|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 January 2008
doi: 10.1242/dev.016121
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Centro Andaluz de Biología del Desarrollo (CABD), CSIC-Universidad Pablo de Olavide, Carretera de Utrera km 1, 41013 Sevilla, Spain.
Author for correspondence (e-mail:
agonrey{at}upo.es)
Accepted 13 November 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Jak/Stat, Germline stem cells, Niche signalling, BMP, Drosophila oogenesis
| INTRODUCTION |
|---|
|
|
|---|
Germline stem cells (GSCs) are broadly conserved across animal species.
Although the normal development of this type of stem cells is in some respects
limited, as they normally give rise only to sexual gametes and accessory
cells, they show a series of characteristics that make GSCs an important
source of information useful for understanding stem cell behaviour
(Wong et al., 2005
). For
instance, differentiating Drosophila germline cells have been shown
to de-differentiate and to adopt a stem cell fate under certain experimental
conditions, thus opening the possibility to find new sources of progenitor
cells for tissue repair (Brawley and
Matunis, 2004
; de Rooij and
Russell, 2000
; Kai and
Spradling, 2004
). Similarly, a number of niches hosting GSCs have
been defined in several experimental systems such as mice, flies and worms.
The Drosophila germline has emerged as one of the best experimental
systems in which to study the biology of stem cells and their niches. We have
focused our investigations on the ovarian niche and on the behaviour of the
GSCs contained within it. Ovarian GSCs are located in the anterior tip of the
germarium, a structure composed of germline cells - including GSCs, and
differentiating cystoblasts and cystocytes - and a few somatic cell types,
namely terminal filament cells (TFCs), cap cells (CpCs), escort stem cells
(ESCs) and escort cells (ECs). These somatic cells have been shown to provide
physical support and signals to the GSC population
(Decotto and Spradling, 2005
;
Xie and Spradling, 2000
).
Communication between support cells and stem cells is crucial to control
ovarian niche formation and to avoid depletion of stem cells.
decapentaplegic (dpp), glass bottom boat
(gbb), fs(1)Yb, piwi and hedgehog are known to be
expressed in somatic support cells and to control GSC numbers
(Cox et al., 1998
;
Cox et al., 2000
;
King and Lin, 1999
;
King et al., 2001
;
Song et al., 2004
;
Xie and Spradling, 1998
).
Although it is well established that the activity of the two BMP-like
molecules Dpp and Gbb is required for GSC maintenance by directly repressing
transcription of the differentiation-promoting gene bag of marbles
(bam) and by modulating the activity of the putative regulator of
translation Pelota (Chen and McKearin,
2003
; Song et al.,
2004
; Szakmary et al.,
2005
; Xi et al.,
2005
; Xie and Spradling,
1998
), the mechanisms that ensure appropriate BMP signalling in
the GSC niche remain unknown. In this work, we identify a signalling pathway
that modulates BMP signalling in the niche. The evolutionarily conserved Janus
kinase/Signal transducer and activator of transcription (Jak/Stat) signalling
pathway has been identified as a key regulator of the Drosophila
germline niches (Decotto and Spradling,
2005
; Kiger et al.,
2001
; Tulina and Matunis,
2001
). Here we show that this pathway acts upstream of
dpp transcription in ovarian support cells to ensure the maintenance
of the adjacent GSC population.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Fly stocks
Flies were raised on standard Drosophila media at 25°C unless
indicated otherwise. Stat92E06346, domeG0468,
hop27, hop25, hop2 and
updYM55 (also known as osupd-4) have
been described elsewhere (Binari and
Perrimon, 1994
; Brown et al.,
2001
; Hou et al.,
1996
; Perrimon and Mahowald,
1986
; Wieschaus et al.,
1984
). To express UASt-DsRed (Bloomington Stock Center)
or UASt-dome
CYT
(Brown et al., 2001
) in somatic
cells we used the bab1-Gal4 driver
(Bolívar et al., 2006
).
In order to obtain adult females overexpressing upd2
(Hombria et al., 2005
) or
hopTum (Harrison et
al., 1995
) under the control of bab1-Gal4, we crossed
w; tub-Gal80ts/CyO; bab1-Gal4/TM2 with
yw; UASt-upd2 or yw;
UASt-hopTum, respectively. The offspring were grown at
18°C and, upon eclosion, adult F1 flies were shifted to 31°C for 4
days.
Generation of somatic and germline clones
Germline mutant clones were generated using the FLP/FRT technique. The
following chromosomes were used: y w hs-flp122, FRT82B
Stat92E06346, FRT19A domeG0468 and
FRT101 hop2. 72- to 96-hour-old larvae were heat shocked
for 1 hour at 37°C; adult offspring were transferred to fresh food and
kept at 25°C until dissection at the appropriate time. To generate somatic
mutant clones we used the following chromosomes: FRT101
hop2and FRT101 ubi-GFP; bab1-Gal4
UASt-flp.
Reverse transcriptase (RT) PCR
mRNA was isolated from
100 ovary pairs from yw virgin females
or from 12- to 24-hour-old yw embryos and purified using the
QuickPrep Micro mRNA Purification Kit (Amersham Biosciences) according to the
manufacturer's instructions. One to two micrograms of mRNA was used as a
template for first-strand cDNA synthesis together with 0.5 µg of oligo(dT)
(Sigma Genosis) and the Superscript II RNase H Transcriptase (Invitrogen
LifeTechnology) in a final volume of 20 µl. Two microlitres of the ovarian
or embryonic cDNA libraries served as templates for the subsequent RT-PCR
amplification. The following primers (5'-3') were used for cDNA
detection:
ftz sense, CGAGGAGACTTTGGCATCAGATTG; antisense, TGACTGTGACTGTGGCTGTAAGCG;
hh sense, CAACAGGGACATCCTTTTTCCG; antisense, TGCCGTATTTGGACTGGTCG;
upd sense, TTCTGGCTCCTCTGCTGCTTCT; antisense, TACCGCAGCCTAAACAGTAGC;
upd2 sense, AGCGCCAGCCAAGGACGAGTTATC; antisense, TTGGCTGGCGTGTGAAAGTTGAGA; and
upd3 sense, ATGTCCCAGTTTGCCCTCTC; antisense, CTAGAGTTTCTTCTGGATCGCC.
Real-time PCR
Approximately 200 ovary pairs of the genotype
tub-Gal80ts/+; bab1-Gal4/+ or
400 ovary
pairs from tub-Gal80ts/UASt-upd2;
bab1-Gal4/+ females were used for mRNA isolation and cDNA synthesis
following the above protocol (both types of females were grown at 18°C
and, upon eclosion, shifted to 31°C for 4 days). Per reaction, 100 ng of
the different cDNA libraries were used as a template for the subsequent
real-time PCR reactions. The relative quantification of dpp and
gbb expression was carried out using the Comparative Cycle Threshold
(CT) method [Separate Tubes protocol, Applied Biosystems User
Bulletin no. 2 (1997), ABI Prism 7700 Sequence Detection System] and Fam
dye-labelled TaqMan MGB probes. Primers and TaqMan probes for the different
cDNAs were obtained from the Assays-by-Design Service (Applied Biosystems) as
follows (5'-3'):
dpp sense, GCCAACACAGTGCGAAGTTTTA; antisense, TGGTGCGGAAATCGATCGT; probe, CACACAAAGATAGTAAAATC;
gbb sense, CGCTGTCCTCGGTGAACA; antisense, CGGTCACGTTGAGCTCCAA; probe, CCAGCCCACGTAGTCC; and
RNA polymerase II sense, ACTGAAATCATGATGTACGACAACGA; antisense, TGAGAGATCTCCTCGGCATTCT; probe, TCCTCGTACAGTTCTTCC.
RNA polymerase II (RpII140) was used as the endogenous
control. Primer pairs were validated representing the CT mean value
of three replicates at increasing cDNA concentrations. The absolute value of
the slope of log input amount versus
CT was <0.1.
Real-time PCR was performed on an ABI-PRISM 7700 Sequence Detection System
machine. Quantified mRNA levels were expressed as relative fold change
normalised to RNA polymerase II. The comparative CT method
was used to analyse the data by generating relative values of the amount of
target cDNA. Relative quantification for any given gene, expressed as fold
variation over control, was calculated from the determination of the
difference between the CT of the given gene (dpp or
gbb) and that of the calibrator gene (RNA polymerase II).
CT values used were the result of three different replicas from
three independent experiments.
| RESULTS |
|---|
|
|
|---|
It has been reported that overexpression of the Upd ligand in ESCs and ECs
using the c587-Gal4 line leads to disorganised germaria and to rare
ovarioles (3.5%) filled with GSC-like cells
(Decotto and Spradling, 2005
;
Kai and Spradling, 2003
).
Considering the importance of CpCs for niche function
(Song et al., 2007
), we wished
to study the effect of Upd or Upd2 ectopic expression using the
bab1-Gal4 line, which induces strong expression of reporter genes in
TFCs and CpCs and weaker levels in ESCs and ECs
(Fig. 1E)
(Bolívar et al., 2006
).
Whereas the overexpression of Upd produced a mild increase in the number of
GSC-like cells in experimental germaria (not shown), bab1-Gal4-driven
expression of UASt-upd2 gave a very consistent phenotype, as it
caused hyperplastic stem cell growth in all of the ovarioles examined
(n>100; Fig. 1F).
In these germaria, we never observed the gross organisational defects reported
after c587-Gal4-driven Upd expression
(Decotto and Spradling, 2005
).
Because it has been established that Gal4-mediated Upd2 overexpression results
in ectopic activation of the pathway
(Hombria et al., 2005
), the
above result demonstrates that strong Jak/Stat pathway overactivation in TFCs
and CpCs, and at lower levels in ESCs and ECs, is sufficient to increase
greatly the number of GSCs present in the niche.
|
25% of these
mutant ovarioles were devoid of germline cells (not shown).
The morphology of the spectrosome has previously been used as a marker to
assess GSC division (de Cuevas and
Spradling, 1998
). Early interphase spectrosomes display a
characteristic `exclamation mark' figure
(Fig. 2C) in which the nascent
cystoblast spectrosome on the basal side of the cytokinetic ring remains
temporally linked to the apically-anchored GSC spectrosome material via the
cytokinetic neck. This study also showed that GSC cytokinesis only occurs
several hours later, after S phase of the following cycle is completed in both
the GSC daughter and its sister cystoblast
(de Cuevas and Spradling,
1998
). Surprisingly, during our analysis of Jak/Stat hypomorphic
mutant germaria, we found that a large proportion of GSCs undergoing
cytokinesis exhibited a strikingly different spectrosome arrangement. In these
cases, most of the GSC spectrosome lost its apical localisation and came to
lie next to the cytokinetic ring, adopting - together with the future
cystoblast's spectrosome - a `dumbbell shape'. In addition, a small `scar' of
spectrosome material was frequently observed on the apical side of the GSC in
contact with the CpCs, perhaps labelling the original, apical anchoring point
of the interphase GSC spectrosome (Fig.
2D). GSC divisions harbouring this spectrosomal organisation are
hereafter referred to as `anchorless', the frequency of which depends on the
severity of the mutant condition and on the age of the female (see Table S1 in
the supplementary material). In fact, nearly 75% of GSCs of the strongest
mutant combination analysed 25 days AE showed anchorless spectrosomes
(Fig. 2D,F). A detailed study
of control ovaries indicated that anchorless figures are also found in
wild-type niches. We observed that until 10 days AE, a small percentage
(11-13%) of control GSCs show anchorless figures. However, there was a
noticeable increase in the frequency of anchorless figures 25 days AE (23.5%),
as GSCs aged (Fig. 2F).
The increased frequency of GSCs containing anchorless spectrosomes in
ageing wild-type niches and in Jak/Stat mutant niches raises the question of
the significance for GSC niche function of the occurrence of anchorless
spectrosomes. Wild-type GSCs are known to be lost from the niche as flies age
(Xie and Spradling, 1998
;
Xie and Spradling, 2000
).
Similarly, we have shown that the average number of Jak/Stat mutant GSCs per
germaria is greatly reduced in comparison to the controls, a phenotype that
becomes more severe with time (Fig.
2E; see Table S1 in the supplementary material). Thus, there is a
correlation between the rise in the frequency of anchorless figures in
wild-type niches and in Jak/Stat mutant niches and the occurrence of GSC loss.
Hence, it is possible that the high frequency of an anchorless spectrosome
arrangement is generally related to stem cell loss. Both the experimental
evidence provided below and the observation by Decotto and Spradling that the
spectrosomes of the remaining GSCs present in Stat92E mutant germaria
move away from CpCs (Decotto and
Spradling, 2005
), further support this possibility.
|
We took two experimental approaches to test the above hypothesis. First, we
ectopically expressed a dominant-negative form of the receptor Dome
(Dome
CYT) (Brown et al.,
2001
) in the somatic cells of the niche and analysed its effect(s)
on GSC behaviour. Experimental females grown at 25°C for 25 days AE showed
a small but significant decrease in the number of GSCs per germarium (control,
2.61±0.62 GSCs/germarium, n=61;
bab1-Gal4/UASt-dome
CYT,
2.21±0.74 GSCs/germarium, n=39; P<0.05). This
reduction in the number of GSCs populating the ovarian niche was accompanied
by an increase in the frequency of anchorless figures 25 days AE, which rose
from
24% in controls to
46.50% in experimental females. In fact, we
observed germaria where all of the GSCs contained anchorless spectrosomes, a
phenotype never encountered in wild-type niches
(Fig. 3B). Second, we generated
CpCs mutant for a strong loss-of-function allele of the hop gene,
hop2. To this end, we utilised a bab1-Gal4
UAS-flp chromosome to manipulate genetically the support cells of the
GSC niche (Bolívar et al.,
2006
). Wild-type CpCs adopt a rosette-like arrangement at the base
of the terminal filament and come to lie in close contact with the underlying
GSCs (reviewed by González-Reyes,
2003
; Spradling et al.,
1997
). The analysis of hop- clones revealed
that the activity of the Jak/Stat pathway in CpCs is essential to prevent GSC
differentiation. Where wild-type GSCs abutted both hop-/-
and hop+/- CpCs, they appeared to be retained normally in
the niche, as judged from possession of a normal-looking spectrosome 14 days
AE (Fig. 3C). However, GSCs
that made contact exclusively with hop-/- CpCs displayed
characteristics of differentiating germline cells, as shown by the frequent
appearance of anchorless GSCs and by the development of cysts directly
abutting mutant CpCs 14 days AE (55% of cases; n=17;
Fig. 3D,E). It is interesting
to note that the presence of hop-deficient CpCs did not affect the
overall structure of the anterior germarium, in contrast to
Stat92E- ESCs (Decotto
and Spradling, 2005
). Finally, we assessed whether the removal of
Jak/Stat signalling during gonadal development affects normal CpC
specification. We analysed the pattern of expression of two CpC markers, the
transcription factor Engrailed and nuclear Lamin C, in
bab1-Gal4-induced hop- CpC clones
(Forbes et al., 1996
;
Xie and Spradling, 2000
)
(Fig. 4). We found that the
loss of hop activity did not affect the expression of either of these
markers, strongly suggesting that GSC differentiation induced by the loss of
hop from CpCs is not due to a failure of normal CpC development.
Jak/Stat activity regulates dpp transcription and signalling
The above results demonstrate that somatic Jak/Stat signalling has a
specific effect on GSC maintenance and they strongly suggest that a signal is
transmitted from the CpCs to the germline. To prove that this is the case, we
expressed a constitutively active form of the Janus kinase,
hopTum (Luo et al.,
1995
), in support cells using the bab1-Gal4 driver. As
shown in Fig. 5A,
overexpression of HopTum in support cells blocks cyst
differentiation and induces ectopic GSCs. Since this gain-of-function form of
Jak activates the pathway in support cells in a cell-autonomous manner, the
effect observed on the germline demonstrates the existence of a signal relayed
from the support cells to the GSCs that is regulated by Jak/Stat. In an
attempt to determine the nature of this signal, we examined whether the
Jak/Stat pathway was regulating the transcription of the vertebrate bone
morphogenetic protein 2 (Bmp2) orthologue dpp. This gene has been
shown to encode an extrinsic signal required to prevent GSC differentiation in
the germarial niche (Casanueva and
Ferguson, 2004
; Kai and
Spradling, 2003
; Song et al.,
2004
; Xie and Spradling,
1998
; Xie and Spradling,
2000
).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Two well-characterised extrinsic factors acting in the ovarian GSC niche
are the BMP-like proteins Dpp and Gbb, which are known to block germline stem
cell differentiation by repressing the transcription of the bam gene
(Chen and McKearin, 2005
;
Song et al., 2004
;
Szakmary et al., 2005
). In
addition to its effect on bam expression, BMP signalling in the
germline controls GSC maintenance through the activity of pelota, a
putative regulator of translation that controls GSC self-renewal by repressing
a Bam-independent differentiation pathway
(Xi et al., 2005
). The
short-range signalling by Dpp and Gbb is restricted to GSCs and, albeit at
lower levels, to cystoblasts (Kai and
Spradling, 2003
). In the absence of Dpp or Gbb signalling, Bam is
expressed in GSCs and the repressor activity of Pelota is probably reduced. As
a result, GSCs differentiate and the niche is emptied
(Song et al., 2004
;
Xi et al., 2005
;
Xie and Spradling, 1998
).
There are however clear differences between the roles of Dpp and Gbb in the
female GSC niche. Dpp overexpression prevents stem cell differentiation and
induces the formation of large tumours of GSC-like cells, partly by
de-differentiating `committed' cystocytes and partly by inducing GSC division
(Kai and Spradling, 2004
;
Xie and Spradling, 1998
).
Thus, the reception of Dpp in the germline is not only necessary to maintain a
stable population of GSCs, but is also sufficient to specify stem cell fate.
This conclusion points towards Dpp as the limiting factor that controls female
GSC niche size and function. By contrast, Gbb is necessary but not sufficient
to prevent female GSC differentiation
(Song et al., 2004
). In this
work, we have demonstrated that the Jak/Stat pathway is required in support
cells to preserve GSCs, most probably by regulating dpp (but not
gbb) transcription and by determining the extent of BMP pathway
activation in the germline. Therefore, considering the significance of Dpp in
the proper functioning of the GSC niche, our results strongly suggest that the
activity of the Jak/Stat pathway defines the GSC niche in the female ovary.
Interestingly, Jak/Stat signalling in the Drosophila testis
constitutes another extrinsic factor essential for GSCs to retain
self-renewing potential, even though in this case the transduction of the
pathway is required cell-autonomously in the germline
(Kiger et al., 2001
;
Tulina and Matunis, 2001
). It
would thus appear that the same signalling pathway defines both male and
female GSC niches. This conclusion correlates with previous results suggesting
that male and female germline niches are governed by common signals
(Decotto and Spradling, 2005
;
Gilboa and Lehmann, 2004
).
The mechanism(s) by which Jak/Stat signalling modulates dpp
transcription remain to be elucidated. Sequence analysis shows the existence
of several consensus binding sites for the Stat transcription factor in the
dpp gene (data not shown) (Bach et
al., 2003
), but their functionality has not been tested.
Alternatively, or in addition, the control of dpp mRNA levels by
Jak/Stat might be indirect. Whatever the situation, it is unlikely that the
increase in dpp mRNA after ectopic Jak/Stat signalling is a
non-specific effect of the global disruption of heterochromatic gene silencing
that occurs in Drosophila larvae and adults upon Jak overactivation
(Shi et al., 2006
). First,
gbb transcription is not affected under the same experimental
conditions that cause an increase in dpp mRNA levels. Second, it has
been suggested that dpp might function downstream of, or in parallel
to, Jak/Stat signalling in Drosophila testes
(Singh et al., 2006
). Finally,
the ectopic expression of Upd in eye discs results in a slight enhancement of
dpp mRNA levels (Bach et al.,
2003
). Altogether, these and our observations strongly suggest
that Jak/Stat activation in support cells specifically regulates dpp
transcription.
Our analysis of GSC spectrosomes has revealed a new organisation of the spectrosome that might constitute a useful tool to analyse niche function. Anchorless figures are formed during post-mitotic (early interphase) stages and are observed in a small percentage of wild-type GSCs, suggesting that either this organisation of the spectrosome is very dynamic and lasts for a short period of time in GSCs undergoing cytokinesis, or that only a few of the GSCs present in an ovary develop it. In any case, because a significant increase in the frequency of these figures is associated with stem cell loss when Jak/Stat signalling is impaired, the rise in the frequency of anchorless spectrosomes might reflect the existence of defective niche signalling. We propose that Jak/Stat pathway activation in support cells prevents premature GSC loss by regulating the production of the relay signal Dpp. Thus, mutant niches might not achieve the right balance of survival factors, including Dpp, required to maintain a wild-type population of GSCs during the female's lifetime.
Given the importance of BMP signalling to avoid depletion of GSCs and to
control their proliferation, the production of BMP ligands ought to be tightly
regulated. In this context, CpCs and ESCs seem to act as a signalling centre
where several signalling pathways might be integrated. In addition to
dpp and gbb, other extrinsic factors with defined roles in
the control of populations of GSCs and/or follicle stem cells, such as
fs(1)Yb, piwi, wingless and hedgehog, are known to be
expressed in CpCs (Cox et al.,
1998
; Cox et al.,
2000
; King and Lin,
1999
; King et al.,
2001
; Song et al.,
2004
; Song and Xie,
2003
; Xie and Spradling,
1998
; Zhang and Kalderon,
2001
). Our observations add the transduction of the Jak/Stat
signal(s) to the complex network of signalling pathways that co-exist in the
CpCs. Similarly, the Jak/Stat pathway is required in ESCs to maintain GSCs
(Decotto and Spradling, 2005
).
Altogether, this evidence emphasises the contribution of support cells in
direct contact with GSCs (CpCs and ESCs) in the determination of GSC niche
size and function (Song et al.,
2007
). The signals that regulate Jak/Stat pathway activation in
the niche are at present unknown, but clear candidates are any of the
signalling molecules present in CpCs. In this regard, it is interesting to
note that the expression of piwi and hedgehog in these cells
is controlled by fs(1)Yb (King et
al., 2001
). In addition, systemic signals such as the
neural-derived insulin-like peptides, utilised in the ovary to sense
nutritional input and to impinge on GSC niche activity to coordinate nutrient
availability with egg production (LaFever
and Drummond-Barbosa, 2005
), might play a role. Deciphering the
mechanism(s) that modulates Jak/Stat activity in ovarian support cells and
determining the generality of Jak/Stat regulation of BMP signalling in other
well-established niches are interesting questions that await further
investigation.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/3/533/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Agaisse, H., Petersen, U., Boutros, M., Mathey-Prevot, B. and Perrimon, N. (2003). Signaling role of hemocytes in Drosophila JAK/STAT-dependent response to septic injury. Dev. Cell 5,441 -450.[CrossRef][Medline]
Bach, E. A., Vincent, S., Zeidler, M. P. and Perrimon, N.
(2003). A sensitized genetic screen to identify novel regulators
and components of the Drosophila janus kinase/signal transducer and activator
of transcription pathway. Genetics
165,1149
-1166.
Bach, E. A., Ekas, L. A., Ayala-Camargo, A., Flaherty, M. S., Lee, H., Perrimon, N. and Baeg, G. H. (2007). GFP reporters detect the activation of the Drosophila JAK/STAT pathway in vivo. Gene Expr. Patterns 7,323 -331.[CrossRef][Medline]
Binari, R. and Perrimon, N. (1994).
Stripe-specific regulation of pair-rule genes by hopscotch, a putative Jak
family tyrosine kinase in Drosophila. Genes Dev.
8, 300-312.
Bolívar, J., Pearson, J., López-Onieva, L. and González-Reyes, A. (2006). Genetic dissection of a stem cell niche: the case of the Drosophila ovary. Dev. Dyn. 235,2969 -2979.[CrossRef][Medline]
Brawley, C. and Matunis, E. (2004).
Regeneration of male germline stem cells by spermatogonial dedifferentiation
in vivo. Science 304,1331
-1334.
Brown, S., Hu, N. and Castelli-Gair Hombria, J. (2001). Identification of the first invertebrate interleukin JAK/STAT receptor, the Drosophila gene domeless. Curr. Biol. 11,1700 -1705.[CrossRef][Medline]
Casanueva, M. and Ferguson, E. (2004). Germline
stem cell number in the Drosophila ovary is regulated by redundant mechanisms
that control Dpp signalling. Development
131,1881
-1890.
Chen, D. and McKearin, D. (2003). Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cells. Curr. Biol. 13,1786 -1791.[CrossRef][Medline]
Chen, D. and McKearin, D. (2005). Gene circuitry controlling a stem cell niche. Curr. Biol. 15,179 -184.[CrossRef][Medline]
Chen, H., Chen, X., Oh, S., Marinissen, M., Gutkind, J. and Hou,
S. (2002). mom identifies a receptor for the Drosophila
JAK/STAT signal transduction pathway and encodes a protein distantly related
to the mammalian cytokine receptor family. Genes Dev.
16,388
-398.
Cox, D., Chao, A., Baker, J., Chang, L., Qiao, D. and Lin,
H. (1998). A novel class of evolutionary conserved genes
defined by piwi are essential for stem cell self-renewal. Genes
Dev. 12,3715
-3727.
Cox, D., Chao, A. and Lin, H. (2000). piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells. Development 127,503 -514.[Abstract]
Decotto, E. and Spradling, A. C. (2005). The Drosophila ovarian and testis stem cell niches: similar somatic stem cells and signals. Dev. Cell 9,501 -510.[CrossRef][Medline]
de Cuevas, M. and Spradling, A. (1998). Morphogenesis of the Drosophila fusome and its implications for oocyte specification. Development 125,2781 -2799.[Abstract]
de Rooij, D. G. and Russell, L. D. (2000). All you wanted to know about spermatogonia but were afraid to ask. J. Androl. 21,776 -798.[Medline]
Forbes, A., Spradling, A., Ingham, P. and Lin, H. (1996). The role of segment polarity genes during early oogenesis in Drosophila. Development 122,3284 -3294.
Fuchs, E., Tumbar, T. and Guasch, G. (2004). Socializing with the neighbors: stem cells and their niche. Cell 116,769 -778.[CrossRef][Medline]
Gilbert, M. M., Weaver, B. K., Gergen, J. P. and Reich, N. C. (2005). A novel functional activator of the Drosophila JAK/STAT pathway, unpaired2, is revealed by an in vivo reporter of pathway activation. Mech. Dev. 122,939 -948.[CrossRef][Medline]
Gilboa, L. and Lehmann, R. (2004). How
different is Venus from Mars? The genetics of germ-line stem cells in
Drosophila females and males. Development
131,4895
-4905.
González-Reyes, A. (2003). Stem cells,
niches and cadherins: a view from Drosophila. J. Cell
Sci. 116,949
-954.
Harrison, D. A., Binari, R., Nahreini, T. S., Gilman, M. and Perrimon, N. (1995). Activation of a Drosophila Janus kinase (JAK) causes hematopoietic neoplasia and developmental defects. EMBO J. 14,2857 -2865.[Medline]
Harrison, D., McCoon, P., Binari, R., Bilman, M. and Perrimon,
N. (1998). Drosophila unpaired encodes a secreted protein
that activates the JAK signaling pathway. Genes Dev.
12,3252
-3263.
Hombria, J. C.-G., Brown, S., Hader, S. and Zeidler, M. P. (2005). Characterisation of Upd2, a Drosophila JAK/STAT pathway ligand. Dev. Biol. 288,420 -433.[CrossRef][Medline]
Hou, X. S., Melnick, M. B. and Perrimon, N. (1996). Marelle acts downstream of the Drosophila HOP/JAK kinase and encodes a protein similar to the mammalian STATs. Cell 84,411 -419.[CrossRef][Medline]
Kai, T. and Spradling, A. (2003). An empty
Drosophila stem cell niche reactivates the proliferation of ectopic cells.
Proc. Natl. Acad. Sci. USA
100,4633
-4638.
Kai, T. and Spradling, A. (2004). Differentiating germ cells can revert into functional stem cells in Drosophila melanogaster ovaries. Nature 428,564 -569.[CrossRef][Medline]
Kiger, A., Jones, D., Schulz, C., Rogers, M. and Fuller, M.
(2001). Stem cell self-renewal specified by JAK-STAT activation
in response to a support clue. Science
294,2542
-2545.
King, F. and Lin, H. (1999). Somatic signaling mediated by fs(1)Yb is essential for germline stem cell maintenance during Drosophila oogenesis. Development 126,1833 -1844.[Abstract]
King, F., Szakmary, A., Cox, D. and Lin, H. (2001). Yb modulates the divisions of both germline and somatic stem cells through piwi- and hh-mediated mechanisms in the Drosophila ovary. Mol. Cell 7,497 -508.[CrossRef][Medline]
LaFever, L. and Drummond-Barbosa, D. (2005).
Direct control of germline stem cell division and cyst growth by neural
insulin in Drosophila. Science
309,1071
-1073.
Luo, H., Hanratty, W. P. and Dearolf, C. R. (1995). An amino acid substitution in the Drosophila hopTum-l Jak kinase causes leukemia-like hematopoietic defects. EMBO J. 14,1412 -1420.[Medline]
Perrimon, N. and Mahowald, A. P. (1986). l(1)hopscotch, A larval-pupal zygotic lethal with a specific maternal effect on segmentation in Drosophila. Dev. Biol. 118, 28-41.[CrossRef][Medline]
Scadden, D. T. (2006). The stem-cell niche as an entity of action. Nature 441,1075 -1079.[CrossRef][Medline]
Shi, S., Calhoun, H. C., Xia, F., Li, J., Le, L. and Li, W. X. (2006). JAK signaling globally counteracts heterochromatic gene silencing. Nat. Genet. 38,1071 -1076.[CrossRef][Medline]
Singh, S. R., Zhen, W., Zheng, Z., Wang, H., Oh, S. W., Liu, W., Zbar, B., Schmidt, L. S. and Hou, S. X. (2006). The Drosophila homolog of the human tumor suppressor gene BHD interacts with the JAK-STAT and Dpp signaling pathways in regulating male germline stem cell maintenance. Oncogene 25,5933 -5941.[CrossRef][Medline]
Song, X. and Xie, T. (2003). Wingless signaling
regulates the maintenance of ovarian somatic stem cells in Drosophila.
Development 130,3259
-3268.
Song, X., Wong, M. D., Kawase, E., Xi, R., Ding, B. C.,
McCarthy, J. J. and Xie, T. (2004). Bmp signals from niche
cells directly repress transcription of a differentiation-promoting gene, bag
of marbles, in germline stem cells in the Drosophila ovary.
Development 131,1353
-1364.
Song, X., Call, G. B., Kirilly, D. and Xie, T.
(2007). Notch signaling controls germline stem cell niche
formation in the Drosophila ovary. Development
134,1071
-1080.
Spradling, A., de Cuevas, M., Drummond-Barbosa, D., Keyes, L., Lilly, M., Pepling, M. and Xie, T. (1997). The Drosophila germarium: stem cells, germ line cysts, and oocytes. Cold Spring Harb. Symp. Quant. Biol. 62,25 -34.[Medline]
Spradling, A., Drummond-Barbosa, D. and Kai, T. (2001). Stem cells find their niche. Nature 414,98 -104.[CrossRef][Medline]
Szakmary, A., Cox, D. N., Wang, Z. and Lin, H. (2005). Regulatory relationship among piwi, pumilio, and bag-of-marbles in Drosophila germline stem cell self-renewal and differentiation. Curr. Biol. 15,171 -178.[CrossRef][Medline]
Tanimoto, H., Itoh, S., ten Dijke, P. and Tabata, T. (2000). Hedgehog creates a gradient of Dpp activity in Drosophila wing imaginal discs. Mol. Cell 5, 59-71.[CrossRef][Medline]
Tulina, N. and Matunis, E. (2001). Control of
stem cell self-renewal in Drosophila spermatogenesis by JAK-STAT signaling.
Science 294,2546
-2549.
Wieschaus, E., Nüsslein-Volhard, C. and Jürgens, G. (1984). Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster III. Zygotic loci on the X-chromosome and the fourth chromosome. Roux's Arch. Dev. Biol. 193,296 -307.[CrossRef]
Wong, M. D., Jin, Z. and Xie, T. (2005). Molecular mechanisms of germline stem cell regulation. Annu. Rev. Genet. 39,173 -195.[CrossRef][Medline]
Xi, R., Doan, C., Liu, D. and Xie, T. (2005).
Pelota controls self-renewal of germline stem cells by repressing a
Bam-independent differentiation pathway. Development
132,5365
-5374.
Xie, T. and Spradling, A. (1998). decapentaplegic is essential for the maintenance and division of germline stem cells in the Drosophila ovary. Cell 94,251 -260.[CrossRef][Medline]
Xie, T. and Spradling, A. (2000). A niche
maintaining germ line stem cells in the Drosophila ovary.
Science 290,328
-330.
Zhang, Y. and Kalderon, D. (2001). Hedgehog acts as a somatic stem cell factor in the Drosophila ovary. Nature 410,599 -604.[CrossRef][Medline]
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||