specify the two pouches. Because
Lrig3 expression is restricted to the lateral pouch during these
early patterning stages, it seemed possible that Lrig3 acts in a signaling
pathway that ensures restricted expression of transcription factors required
for specification of the lateral canal. To test this, we examined the
expression patterns of Otx1, Otx2, Hmx3 and Dlx5,
transcription factors required for normal development of the vestibular system
(Merlo et al., 2002;
Morsli et al., 1999;
Wang et al., 1998). However,
Lrig3 mutant embryos exhibited no obvious changes in early gene
expression, indicating that the lateral pouch is specified in the right place
and at the right time (see Fig. S3 in supplementary material).
As canal patterning was unaffected, we asked whether subsequent
morphogenesis events proceed normally in Lrig3 mutant embryos. We
visualized pouch outgrowth and fusion by paintfilling inner ears between E11.5
and E12.5 (Fig. 3). The precise
stage of canal development was determined by evaluating the extent of fusion
in the anterior and posterior canals, which develop earlier than the lateral
canal (Martin and Swanson,
1993). In control embryos, the lateral pouch grows out at E12 and
fusion begins at E12.5 (Fig.
3A-C). No changes in the size or shape of the early canal pouch
occur in E12 Lrig3 mutant embryos, consistent with correct patterning
of the otic vesicle (Fig. 3D).
However, fusion in the lateral pouch begins several hours earlier than normal
and over a larger area, extending to the perimeter of the lateral pouch
epithelium (Fig. 3E). The
lateral canal is truncated by E12.5, when fusion is just beginning in
wild-type littermates (Fig.
3F). Thus, fusion is expanded and accelerated in Lrig3
mutants.
|
These results suggest that Lrig3 is required in the non-fusing
epithelium to prevent fusion from occurring by balancing the activity of
Ntn1 in the fusion plate. Malformation of the semicircular canals in
Ntn1 mutant mice is preceded by a failure in basement membrane
breakdown (Salminen et al.,
2000). Therefore, we asked whether the early and ectopic fusion
event in Lrig3 mutant mice is also accompanied by changes in the
integrity of the basal lamina that normally separates the epithelium from the
surrounding mesenchyme. We found that dramatic changes occur in the basal
lamina of Lrig3 mutant embryos. In control embryos, laminin and
collagen networks are intact prior to fusion plate formation, as shown by
immunostaining and electron microscopy analysis
(Fig. 4A-E). By contrast, in
Lrig3 mutants, the basal lamina is missing or disrupted throughout
the lateral pouch, including regions where fusion normally never occurs
(Fig. 4F-J). Moreover, the otic
epithelium throughout the lateral pouch is abnormally thin, such that even
cells in the perimeter of the pouch resemble fusion plate cells
(Fig. 4A',F').
Neither caspase 3 immunostaining (see Fig. S4 in the supplementary material)
nor electron microscopy analysis (data not shown) revealed an increase in
apoptosis, suggesting that these morphological changes are not associated with
cell death. Thus, Lrig3 inhibits basement membrane breakdown in the non-fusing
epithelium.
Ntn1-dependent basal lamina breakdown does not require known receptors
To understand the molecular basis of the basement membrane phenotype, we
explored the possibility that Lrig3 modulates Ntn1 activity by regulating one
of its known receptors. This hypothesis is supported by the facts that
Lrig3 is expressed complementary to Ntn1 and that Lrig
proteins regulate degradation of many different transmembrane receptors
(Hedman and Henriksson, 2007).
Ntn1 is best known as an axon guidance molecule, which signals through the Ig
superfamily of receptors DCC (deleted in colorectal cancer) and neogenin 1, as
well as the Unc5 family of receptors (Unc5Ha-d)
(Moore et al., 2007). Outside
of the nervous system, Ntn1 signals through neogenin
(Srinivasan et al., 2003),
Unc5hb (Lu et al., 2004) and
integrin 3/6 receptors (Yebra et
al., 2003) to regulate cell adhesion, migration and other aspects
of tissue morphogenesis.
To identify relevant receptors, we asked whether any of the known Ntn1
receptors is required for inner ear morphogenesis. In situ hybridization
screens by our laboratory and others revealed Unc5hb, neogenin and
integrin 3/6 as potential candidates
(Matilainen et al., 2007).
However, although Unc5hb is expressed together with Lrig3 in
non-fusing epithelium, the inner ear forms normally in Unc5hb mutant
mice (see Fig. S5 in the supplementary material). Moreover, none of the known
Ntn1 receptors that are expressed in the developing otic epithelium (neogenin,
integrin 3/6) or surrounding mesenchyme (Unc5hc) are required
for canal morphogenesis (see Fig. S5 in the supplementary material)
(Matilainen et al., 2007).
Interestingly, the pro-angiogenic activities of Ntn1 have been proposed to
be independent of known receptors, suggesting an alternative binding partner
in this system (Wilson et al.,
2006). Although Lrig3 is a cell-surface protein, Lrig3 does not
appear to be the missing receptor, as tagged versions of Lrig3 and Ntn1 do not
colocalize in cultured cell lines (see Fig. S6 in the supplementary material).
Moreover, equal amounts of Ntn1 are secreted from cells in the presence and
absence of Lrig3 (see Fig. S6 in the supplementary material). Thus, Ntn1
appears to act through a non-canonical pathway in the inner ear to control
basal lamina integrity, either via a novel receptor or a receptor-independent
mechanism.
|
|
). As seen by β-galactosidase histochemistry
(Fig. 3I), PLAP expression is
reduced in the fusion plate in Lrig3 heterozygous embryos
(Fig. 5C). By contrast, in
Ntn1 mutants, PLAP expression persists throughout the lateral pouch
(Fig. 5G). Surprisingly, we
also observed sustained expression of Lrig3 itself in Lrig3
mutants, indicating that Lrig3 is required for its own downregulation
(Fig. 5B,F). Therefore, we
asked whether Ntn1 transcription is also autoregulated. Indeed,
Ntn1-βgeo expression is lost from the lateral pouch in Ntn1
mutants (Fig. 5D,H). Ntn1
autoregulation appears to be limited to the lateral pouch, as no changes in
expression occur in the dorsal pouch. Together, these experiments show that
mutually antagonistic interactions between Lrig3 and Ntn1
restrict Ntn1 expression to fusion plate cells and Lrig3
expression to non-fusing epithelium. This feedback loop seems to be uniquely
important for lateral canal development, suggesting that new mechanisms
operate in this most recently evolved semicircular canal.
|
We conclude that Lrig3 plays a pivotal role in lateral canal morphogenesis by restricting Ntn1 expression to the fusion plate. Cross-repressive interactions between Lrig3 and Ntn1 coordinate the timing and location of fusion, thereby determining the shape of the lateral canal.
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Historically, much emphasis has been placed on the identification of
determinants that define domains within the anlage of a developing structure.
More recently, however, it has become clear that an additional level of
control is needed to restrict the spatiotemporal activities of each factor. A
common solution to this problem is the production of a feedback-induced
antagonist that dampens the activity of a signaling pathway after activation,
as is the case for Sprouty and Sef proteins in the FGF pathway
(Shim et al., 2005;
Tsang and Dawid, 2004).
Signaling activity is also modulated by the basal lamina, which can limit
dispersal of the protein and its ability to bind to its receptor
(Relan and Schuger, 1999). The
Lrig3/Ntn1 feedback loop incorporates both of these features: the
induction of an antagonist, Lrig3, which controls the timing and
extent of Ntn1-dependent basal lamina breakdown.
The Ntn1/Lrig3 feedback loop uncovered by this analysis is a novel
mechanism for modulating expression of Ntn1 during development. In
addition to the developing canals, Lrig3 and Ntn1 are also
expressed in many other regions of the embryo, including the cochlea, neural
tube and somites (see Fig. S1 in the supplementary material). Although no
alterations of these tissues are obvious in Lrig3 mutant mice (data
not shown), this may be due to compensation by the close family member
Lrig1. Indeed, our expression studies indicate that the only two
places where Lrig1 and Lrig3 do not overlap are the lateral
canal pouch and the branchial arches, consistent with the lateral canal
truncation and craniofacial abnormalities evident in Lrig3 mutant
mice. Conversely, psoriasis is the only salient defect reported in
Lrig1 mutant mice (Suzuki et al.,
2002). Hence, Lrig1; Lrig3 double mutants may exhibit
additional phenotypes related to misregulation of Ntn1 and may reveal
a general mechanism for Ntn1 regulation.
|
). Consistent with this idea, all three Lrig genes
are downregulated in specific human cancers, with Lrig1 studied most
extensively (Guo et al., 2006;
Hedman and Henriksson, 2007;
Hedman et al., 2002;
Lindstrom et al., 2008;
Ljuslinder et al., 2007).
Strikingly, the loss of Lrig1 correlates with worse outcomes in
advanced stage cervical cancer (Lindstrom
et al., 2008) and squamous cell carcinomas
(Tanemura et al., 2005). In
addition, the presence of Lrig1 is sufficient to inhibit the invasive
behavior of bladder cancer cell lines and to prevent breakdown of fibronectin
in a cell-matrix adhesion assay (Yang et
al., 2006). Conversely, increased Ntn-1 induces tumor
growth and invasion in human colorectal cell lines
(Rodrigues et al., 2007) and
is associated with poor prognoses for adenocarcinoma
(Link et al., 2007). Although
the effect of Ntn-1 on tumor behavior is mediated in part by
inhibition of apoptosis through the DCC and Unc5h dependence receptors
(Fitamant et al., 2008;
Mazelin et al., 2004;
Rodrigues et al., 2007), our
data raise the possibility that in some tumors, Ntn1 may act
downstream of Lrig3 to facilitate basement membrane breakdown and tumor
metastasis.
Based on the current understanding of this poorly characterized family of
proteins, it is likely that Lrig3 represses Ntn1 transcription by
regulating activity of a receptor tyrosine kinase signaling pathway. The
best-studied family member, Lrig1, is induced by EGF signaling and antagonizes
downstream signaling events by causing degradation of all four ErbB receptors
(Gur et al., 2004;
Laederich et al., 2004). Lrig1
has also been implicated as a negative regulator of Met and Ret receptor
tyrosine kinases (RTKs) (Ledda et al.,
2008; Shattuck et al.,
2007), raising the possibility that Lrig proteins serve as general
antagonists of RTKs. Consistent with this idea, Lrig3 can bind to the FGF
receptor tyrosine kinase receptor in vitro and inhibits FGF signaling in the
developing neural crest in Xenopus
(Zhao et al., 2008). This
function may be conserved in mice, as Lrig3 morphant tadpoles exhibit
craniofacial defects similar to what is observed in Lrig3 mutant
mice. As FGF signaling plays a prominent role in canal morphogenesis
(Chang et al., 2004;
Pauley et al., 2003;
Pirvola et al., 2004), the
Lrig3 inner ear phenotype is also likely to be caused by aberrant FGF
activity. However, although FGF ligands and receptors have been implicated,
the downstream signaling events in the fusion plate remain elusive, with no
known target genes and multiple feedback-induced antagonists that are not
required for canal development (Abraira et
al., 2007; Shim et al.,
2005). Hence, until we have a better understanding of how FGF
signaling acts specifically in the fusion plate, it will be difficult to
determine whether and how Lrig3 influences FGF activity.
Together with what is known about Lrig function, the simplest interpretation of our results is that Lrig3 titrates activity of a receptor tyrosine kinase signaling pathway that normally induces expression of Ntn1, as well as Lrig3 itself (Fig. 7). Prior to fusion, Lrig3 is expressed throughout the lateral pouch, where it inhibits RTK activity and prevents fusion from beginning (Fig. 7, step 1). Subsequently, we hypothesize the presence of a fusion plate inducing signal, which overcomes Lrig3-mediated inhibition (Fig. 7, step 2) to activate the RTK pathway and allow expression of Ntn1 (Fig. 7, step 3). Ntn1, in turn, enhances activity of this same pathway, most probably by promoting breakdown of the basal lamina (Fig. 7, step 4). Hence, in Lrig3 mutants, increased RTK signaling results in early and expanded Ntn1 expression, as well as persistent Lrig3 expression (Fig. 7A). Conversely, in Ntn1 mutants, RTK signaling occurs at low levels, both because of the presence of Lrig3 and the failure to potentiate the pathway through Ntn1-mediated breakdown of the basal lamina. Owing to the low level of RTK signaling, canal development arrests at the canal pouch stage, such that expression of Ntn1 is lost and Lrig3 is never reduced (Fig. 7A).
A key feature of this model is the fact that Lrig3 is present prior to any of these events, but is also crucial for the subsequent emergence of mutually exclusive domains of Lrig3 and Ntn1 expression. As Lrig3 activity is required for the feedback loop to function properly, the initial Lrig3 expression also fails to be downregulated in Lrig3 mutants. Hence, the subsequent interactions between Lrig3 and Ntn1 serve to simultaneously reduce Lrig3 transcription and increase Ntn1 only in the regions that receive the inducing signal.
The proposed model fits both with the results reported here as well as the
known activities of Lrig3 and Ntn1, but also raises several questions for
future consideration. Unfortunately, the ability of Lrig proteins to bind to
widely divergent members of the receptor tyrosine kinase family in vitro will
make it difficult to pinpoint a single binding partner in vivo, especially in
a structure as small as the lateral pouch. The best candidate is the FGF
receptor, not only because Lrig3 is known to bind to and inhibit FGF receptor,
but also because of the known importance of FGF signaling during inner ear
development. In the developing vestibular system, FGF signaling cooperates
with the BMP pathway to define sensory and non-sensory domains of the inner
ear (Chang et al., 2004;
Pauley et al., 2003) and is
subsequently required for proliferation of the periotic mesenchyme
(Pirvola et al., 2004).
Moreover, mesenchymal proliferation is reduced in Ntn1 mutants,
consistent with the idea that Ntn1-dependent breakdown of the basal lamina
promotes the ability of the FGF ligand to act during canal morphogenesis.
Indeed, it is well established that FGF signaling levels are modified by
interactions with the basement membrane during other types of tissue
morphogenesis (Lonai, 2003;
Patel et al., 2007). Although
it remains unclear how Ntn1 mediates its effects, the extent of basement
membrane breakdown correlates strongly with the amount of Ntn1:
breakdown does not occur in Ntn1 mutants, is expanded in the presence
of ectopic Ntn1 in Lrig3 mutants, and proceeds normally in
rescued embryos that have only one copy of Ntn1. Additional
experiments will be needed to understand the specific function of Ntn1 in the
basement membrane, as well as how Ntn1-induced changes influence the activity
of FGF or other signaling ligands in the extracellular matrix.
Because modest perturbations in the structure of the inner ear cause severe
behavioral deficits, our genetic studies were able to reveal the consequences
of slight changes in signaling activity that may be undetectable by in vitro
methods. Indeed, lateral canal truncations also occur in BMP4
heterozygotes, emphasizing the unusual sensitivity of the developing inner ear
to modest changes in signaling levels
(Chang et al., 2008).
Similarly, in humans, the lateral canal is the most common site of inner ear
anomalies (Sando et al., 2001;
Sando et al., 1984),
emphasizing the importance of identifying the molecular players that make this
canal unusually susceptible to developmental insults. Hence, the
Lrig3/Ntn1 feedback loop may provide an additional safeguard
for tissues whose function depends crucially on the perfect morphogenesis of
complex structures.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/24/4091/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Abraira, V. E., Hyun, N., Tucker, A. F., Coling, D. E., Brown,
M. C., Lu, C., Hoffman, G. R. and Goodrich, L. V. (2007).
Changes in Sef levels influence auditory brainstem development and function.
J. Neurosci. 27,4273
-4282.
Chang, W., Brigande, J. V., Fekete, D. M. and Wu, D. K.
(2004). The development of semicircular canals in the inner ear:
role of FGFs in sensory cristae. Development
131,4201
-4211.
Chang, W., Lin, Z., Kulessa, H., Hebert, J., Hogan, B. L. and
Wu, D. K. (2008). Bmp4 is essential for the formation of the
vestibular apparatus that detects angular head movements. PLoS
Genet. 4,e1000050
.[CrossRef][Medline]
Fekete, D. M. (1999). Development of the
vertebrate ear: insights from knockouts and mutants. Trends
Neurosci. 22,263
-269.[CrossRef][Medline]
Fekete, D. M. and Wu, D. K. (2002). Revisiting
cell fate specification in the inner ear. Curr. Opin.
Neurobiol. 12,35
-42.[CrossRef][Medline]
Fitamant, J., Guenebeaud, C., Coissieux, M. M., Guix, C.,
Treilleux, I., Scoazec, J. Y., Bachelot, T., Bernet, A. and Mehlen, P.
(2008). Netrin-1 expression confers a selective advantage for
tumor cell survival in metastatic breast cancer. Proc. Natl. Acad.
Sci. USA 105,4850
-4855.
Guo, D., Holmlund, C., Henriksson, R. and Hedman, H.
(2004). The LRIG gene family has three vertebrate paralogs widely
expressed in human and mouse tissues and a homolog in Ascidiacea.
Genomics 84,157
-165.[CrossRef][Medline]
Guo, D., Nilsson, J., Haapasalo, H., Raheem, O., Bergenheim, T.,
Hedman, H. and Henriksson, R. (2006). Perinuclear
leucine-rich repeats and immunoglobulin-like domain proteins (LRIG1-3) as
prognostic indicators in astrocytic tumors. Acta
Neuropathol. 111,238
-246.[CrossRef][Medline]
Gupta, G. P. and Massague, J. (2006). Cancer
metastasis: building a framework. Cell
127,679
-695.[CrossRef][Medline]
Gur, G., Rubin, C., Katz, M., Amit, I., Citri, A., Nilsson, J.,
Amariglio, N., Henriksson, R., Rechavi, G., Hedman, H. et al.
(2004). LRIG1 restricts growth factor signaling by enhancing
receptor ubiquitylation and degradation. EMBO J.
23,3270
-3281.[CrossRef][Medline]
Hedman, H. and Henriksson, R. (2007). LRIG
inhibitors of growth factor signalling-double-edged swords in human cancer?
Eur. J. Cancer 43,676
-682.[CrossRef][Medline]
Hedman, H., Nilsson, J., Guo, D. and Henriksson, R.
(2002). Is LRIG1 a tumour suppressor gene at chromosome 3p14.3?
Acta Oncol. 41,352
-354.[CrossRef][Medline]
Kennedy, T. E. (2000). Cellular mechanisms of
netrin function: long-range and short-range actions. Biochem. Cell
Biol. 78,569
-575.[CrossRef][Medline]
Laederich, M. B., Funes-Duran, M., Yen, L., Ingalla, E., Wu, X.,
Carraway, K. L., 3rd and Sweeney, C. (2004). The leucine-rich
repeat protein LRIG1 is a negative regulator of ErbB family receptor tyrosine
kinases. J. Biol. Chem.
279,47050
-47056.
Ledda, F., Bieraugel, O., Fard, S. S., Vilar, M. and Paratcha,
G. (2008). Lrig1 is an endogenous inhibitor of Ret receptor
tyrosine kinase activation, downstream signaling, and biological responses to
GDNF. J. Neurosci. 28,39
-49.
Leighton, P. A., Mitchell, K. J., Goodrich, L. V., Lu, X.,
Pinson, K., Scherz, P., Skarnes, W. C. and Tessier-Lavigne, M.
(2001). Defining brain wiring patterns and mechanisms through
gene trapping in mice. Nature
410,174
-179.[CrossRef][Medline]
Lindstrom, A. K., Ekman, K., Stendahl, U., Tot, T., Henriksson,
R., Hedman, H. and Hellberg, D. (2008). LRIG1 and squamous
epithelial uterine cervical cancer: correlation to prognosis, other tumor
markers, sex steroid hormones, and smoking. Int. J. Gynecol.
Cancer 18,312
-317.[CrossRef][Medline]
Link, B. C., Reichelt, U., Schreiber, M., Kaifi, J. T.,
Wachowiak, R., Bogoevski, D., Bubenheim, M., Cataldegirmen, G., Gawad, K. A.,
Issa, R. et al. (2007). Prognostic implications of netrin-1
expression and its receptors in patients with adenocarcinoma of the pancreas.
Ann. Surg. Oncol. 14,2591
-2599.[CrossRef][Medline]
Ljuslinder, I., Golovleva, I., Palmqvist, R., Oberg, A.,
Stenling, R., Jonsson, Y., Hedman, H., Henriksson, R. and Malmer, B.
(2007). LRIG1 expression in colorectal cancer. Acta
Oncol. 46,1118
-1122.[CrossRef][Medline]
Lonai, P. (2003). Epithelial mesenchymal
interactions, the ECM and limb development. J. Anat.
202, 43-50.[CrossRef][Medline]
Lu, X., Le Noble, F., Yuan, L., Jiang, Q., De Lafarge, B.,
Sugiyama, D., Breant, C., Claes, F., De Smet, F., Thomas, J. L. et al.
(2004). The netrin receptor UNC5B mediates guidance events
controlling morphogenesis of the vascular system.
Nature 432,179
-186.[CrossRef][Medline]
Martin, P. and Swanson, G. J. (1993).
Descriptive and experimental analysis of the epithelial remodellings that
control semicircular canal formation in the developing mouse inner ear.
Dev. Biol. 159,549
-558.[CrossRef][Medline]
Matilainen, T., Haugas, M., Kreidberg, J. A. and Salminen,
M. (2007). Analysis of Netrin 1 receptors during inner ear
development. Int. J. Dev. Biol.
51,409
-413.[CrossRef][Medline]
Mazelin, L., Bernet, A., Bonod-Bidaud, C., Pays, L., Arnaud, S.,
Gespach, C., Bredesen, D. E., Scoazec, J. Y. and Mehlen, P.
(2004). Netrin-1 controls colorectal tumorigenesis by regulating
apoptosis. Nature 431,80
-84.[CrossRef][Medline]
Merlo, G., Laura, P., Mantero, S., Zerega, B., Adamska, M.,
Rinkwitz, S., Bober, E. and Levi, G. (2002). The
Dlx5 homeobox gene is essential for vestibular morphogenesis in the
mouse embryo through a BMP4-mediated pathway. Dev.
Biol. 248,157
-169.[CrossRef][Medline]
Mitchell, K. J., Pinson, K. I., Kelly, O. G., Brennan, J.,
Zupicich, J., Scherz, P., Leighton, P. A., Goodrich, L. V., Lu, X., Avery, B.
J. et al. (2001). Functional analysis of secreted and
transmembrane proteins critical to mouse development. Nat.
Genet. 28,241
-249.[CrossRef][Medline]
Moore, S. W., Tessier-Lavigne, M. and Kennedy, T. E.
(2007). Netrins and their receptors. Adv. Exp. Med.
Biol. 621,17
-31.[Medline]
Morsli, H., Tuorto, F., Choo, D., Postiglione, M. P., Simeone,
A. and Wu, D. K. (1999). Otx1 and Otx2 activities are
required for the normal development of the mouse inner ear.
Development 126,2335
-2343.[Abstract]
Patel, V. N., Knox, S. M., Likar, K. M., Lathrop, C. A.,
Hossain, R., Eftekhari, S., Whitelock, J. M., Elkin, M., Vlodavsky, I. and
Hoffman, M. P. (2007). Heparanase cleavage of perlecan
heparan sulfate modulates FGF10 activity during ex vivo submandibular
gland branching morphogenesis. Development
134,4177
-4186.
Pauley, S., Wright, T. J., Pirvola, U., Ornitz, D., Beisel, K.
and Fritzsch, B. (2003). Expression and function of FGF10 in
mammalian inner ear development. Dev. Dyn.
227,203
-215.[CrossRef][Medline]
Pirvola, U., Zhang, X., Mantela, J., Ornitz, D. M. and Ylikoski,
J. (2004). Fgf9 signaling regulates inner ear morphogenesis
through epithelial-mesenchymal interactions. Dev.
Biol. 273,350
-360.[CrossRef][Medline]
Relan, N. K. and Schuger, L. (1999). Basement
membranes in development. Pediatr. Dev. Pathol.
2, 103-118.[CrossRef][Medline]
Rodrigues, S., De Wever, O., Bruyneel, E., Rooney, R. J. and
Gespach, C. (2007). Opposing roles of netrin-1 and the
dependence receptor DCC in cancer cell invasion, tumor growth and metastasis.
Oncogene 26,5615
-5625.[CrossRef][Medline]
Salminen, M., Meyer, B. I., Bober, E. and Gruss, P.
(2000). Netrin 1 is required for semicircular canal formation in
the mouse inner ear. Development
127, 13-22.[Abstract]
Sando, I., Takahara, T. and Ogawa, A. (1984).
Congenital Anomalies of the Inner Ear. Ann. Otol. Rhinol.
Laryngol. Suppl. 112,110
-118.
Sando, I., Orita, Y., Miura, M. and Balaban, C.
(2001). Vestibular abnormalities in congenital disorders.
Ann. NY Acad. Sci. 942,15
-24.[Medline]
Schneiders, F. I., Maertens, B., Bose, K., Li, Y., Brunken, W.
J., Paulsson, M., Smyth, N. and Koch, M. (2007). Binding of
netrin-4 to laminin short arms regulates basement membrane assembly.
J. Biol. Chem. 282,23750
-23758.
Schwenk, F., Baron, U. and Rajewsky, K. (1995).
A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene
segments including deletion in germ cells. Nucleic Acids
Res. 23,5080
-5081.
Serafini, T., Colamarino, S. A., Leonardo, E. D., Wang, H.,
Beddington, R., Skarnes, W. C. and Tessier-Lavigne, M.
(1996). Netrin-1 is required for commissural axon guidance in the
developing vertebrate nervous system. Cell
87,1001
-1014.[CrossRef][Medline]
Shattuck, D. L., Miller, J. K., Laederich, M., Funes, M.,
Petersen, H., Carraway, K. L., 3rd and Sweeney, C. (2007).
LRIG1 is a novel negative regulator of the Met receptor and opposes Met and
Her2 synergy. Mol. Cell. Biol.
27,1934
-1946.
Shim, K., Minowada, G., Coling, D. E. and Martin, G. R.
(2005). Sprouty2, a mouse deafness gene, regulates cell fate
decisions in the auditory sensory epithelium by antagonizing FGF signaling.
Dev. Cell 8,553
-564.[CrossRef][Medline]
Srinivasan, K., Strickland, P., Valdes, A., Shin, G. C. and
Hinck, L. (2003). Netrin-1/neogenin interaction stabilizes
multipotent progenitor cap cells during mammary gland morphogenesis.
Dev. Cell 4,371
-382.[CrossRef][Medline]
Streeter, G. (1907). On the development of the
membranous labyrinth and the acoustic and facial nerves in the human embryo.
Am. J. Anat. 6,139
-165.[CrossRef]
Suzuki, Y., Miura, H., Tanemura, A., Kobayashi, K., Kondoh, G.,
Sano, S., Ozawa, K., Inui, S., Nakata, A., Takagi, T. et al.
(2002). Targeted disruption of LIG-1 gene results in psoriasiform
epidermal hyperplasia. FEBS Lett.
521, 67-71.[CrossRef][Medline]
Tanemura, A., Nagasawa, T., Inui, S. and Itami, S.
(2005). LRIG-1 provides a novel prognostic predictor in squamous
cell carcinoma of the skin: immunohistochemical analysis for 38 cases.
Dermatol. Surg. 31,423
-430.[Medline]
Tsang, M. and Dawid, I. B. (2004). Promotion
and attenuation of FGF signaling through the Ras-MAPK pathway. Sci.
STKE 2004,pe17
.
Wang, W., Van De Water, T. and Lufkin, T.
(1998). Inner ear and maternal reproductive defects in mice
lacking the Hmx3 homeobox gene. Development
125,621
-634.[Abstract]
Wilson, B. D., Li, M., Park, K. W., Suli, A., Sorensen, L. K.,
Larrieu-Lahargue, F., Urness, L. D., Suh, W., Asai, J., Kock, G. A. et al.
(2006). Netrins promote developmental and therapeutic
angiogenesis. Science
313,640
-644.
Yang, W. M., Yan, Z. J., Ye, Z. Q. and Guo, D. S.
(2006). LRIG1, a candidate tumour-suppressor gene in human
bladder cancer cell line BIU87. BJU Int.
98,898
-902.[CrossRef][Medline]
Yebra, M., Montgomery, A. M., Diaferia, G. R., Kaido, T.,
Silletti, S., Perez, B., Just, M. L., Hildbrand, S., Hurford, R., Florkiewicz,
E. et al. (2003). Recognition of the neural chemoattractant
Netrin-1 by integrins alpha6beta4 and alpha3beta1 regulates epithelial cell
adhesion and migration. Dev. Cell
5, 695-707.[CrossRef][Medline]
Zhao, H., Tanegashima, K., Ro, H. and Dawid, I. B.
(2008). Lrig3 regulates neural crest formation in Xenopus by
modulating Fgf and Wnt signaling pathways. Development
135,1283
-1293.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
