|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 January 2008
doi: 10.1242/dev.010801
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Dipartimento di Biotecnologie e Bioscienze, Università di
Milano-Bicocca, Piazza della Scienza 2, 20126 Milano, Italy.
2 Dipartimento di Scienze Biomolecolari e Biotecnologie, Università degli
Studi di Milano, Via Celoria 26, 20133 Milano, Italy.
3 Direzione Scientifica Fondazione IRCCS Ospedale Maggiore Policlinico,
Mangiagalli e Regina Elena, Via Francesco Sforza 28, 20122 Milano,
Italy.
4 Dipartimento di Medicina Sperimentale, Facoltà di Medicina,
Università degli Studi di Milano-Bicocca, Via Cadore 48, 20052 Monza,
Italy.
5 Stem Cell Research Institute, DIBIT H San Raffaele, Via Olgettina 58, 20132
Milano, Italy.
Author for correspondence (e-mail:
silvia.nicolis{at}unimib.it)
Accepted 5 November 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Sox2, Neural stem cells, Neurogenesis, Transcription factors
| INTRODUCTION |
|---|
|
|
|---|
In the nervous system, Sox2 is expressed, and is functionally important, at
the earliest developmental stages, in both chick and Xenopus
(Kamachi et al., 2000
;
Pevny and Placzek, 2005
;
Wegner and Stolt, 2005
). In
humans, Sox2 neural expression is conserved, and heterozygous SOX2
mutations cause hippocampal defects, forebrain abnormalities and anophtalmia
(Fantes et al., 2003
;
Sisodiya et al., 2006
;
Kelberman et al., 2006
). In
the mouse nervous system, Sox2 is expressed in stem cells and early
precursors, and in few mature neurons
(Zappone et al., 2000
;
Ferri et al., 2004
). Adult
Sox2-deficient mice, in which Sox2 expression is decreased by about 70%,
exhibit neural stem/precursor cell proliferative defects in the hippocampus
and periventricular zone (Ferri et al.,
2004
). Moreover, neurons containing
neurofilament/ubiquitin-positive aggregates are observed, together with dead
neurons, in thalamic and striatal parenchyma, which are already substantially
reduced in size at early developmental stages. These observations point to a
possible role for Sox2 in the maturation and/or survival of embryonic and
adult neurons. In these mutant mice, abnormalities of ependyma and choroid
plexi (the source of growth and trophic factors/signaling molecules)
(Lim et al., 2000
) were also
observed (Ferri et al., 2004
).
This raises the issue of whether neuronal defects observed in vivo represent
an intrinsic defect, or a response to abnormalities in the environment.
We performed in vitro differentiation studies on neurosphere-derived neural cells. Neural stem cells from Sox2-deficient mice produce reduced numbers of mature neurons, but generate normal glia. Normal Sox2 levels are required at early differentiation stages. In vivo, subsets of GABAergic neurons are affected.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunocytochemistry and immunohistochemistry
Immunocytochemistry was as described by Zappone et al.
(Zappone et al., 2000
). For
single-cell Sox2 immunofluorescence quantitation, see Fig. S2 in the
supplementary material. Apoptosis was assayed by the DeadEnd Fluorimetric
TUNEL system (Promega). Immunohistochemistry and BrdU labeling were as in
Ferri et al. (Ferri et al.,
2004
); in the latter, sacrifice was 3 days after the last
injection. Five olfactory bulb sections (20 µm; one every 16) were counted
per animal.
|
For immunofluorescence, 4% paraformaldehyde-fixed cells were pre-incubated with 10% FCS, 0.2% Triton X-100 in PBS for 30-60 minutes at room temperature, than the primary antibody was added (in 10% FCS in PBS) and left overnight at 4°C (or 1 hour at 37°C); cells were washed in PBS, the secondary antibody was added (in 10% FCS in PBS) for 1 hour at room temperature, followed by wash in PBS, DAPI nuclear counterstaining (4-8 minutes), and mounting in Fluorsave. Cells immunopositive for the various markers were counted under a fluorescence microscope; a minimum of 3000 total cells distributed on five fields was evaluated. Negative controls (equal cell samples treated the same way but omitting the primary antibody) were always performed in parallel for each reported experiment, and gave no signal.
RT-PCR
DNAse-treated RNA was reverse transcribed and assayed by PCR for
Sox2 as described by Zappone et al.
(Zappone et al., 2000
).
Results were normalized using 18S RNA primers:
5'TTTCGGAACTGAGGCCATGATTAAG3' and
5'AGTTTCAGCTTTGCAACCATACTCC3'.
Chromatin immunoprecipitation (ChiP), electrophoresis mobility shift (EMSA) and transfections
For ChIP, see Weinmann and Farnham
(Weinmann and Farnham, 2002
).
Antibodies were anti-Sox2 (R&D) and rabbit anti-SV40 large-T (Santa Cruz).
Primers for GFAP upstream region were
5'AAAGAATTCCCTGTGTTAGTCAGGGTTCTCTAG3' and
5'AAACTCGAGTACAGTGAATGGGTAATAAAAATA3'. For SRR2 and nestin
primers, see Miyagi et al. (Miyagi et al.,
2006
). For EMSA, see Catena et al.
(Catena et al., 2004
).
Oligonucleotides are shown in Fig.
9.
For P19 transfection, the 0.6 Gfap region
(Fig. 9; amplified with above
ChIP primers) was cloned upstream to the TK promoter in the TK-luciferase
vector (Miyagi et al., 2006
).
P19 cells (5x105), plated the previous day in 3 cm dishes,
were transfected with 0.5 µg luciferase reporter and 0.5 µg Sox2
expression vector (the CMV-Sox2-GFP lentiviral genome described below, or the
same empty vector) using Lipofectamine 2000 (Invitrogen). Lysates were assayed
for luciferase (Promega-E1980 kit) after 24 hours.
Sox2 lentiviral transduction
The Sox2 cDNA (XhoI-Bsu36I 1.3kb fragment) was cloned
into the pRRLsin.PPT.CMV.NTRiresGFPpre lentiviral vector
(Brunelli et al., 2007
),
between the CMV promoter and the IRES-GFP. The same vector, empty or carrying
a Cre gene, was used as negative control (with comparable results).
Lentiviruses were prepared as described by Brunelli et al.
(Brunelli et al., 2007
). Cells
were transduced at MOI 100 at day 1 or 4
(Fig. 1A) overnight. The
following day the medium was changed to proliferation (day 1 transductions) or
differentiation medium (day 4 transductions), and differentiation continued to
day 9.
Primary cultures of cortical neurons
P0 cortical neurons (Wagenaar et al.,
2005
; Li et al.,
2005
) were plated on polyethyleneimine-laminin-coated slides at
106 cells/ml. After 3 hours, the plating medium was replaced with
Neurobasal medium with B27, 1 mM glutamine, 5 ng/ml bFGF. The culture was
maintained for 4-10 hours, prior to fixation with 4% paraformaldehyde.
| RESULTS |
|---|
|
|
|---|
ENH) (Ferri et al.,
2004
ENH neurosphere
cultures is 25-30% of the wild type (Ferri
et al., 2004
In vitro, the growth (Zappone et al.,
2000
) of undifferentiated cultures (measured as numbers of total
cells, or neurospheres) from mutant mice was not significantly different from
that of normal controls (not shown).
Differentiation was carried out according to Gritti et al.
(Gritti et al., 1996
;
Gritti et al., 2001
)
(Fig. 1A). Undifferentiated
neurospheres, dissociated to single cells, were made to adhere to slides, in
the presence of bFGF. After 3 days, bFGF was removed, and 1% FCS was added,
leading to differentiation within 9 days from initial plating. We studied
differentiation of neurons and glia, as well as Sox2 expression, during this
time window. For Sox2 evaluation, we used mouse monoclonal (R&D) and
rabbit polyclonal (Chemicon) antibodies, of which we carefully confirmed the
specificity (Fig. 1B; see Fig.
S1 in the supplementary material) by testing wild-type cells versus Sox2
conditionally deleted (null) cells.
Sox2 expression during in vitro NSC differentiation
In undifferentiated neurospheres, Sox2 is expressed, together with nestin
(a marker of undifferentiated precursors) in virtually all cells (not shown).
In differentiating cells, Sox2 is expressed at variable levels (dim to bright)
in most cells until day 9, although the bright population was much reduced
after differentiation day 1 (Fig.
1C; see Fig. S2 in the supplementary material); nestin colocalized
with Sox2 at day 1 (Fig. 1C)
but disappeared in most cells by day 3 (see Fig. S4 in the supplementary
material). This result is mirrored by a 80% reduction of Sox2 mRNA in
differentiated cells (Fig. 1D).
In mutant cells, at the beginning of differentiation, Sox2 mRNA
(Ferri et al., 2004
) and
protein (Fig. 1E) are lower
than in normal cells, as expected. By single-cell immunofluorescence, at day
1, the Sox2-bright population is much decreased in mutant cells; between days
5 and 9, the difference between normal and mutant cells is progressively
reduced (see Fig. S2 in the supplementary material).
|
Sox2 mutant neural stem cells generate morphologically immature β-tubulin III-positive neurons
In cultures from normal adults, most neuronal cells show mature morphology,
with extensive arborization, at differentiation day 9
(Fig. 3A,B, left). However, in
mutant cultures, β-tubulin-positive cells with developed arborization
were very rare (Fig. 3A,B,
right) and most (undeveloped) β-tubulin-positive cells showed much weaker
staining (Fig. 3A). Thus,
although the total number of β-tubulin-positive cells is similar between
normal and mutant cultures, the absolute number of morphologically `mature'
mutant neurons is strikingly decreased (see Table S1 in the supplementary
material; Fig. 3).
|
|
|
|
Unexpectedly, in mutant cultures, some (
30%) of the
β-tubulin-positive cells also showed clear, although quite low, GFAP
expression (Fig. 6). These
cells often showed some neuron-like arborization
(Fig. 6, rows 2, 3), but it was
not as developed as in wild type β-tubulin-positive cells; however, these
cells were obviously distinguished from normal astrocytes, which were highly
GFAP-positive (but β-tubulin-negative) and morphologically well developed
(Fig. 6, row 4). In normal
cultures, we never observed such cells, although a very low proportion of
β-tubulin-positive cells (
3%) showed double staining
(Fig. 6, top, arrowhead); these
cells, however, were very poorly developed, and might represent an early
maturation stage. Interestingly, β-tubulin/GFAP double-positive cells
were observed in differentiated cultures of glioblastoma multiforme neural
stem cells (Galli et al.,
2004
; Lee et al.,
2006a
). Notably, these cells aberrantly express Sox2
(Hemmati et al., 2003
;
Lee et al., 2006a
;
Nicolis, 2007
;
Pomeroy et al., 2002
).
Finally, oligodendrocytes were slightly reduced (not shown; see Table S1 in
the supplementary material).
|
|
High levels of Sox2 are required at early, but not late stages of neural differentiation
As shown above, Sox2-mutant cells show significantly lower levels of Sox2
than normal cells at the onset of differentiation
(Fig. 1E, see Fig. S2 in the
supplementary material); but not at later stages (see Fig. S2A-C in the
supplementary material).
To evaluate if restoration of Sox2 levels might rescue the differentiation defect of mutant cells, we used a Sox2-IRES-GFP lentiviral construct. We transduced mutant cells at the end of day 1 after plating (Fig. 1A); after 16 hours, we washed the well to remove the virus, adding fresh medium to allow differentiation to proceed until day 9. Control cells were treated similarly, without virus or with control virus expressing only GFP. In an alternative experiment, cells were transduced at day 4, after the switch from mitogen-containing medium to mitogen-free, serum-containing medium. A high proportion (75-80%) of the cells were transduced, expressing GFP and Sox2 (Fig. 7A). Transduction at day 1 did not change the overall number of β-tubulin-positive cells, but resulted in a dramatic increase in the proportion of well-arborized β-tubulin-positive cells (Fig. 7B,C,D), and of cells expressing the more mature MAP2 marker (Fig. 7C,D).
Importantly, well-arborized morphology in β-tubulin or MAP2-positive cells was observed almost exclusively in efficiently transduced (i.e. GFP-positive) cells (Fig. 7C; arrowheads). Most of the untransduced (GFP-negative) β-tubulin-positive cells showed poor arborization (Fig. 7C; arrow). This latter result represents an `internal' control, indicating that the rescue of the normal phenotype is due to viral-dependent expression, but not to any `environmental' change (caused by the transduction procedure) affecting the efficiency of differentiation. Moreover, control virus expressing GFP but not Sox2 had no effect (Fig. 7B,D). In contrast to the results obtained when the virus was transduced at day 1, no significant effect of Sox2 transduction was observed at day 4 (Fig. 7B,D). Thus, appropriate Sox2 levels are required at a crucial early stage of differentiation.
Ectopic Sox2 represses GFAP expression in differentiating cells
We further examined the astroglia population from cultures transduced with
the Sox2-GFP-expressing lentivirus. Unexpectedly, cells expressing high levels
of GFP (thus presumably of Sox2) showed reduced or no GFAP expression, while
retaining astroglia morphology (Fig.
8A, left) and expression of astrocyte markers S100 and connexin 43
(Fig. 8B; see Fig. S3 in the
supplementary material); by contrast, cells that had not been transduced
showed the expected astroglia morphology with high GFAP expression
(Fig. 8A, left). The loss of
GFAP expression is not due to toxicity from high levels of GFP, as cells
transduced with a GFP-lentivirus without the Sox2 gene were not affected
(Fig. 8A, right). Furthermore,
the inhibitory effect of excess Sox2 levels on GFAP expression was observed
both when the virus was added at day 1 and at day 4
(Fig. 8A).
This surprising result prompted an investigation of the possibility that
Sox2 might directly affect GFAP expression. Upstream to the GFAP promoter
(Morita et al., 1997
;
Kuzmanovic et al., 2003
) lies
a region containing three potential consensus Sox2-binding sites (conserved
between mouse and man) (Fig.
8C). We cloned this region upstream to the thymidine kinase (TK)
minimal promoter, linked to a luciferase reporter, and transfected this
construct into P19 embryonic carcinoma cells, together with a Sox2 expression
vector or, as control, the same vector without Sox2. The upstream promoter
region stimulated luciferase activity by twofold in the absence of Sox2;
however, the stimulation was abolished by Sox2 overexpression
(Fig. 8D). This suggests that
Sox2, expressed at high levels, is a repressor at this regulatory element.
In gel shift analysis (Fig.
8E), recombinant Sox2 (expressed in COS cells) or endogenous Sox2
from P19 cells (Fig. 8E left
panels, lanes 1, 4) forms a retarded complex with a GFAP probe containing the
two upstream putative Sox2 sites. This complex has mobility similar to that
formed on a bona fide Sox2-binding site from an Oct4 gene enhancer
(Chew et al., 2005
)
(Fig. 8E, left panels, Oct4
probe, lanes 2, 5). The complex was abolished by mutation of the Sox2 sites of
the probe (MutGfap, lanes 3, 6) and by competition with excess unlabelled Oct4
(not shown) and wild-type, but not mutant, GFAP oligonucleotide
(Fig. 8E, right). Furthermore,
in in vivo chromatin immunoprecipitation (ChIP) experiments, an anti-Sox2
antibody specifically precipitates the upstream GFAP regulatory region in
chromatin from both P19 (which express Sox2) and embryonic (E12.5) neural tube
cells (Fig. 8F). Control
experiments with other Sox2-binding sequences (SRR2 and nestin) indicate that
the anti-Sox2 antibody correctly precipitates these chromatin regions in P19
and spinal cord cells, respectively, although SRR2 is not precipitated in
spinal cord cells, as expected (Miyagi et
al., 2006
). These experiments, which demonstrate binding of Sox2
to the GFAP upstream region in vivo and in vitro, and Sox2-dependent
transcriptional inhibition (Fig.
8C-F), demonstrate that the repression of GFAP by Sox2 shown in
differentiating neural cells (Fig.
8A) may be mediated, at least in part, by direct Sox2 regulation
of transcription.
|
To analyze in vivo neuronal differentiation, we examined cortical neurons of newborn mice and newly generated rostral migratory stream (RMS) neurons. P0 cortical neurons derive from embryonic radial glia, and had only a few days to mature since their terminal cell division. Neurons, made to adhere to slides, were stained for neuronal markers. Most cells were positive for β-tubulin and MAP2 at variable intensities and had comparable levels of staining between normal and mutant brains (see Fig. S5 in the supplementary material). However, GABA-positive and calretinin-positive cells were decreased by 50-60% in mutant cortical cells (Fig. 9A-C), confirming a defect, in mutant brain in vivo, of at least one class of mature neurons: the GABAergic neurons.
Cortical GABAergic neurons originate from precursors in the ganglionic
eminences, which migrate after terminal division by tangential routes (Makram
et al., 2004; Wonders and Anderson,
2006
). In normal E17.5 embryos, we found several
calretinin-positive (i.e. GABAergic) cells within the cortical plate
(Fig. 10A-D), whereas in
mutant embryos calretinin-positive cells were detected along subcortical fiber
bundles but were very scarce or absent in the cortical plate
(Fig. 10E-H). This migration
abnormality might be part of the suggested differentiation defect. GABA
staining at the same stage reveals a disorganized labeling pattern of
GABAergic neurons in the mutant (Fig.
10I-N). GABAergic cells which reach their final destination in the
cortex progressively develop postnatally into several more mature interneurons
subtypes, which include calretinin-positive ones
(Markram et al., 2004
;
Wonders and Anderson, 2006
).
In adult mutant cortex, calretinin-positive cells showed significant
abnormalities, such as reduced dendritic and axonal arborizations
(Fig. 11). In conclusion, a
subpopulation of embryonically generated neurons (GABAergic neurons) is not
only decreased in numbers in postnatal cortex, but also shows significant
morphological abnormalities in embryo and adult.
|
40%)
decreased in granule (GL) and in periglomerular (PGL) layers of mutant mice
(Fig. 12A), indicating a
significant maturation defect. Does this maturation defect result in reduced steady-state levels of GABAergic neurons? Calretinin-positive cells are strongly decreased (40%) within the most external (periglomerular) layer, where mature calretinin-positive cells reside (Fig. 12B). This suggests that mutant cells destined to develop as calretinin-positive cells in the periglomerular layer may fail to reach it and/or complete their maturation. Additionally, calretinin-positive cells in the external layers of the olfactory bulb showed an important decrease in their degree of arborization (Fig. 12C).
| DISCUSSION |
|---|
|
|
|---|
Sox2 is expressed in differentiating neural cells in vitro
In vitro, Sox2 expression is high in undifferentiated cells, significantly
declines during differentiation, but is not completely extinguished in many
cells (Figs 1,
2). The observed Sox2
expression is not due to antibody crossreactions, as shown by control
experiments, using Sox2-null neural cells.
(Fig. 1B; see Fig. S1 in the
supplementary material), and by RT-PCR
(Fig. 1D). This agrees with
Bani-Yaghoub et al. (Bani-Yaghoub et al.,
2006
), who showed significant Sox2 expression in P3 cortex (glia
and neurons), relative to high levels in embryonic cortex (mostly neural
precursors).
|
Sox2 is important at early stages of neuronal differentiation in vitro
In vitro, Sox2-deficient cells exhibit a striking differentiation defect,
characterized by abnormal morphology and decreased expression of mature
differentiation markers. As the defect is apparent at differentiation day 5
(Fig. 3C), Sox2 is already
required at early stages. This is confirmed by the in vitro rescue experiment
with a Sox2-expressing lentivirus (Fig.
7). Sox2 overexpression in mutant cells at the onset of
differentiation is necessary to rescue the well-arborized
β-tubulin-positive, MAP2-positive phenotype observed in normal, but not
mutant cells. However, late expression does not rescue the phenotype
(Fig. 7). Preliminary data (in
preparation) indicate that neurons originate only from cells that are still
dividing at early differentiation stages (day 2, but not day 4); moreover,
progenitors at early, but not late stages, express transcription factors known
to be involved in neuronal differentiation. Correct expression of Sox2 at
early stages may be required to establish a downstream transcriptional program
for differentiation, perhaps by generating a `poised' chromatin structure at
loci crucial for subsequent neuronal development (as exemplified for Sox2
itself in ES cells) (Boyer et al.,
2005
; Boyer et al.,
2006a
; Boyer et al.,
2006b
; Szutoriz and Dillon, 2005;
Azuara et al., 2006
;
Bernstein et al., 2006
;
Lee et al., 2006b
). When such
a program is compromised by insufficient Sox2 levels, as in the mutant, all
successive maturation steps (from β-tubulin to MAP2/NeuN expression)
would be altered. Indeed, clearly decreased levels of Sox2 are found, in the
mutant, at early, but not at late, stages of neurogenesis.
(Fig. 1E; see Figs S2, S5 in
the supplementary material).
The rescue experiment, while highlighting an essential role of Sox2 in
early cells, does not rule out additional, but not yet demonstrated, roles of
Sox2 at later stages, as suggested by the presence of Sox2 in well-developed
MAP2-positive cells in vitro (Fig.
2) and a few neurons in vivo (ssee Fig. S5 in the supplementary
material) (Ferri et al.,
2004
).
In the mutant, some cells with poorly developed neuronal morphology co-express a neuronal (β-tubulin) with a glial (GFAP) marker (Fig. 6). In neuronal committed cells, Sox2 might act to repress part of a gliogenic transcription program. Indeed, Sox2 binds to the GFAP promoter in vitro and in vivo (Fig. 8E,F); moreover, when overexpressed, it silences the endogenous GFAP activity in differentiating neural cells (Fig. 8A), and inhibits a co-transfected GFAP promoter-driven reporter transgene (Fig. 8D). Thus, at least part of the Sox2-dependent inhibition of GFAP is explained by a direct repressor activity of Sox2.
We hypothesize that Sox2 has a dual role in neural cell differentiation; in
early precursors committing themselves to neurogenesis, it `programs' later
neuronal differentiation events, while repressing some alternative
(glial-specific) transcription programs. In cells undergoing gliogenesis, its
decline would allow proper glial-specific gene expression. Similar models have
been proposed for other differentiation systems
(Enver and Greaves, 1998
;
Hu et al., 1997
;
Laslo et al., 2006
;
Mikkola et al., 2002
;
Nutt et al., 1999
). In mutant
neural precursors, Sox2 levels would be too low to upregulate the neuronal
differentiation program efficiently and/or to switch-off the glial
program.
Different roles for Sox2 in stem and in differentiating cells?
An important role of Sox2 in neural stem/precursor cells
proliferation/maintenance was identified previously
(Graham et al., 2003
;
Bylund et al., 2003
;
Ferri et al., 2004
). This is
consistent with the high level of Sox2 detected in such cells
(Fig. 1B-E; see Fig. S5 in the
supplementary material). Our present results point to an additional role of
Sox2 in differentiated cells. Sox2 might participate in different networks of
transcription factors in stem versus differentiating cells. A precedent exists
for Oct4, a factor co-expressed with Sox2 in ES cells, the levels of which
affect both pluripotency and differentiation
(Niwa et al., 2000
).
Graham et al. (Graham et al.,
2003
) and Bylund et al. (Bylund
et al., 2003
) showed that increasing Sox2 levels in normal chick
embryo neural tube prevents their initial (day 1) differentiation into
β-tubulin-positive cells and maintains their self-renewal. Bani-Yaghoub
et al. (Bani-Yaghoub et al.,
2006
) obtained similar results in embryonic neural precursors in
vitro. These results are apparently at variance with our observation that Sox2
overexpression in Sox2-mutant cells increases their differentiation
(Fig. 7).
|
Sox2 overexpression in mutant cells did not change the balance between neuronal (as measured by β-tubulin expression) and glial cells. Rather, it modulated their differentiated characteristics (increased neuronal maturation, decreased glial GFAP expression). Thus, Sox2 does not control the choice between neuronal and glial differentiation.
In vivo defects in a subset of neuronal cells
In agreement with in vitro neural defects, we detect, in vivo, significant
abnormalities of a subset of neurons, GABAergic neurons. These are decreased
by 40-60% in P0 cortical cells and in the olfactory bulb, indicating that both
embryonic and adult genesis of this neuronal type is compromised (Figs
9,
12). Additionally, we detect
morphological abnormalities in embryonic GABAergic neurons, during their
migration to the cortex from the ganglionic eminences, and in early postnatal
cortex (Figs 10,
11), as well as, to a lower
extent, in newly generated calretinin-positive cells in the adult olfactory
bulb (Fig. 12C). These results
confirm the in vitro results (Figs
3,
4 and
5) and extend preliminary in
vivo evidence of loss of neural parenchyma and reduced maturation of postnatal
neurons (Ferri et al.,
2004
).
From a quantitative point of view, the overall population in the P0 cortex and postnatal olfactory bulb is not as deeply affected as in the in vitro experiments. We suggest several, not mutually exclusive, explanations for this discrepancy.
First, only selected neuronal populations may be vulnerable to low Sox2
dosage; these might be more represented in vitro than in vivo. Indeed, in
vivo, among the neuron types tested, only the GABAergic subset is detectably
compromised; significantly, in our in vitro system, the majority of
differentiated neurons are of this type
(Fig. 5) (see
Gritti et al., 2001
;
Conti et al., 2005
).
Second, in vitro stem cells may differ to some extent from in vivo stem
cells. Indeed, most bona fide in vivo stem cells are in a low cycling state,
and are a radial glia cell type (Doetsch,
2003
), whereas in vitro stem cells are highly proliferating.
Moreover, many in vitro stem cells actually arise from more differentiated in
vivo precursors (transit-amplifying progenitors, astroglia and
oligodendrocytes), which have been reprogrammed in vitro to a stem cell status
by growth factor stimulation (Doetsch et
al., 2002
). Interestingly, reprogramming of oligodendrocyte
precursors to stem cells requires Sox2 reactivation
(Kondo and Raff, 2004
); thus,
Sox2 mutant neural stem cells might have been `reprogrammed' less efficiently
than wild-type cells.
Third, in vitro culture conditions, while allowing efficient
differentiation of normal neural stem cells, might be subtly deficient
relative to the in vivo environment. This might exaggerate the proportion of
mutant Sox2 cells that fail to undergo appropriate differentiation in vitro.
Indeed, in vitro not all differentiated markers are developed, and very few
cells express appropriate electrophysiological properties, in contrast to ex
vivo neurons (Gritti et al.,
1996
; Gritti et al.,
2001
).
Finally, cell selection effects normally operate in vivo, and only a
minority of post-migratory cells survive
(Ferrer et al., 1992
;
Muotri and Gage, 2006
;
Oppenheim, 1991
). Abnormal
neurons, that fail to properly develop and establish connections, will
probably be selected against in vivo. The neuronal loss observed in vivo in
specific brain areas (striatum, thalamus), and the reduced cortical extension
(Ferri et al., 2004
), might
reflect these phenomena.
Conclusions
The in vitro culture system, by demonstrating a role for Sox2 in neuronal
differentiation, will allow the identification of early Sox2 targets important
for neuronal differentiation, by functional rescue experiments. Rare cases of
Sox2 deficiency in man are characterized by hippocampal abnormalities,
epilepsy, eye and pituitary defects
(Fantes et al., 2003
;
Ragge et al., 2005
;
Sisodiya et al., 2006
;
Kelberman et al., 2006
), also
reported in mutant mice (Ferri et al.,
2004
; Taranova et al.,
2006
). Loss of GABAergic inhibitory neurons leads to epilepsy in
mouse and man (Noebels, 2003
;
Cobos et al., 2005
). Our
observation of GABAergic neuron deficiency in mouse points to a plausible
cellular basis for epilepsy in humans with SOX2 mutations. Other
neuronal subsets remain to be tested for their Sox2 requirement.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/3/541/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian,
N. and Lovell-Badge, R. (2003). Multipotent cell lineages in
early mouse development depend on SOX2 function. Genes
Dev. 17,126
-140.
Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jorgensen, H. F., John, R. M., Gouti, M., Casanova, M., Warnes, G., Merkenschlager, M. et al. (2006). Chromatin signatures of pluripotent cell lines. Nat. Cell Biol. 8,532 -538.[CrossRef][Medline]
Bani-Yaghoub, M., Tremblay, R. G., Lei, J. X., Zhang, D., Zurakowski, B., Sandhu, J. K., Smith, B., Ribecco-Lutkiewicz, M., Kennedy, J., Walker, P. R. et al. (2006). Role of Sox2 in the development of the mouse neocortex. Dev. Biol. 295, 52-66.[CrossRef][Medline]
Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K. et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125,315 -326.[CrossRef][Medline]
Boyer, L. A., Lee, T. I., Cole, M. F., Johnstone, S. E., Levine, S. S., Zucker, J. P., Guenther, M. G., Kumar, R. M., Murray, H. L., Jenner, R. G. et al. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122,947 -956.[CrossRef][Medline]
Boyer, L. A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L. A., Lee, T. I., Levine, S. S., Wernig, M., Tajonar, A., Ray, M. K. et al. (2006a). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441,349 -353.[CrossRef][Medline]
Boyer, L. A., Mathur, D. and Jaenisch, R. (2006b). Molecular control of pluripotency. Curr. Opin. Genet. Dev. 16,455 -462.[CrossRef][Medline]
Brunelli, S., Relaix, F., Baesso, S., Buckingham, M. and Cossu, G. (2007). Beta catenin-independent activation of MyoD in presomitic mesoderm requires PKC and depends on Pax3 transcriptional activity. Dev. Biol. 304,604 -614.[CrossRef][Medline]
Bylund, M., Andersson, E., Novitch, B. G. and Muhr, J. (2003). Vertebrate neurogenesis is counteracted by Sox1-3 activity. Nat. Neurosci. 6,1162 -1168.[CrossRef][Medline]
Catena, R., Tiveron, C., Ronchi, A., Porta, S., Ferri, A., Tatangelo, L., Cavallaro, M., Favaro, R., Ottolenghi, S., Reinbold, R. et al. (2004). Conserved POU binding DNA sites in the Sox2 upstream enhancer regulate gene expression in embryonic and neural stem cells. J. Biol. Chem. 279,41856 -41857.
Chew, J. L., Loh, Y. H., Zhang, W., Chen, X., Tam, W. L., Yeap,
L. S., Li, P., Ang, Y. S., Lim, B., Robson, P. et al. (2005).
Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2
complex in embryonic stem cells. Mol. Cell. Biol.
25,6031
-6046.
Cobos, I., Calcagnotto, M. E., Vilaythong, A. J., Thwin, M. T., Noebels, J. L., Baraban, S. C. and Rubenstein, J. L. (2005). Mice lacking Dlx1 show subtype-specific loss of interneurons, reduced inhibition and epilepsy. Nat. Neurosci. 8,1059 -1068.[CrossRef][Medline]
Conti, L., Pollard, S., Gorba, T., Reitano, E., Toselli, M., Biella, G., Sun, Y., Sanzone, S., Ying, Q.-L., Cattaneo, E. et al. (2005). Niche-independent symmetrical self-renewal of a mammalian tissue stem cell. PloS Biol. 3, e283.[CrossRef][Medline]
Doetsch, F. (2003). The glial identity of neural stem cells. Nat. Neurosci. 6,1127 -1134.[CrossRef][Medline]
Doetsch, F., Petreanu, L., Caille, I., Garcia-Verdugo, J. M. and Alvarez-Buylla, A. (2002). EGF converts transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells. Neuron 36,1021 -1034.[CrossRef][Medline]
Enver, T. and Greaves, M. (1998). Loops, lineage, and leukemia. Cell 94, 9-12.[CrossRef][Medline]
Fantes, J., Ragge, N. K., Lynch, S. A., McGill, N. I., Collin, J. R., Howard- Peebles, P. N., Hayward, C., Vivian, A. J., Williamson, K., van Heyningen, V. et al. (2003). Mutations in SOX2 cause anophthalmia. Nat. Genet. 33,461 -463.[CrossRef][Medline]
Ferrer, I., Soriano, E., del Rio, J. A., Alcantara, S. and Auladell, C. (1992). Cell death and removal in the cerebral cortex during development. Prog. Neurobiol. 39, 1-43.[CrossRef][Medline]
Ferri, A. L., Cavallaro, M., Braida, D., Di Cristofano, A.,
Canta, A., Vezzani, A., Ottolenghi, S., Pandolfi, P. P., Sala, M., DeBiasi, S.
et al. (2004). Sox2 deficiency causes neurodegeneration and
impaired neurogenesis in the adult mouse brain.
Development 131,3805
-3819.
Galli, R., Binda, E., Orfanelli, U., Cipelletti, B., Gritti, A.,
De Vitis, S., Fiocco, R., Foroni, C., Dimeco, F. and Vescovi, A.
(2004). Isolation and characterization of tumorigenic, stem-like
neural precursors from human glioblastoma. Cancer Res.
64,7011
-7021.
Graham, V., Khudyakov, J., Ellis, P. and Pevny, L. (2003). SOX2 functions to maintain neural progenitor identity. Neuron 39,749 -765.[CrossRef][Medline]
Gritti, A., Parati, E. A., Cova, L., Frolichsthal, P., Galli,
R., Wanke, E., Faravelli, L., Morassutti, D. J., Roisen, F., Nickel, D. D. et
al. (1996). Multipotential stem cells from the adult mouse
brain proliferate and self-renew in response to basic fibroblast growth
factor. J. Neurosci. 16,1091
-1100.
Gritti, A., Galli, R. and Vescovi, A. L. (2001). Cultures of stem cells of the central nervous system. In Protocols for Neural Cell culture. 3rd edn (ed. S. Fedoroff and A. Richardson), pp. 173-198. Totowa, NJ: Humana Press.
Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Munsterberg, A., Vivian, N., Goodfellow, P. and Lovell-Badge, R. (1990). A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346,245 -250.[CrossRef][Medline]
Hemmati, H. D., Nakano, I., Lazareff, J. A., Masterman-Smith,
M., Geschwind, D. H., Bronner-Fraser, M. and Kornblum, H. I.
(2003). Cancerous stem cells can arise from pediatric brain
tumors. Proc. Natl. Acad. Sci. USA
100,15178
-15183.
Hu, M., Krause, D., Greaves, M., Sharkis, S., Dexter, M.,
Heyworth, C. and Enver, T. (1997). Multilineage gene
expression precedes commitment in the hemopoietic system. Genes
Dev. 11,774
-785.
Kamachi, Y., Uchikawa, M. and Kondoh, H. (2000). Pairing SOX off: with partners in the regulation of embryonic development. Trends Genet. 16,182 -187.[CrossRef][Medline]
Kelberman, D., Rizzoti, K., Avilion, A., Bitner-Glindzicz, M., Cianfarani, S., Collins, J., Chong, W. K., Kirk, J. M., Achermann, J. C., Ross, R. et al. (2006). Mutations within Sox2/SOX2 are associated with abnormalities in the hypothalamo-pituitary-gonadal axis in mice and humans. J. Clin. Invest. 116,2442 -2455.[CrossRef][Medline]
Kondo, T. and Raff, M. (2004). Chromatin
remodeling and histone modification in the conversion of oligodendrocyte
precursors to neural stem cells. Genes Dev.
18,2963
-2972.
Kuzmanovic, M., Dudley, V. J. and Sarthy, V. P.
(2003). GFAP promoter drives Muller cell-specific expression in
transgenic mice. Invest. Ophthalmol. Vis. Sci.
44,3606
-3613.
Laslo, P., Spooner, C. J., Warmflash, A., Lancki, D. W., Lee, H. J., Sciammas, R., Gantner, B. N., Dinner, A. R. and Singh, H. (2006). Multilineage transcriptional priming and determination of alternate hematopoietic cell fates. Cell 126,755 -766.[CrossRef][Medline]
Lee, J., Kotliarova, S., Kotliarov, Y., Li, A., Su, Q., Donin, N. M., Pastorino, S., Purow, B. W., Christopher, N., Zhang, W. et al. (2006a). Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum-cultured cell lines. Cancer Cell 9, 391-403.[CrossRef][Medline]
Lee, T. I., Jenner, R. G., Boyer, L. A., Guenther, M. G., Levine, S. S., Kumar, R. M., Chevalier, B., Johnstone, S. E., Cole, M. F., Isono, K. et al. (2006b). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125,301 -313.[CrossRef][Medline]
Levitt, P., Eagleson, K. L. and Powell, E. M. (2004). Regulation of neocortical interneuron development and the implications for neurodevelopmental disorders. Trends Neurosci. 27,400 -406.[CrossRef][Medline]
Li, D., Marks, J. D., Schumacker, P. T., Young, R. M. and Brorson, J. R. (2005). Physiological hypoxia promotes survival of cultured cortical neurons. Eur. J. Neurosci. 22,1319 -1326.[CrossRef][Medline]
Lim, D. A., Tramontin, A. D., Trevejo, J. M., Herrera, D. G., Garcia-Verdugo, J. M. and Alvarez-Buylla, A. (2000). Noggin antagonizes BMP signaling to create a niche for adult neurogenesis. Neuron 28,713 -726.[CrossRef][Medline]
Lledo, P. M., Alonso, M. and Grubb, M. S. (2006). Adult neurogenesis and functional plasticity in neuronal circuits. Nat. Rev. Neurosci. 7, 179-193.[CrossRef][Medline]
Markram, H., Toledo-Rodriguez, M., Wang, Y., Gupta, A., Silberberg, G. and Wu, C. (2004). Interneurons of the neocortical inhibitory system. Nat. Rev. Neurosci. 5, 793-807.[CrossRef][Medline]
Mikkola, I., Heavey, B., Horcher, M. and Busslinger, M.
(2002). Reversion of B cell commitment upon loss of Pax5
expression. Science 297,110
-113.
Miyagi, S., Nishimoto, M., Saito, T., Ninomiya, M., Sawamoto,
K., Okano, H., Muramatsu, M., Oguro, H., Iwama, A. and Okuda, A.
(2006). The Sox2 regulatory region 2 functions as a neural stem
cell-specific enhancer in the telencephalon. J. Biol.
Chem. 281,13374
-13381.
Morita, N., Nakahira, K., Baba, H., Akita, H., Kumada, T., Ogawa, M., Nakajima, K., Kawata, M., Mikoshiba, K. and Ikenaka, K. (1997). Astrocytic lineage analysis by detection of GFAP promoter activity in vitro. Dev. Neurosci. 19,210 -218.[CrossRef][Medline]
Muotri, A. R. and Gage, F. H. (2006). Generation of neuronal variability and complexity. Nature 441,1087 -1093.[CrossRef][Medline]
Nagy, J. I. and Rash, J. E. (2000). Connexins and gap junctions of astrocytes and oligodendrocytes in the CNS. Brain Res. Rev. 32,29 -44.[CrossRef][Medline]
Nicolis, S. K. (2007). Cancer stem cells and `stemness' genes in neuro-oncology. Neurobiol. Dis. 25,217 -229.[CrossRef][Medline]
Niwa, H., Miyazaki, J. and Smith, A. (2000). Quantitative expression of Oct 3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24,372 -376.[CrossRef][Medline]
Noebels, J. L. (2003). The biology of epilepsy genes. Annu. Rev. Neurosci. 26,599 -625.[CrossRef][Medline]
Nutt, S. L., Heavey, B., Rolink, A. G. and Busslinger, M. (1999). Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401,556 -562.[CrossRef][Medline]
Oppenheim, R. W. (1991). Cell death during development of the nervous system. Annu. Rev. Neurosci. 14,453 -501.[CrossRef][Medline]
Pevny, L. and Placzek, M. (2005). SOX genes and neural progenitor identity. Curr. Opin. Neurobiol. 15, 7-13.[CrossRef][Medline]
Pomeroy, S. L., Tamayo, P., Gaasenbeek, M., Sturla, L. M., Angelo, M., McLaughlin, M. E., Kim, J. Y., Goumnerova, L. C., Black, P. M., Lau, C. et al. (2002). Prediction of central nervous system embryonal tumour outcome based on gene expression. Nature 415,436 -442.[CrossRef][Medline]
Ragge, N. K., Lorenz, B., Schneider, A., Bushby, K., de Sanctis, L., de Sanctis, U., Salt, A., Collin, J. R., Vivian, A. J., Free, S. L. et al. (2005). SOX2 anophthalmia syndrome. Am. J. Med. Genet. A 135,1 -7.[Medline]
Sisodiya, S. M., Ragge, N. K., Cavalleri, G. L., Hever, A., Lorenz, B., Schneider, A., Williamson, K. A., Stevens, J. M., Free, S. L., Thompson, P. J. et al. (2006). Role of SOX2 mutations in human hippocampal malformations and epilepsy. Epilepsia 47,534 -542.[CrossRef][Medline]
Szutorisz, H. and Dillon, N. (2005). The epigenetic basis for embryonic stem cell pluripotency. Bioessays 27,1286 -1293.[CrossRef][Medline]
Tanaka, S., Kamachi, Y., Tanouchi, A., Hamada, H., Jing, N. and
Kondoh, H. (2004). Interplay of SOX and POU factors in
regulation of the Nestin gene in neural primordial cells. Mol.
Cell. Biol. 24,8834
-8846.
Taranova, O. V., Magness, S. T., Fagan, B. M., Wu, Y., Surzenko,
N., Hutton, S. R. and Pevny, L. H. (2006). SOX2 is a
dose-dependent regulator of retinal neural progenitor competence.
Genes Dev. 20,1187
-1202.
Wagenaar, D. A., Madhavan, R., Pine, J. and Potter, S. M.
(2005). Controlling bursting in cortical cultures with
closed-loop multi-electrode stimulation. J. Neurosci.
25,680
-688.
Wegner, M. and Stolt, C. C. (2005). From stem cells to neurons and glia: a Soxist's view of neural development. Trends Neurosci. 28,583 -588.[CrossRef][Medline]
Weinmann, A. S. and Farnham, P. J. (2002). Identification of unknown target genes of human transcription factors using chromatin immunoprecipitation. Methods 26, 37-47.[CrossRef][Medline]
Wilson, M. and Koopman, P. (2002). Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators. Curr. Opin. Genet. Dev. 12,441 -446.[CrossRef][Medline]
Wonders, C. P. and Anderson, S. A. (2006). The origin and specification of cortical interneurons. Nat. Rev. Neurosci. 7,687 -696.[CrossRef][Medline]
Zappone, M. V., Galli, R., Catena, R., Meani, N., De Biasi, S., Mattei, E., Tiveron, C., Vescovi, A. L., Lovell-Badge, R., Ottolenghi, S. et al. (2000). Sox2 regulatory sequences direct expression of a (beta)-geo transgene to telencephalic neural stem cells and precursors of the mouse embryo, revealing regionalization of gene expression in CNS stem cells. Development 127,2367 -2382.[Abstract]
This article has been cited by other articles:
![]() |
B. W. Okaty, M. N. Miller, K. Sugino, C. M. Hempel, and S. B. Nelson Transcriptional and Electrophysiological Maturation of Neocortical Fast-Spiking GABAergic Interneurons J. Neurosci., May 27, 2009; 29(21): 7040 - 7052. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nomura, M. Maruyama, M. Katano, H. Kato, J. Zhang, S. Masui, Y. Mizuno, Y. Okazaki, M. Nishimoto, and A. Okuda Differential Requirement for Nucleostemin in Embryonic Stem Cell and Neural Stem Cell Viability Stem Cells, May 1, 2009; 27(5): 1066 - 1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S Alatzoglou, D. Kelberman, and M. T Dattani The role of SOX proteins in normal pituitary development J. Endocrinol., March 1, 2009; 200(3): 245 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. R. Gangemi, F. Griffero, D. Marubbi, M. Perera, M. C. Capra, P. Malatesta, G. L. Ravetti, G. L. Zona, A. Daga, and G. Corte SOX2 Silencing in Glioblastoma Tumor-Initiating Cells Causes Stop of Proliferation and Loss of Tumorigenicity Stem Cells, January 1, 2009; 27(1): 40 - 48. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cavallaro, J. Mariani, C. Lancini, E. Latorre, R. Caccia, F. Gullo, M. Valotta, S. DeBiasi, L. Spinardi, A. Ronchi, et al. Impaired generation of mature neurons by neural stem cells from hypomorphic Sox2 mutants J. Cell Sci., February 1, 2008; 121(3): e307 - e307. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||