|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 2 January 2008
doi: 10.1242/dev.015263
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biology, University of Washington, Box 351800, Seattle, WA 98195-1800, USA.
Author for correspondence (e-mail:
riddifordl{at}janelia.hhmi.org)
Accepted 6 November 2007
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Metamorphosis, Broad, Juvenile hormone, Pupation, Tribolium
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). These events are rare and thus their evolutionary origins
remain poorly understood.
The evolution of complete metamorphosis (holometaboly) in insects is a key
evolutionary innovation that has contributed to their success
(Yang, 2001). In
holometabolous insects, the three life history stages, larva, pupa and adult,
have morphologies that are highly adapted to the ecological pressures
encountered and that have little or no resemblance to each other.
Holometabolous insects are thought to have evolved from hemimetabolous
insects, which have only two life history stages, the nymph and the adult. The
hemimetabolous insects are direct developers in that the nymphs resemble the
adults except for the genitalia and wings, which develop as everted pads or
buds during nymphal growth and molting. The evolutionary origin of the three
morphologically distinct, life-history stages of holometabolous insects
remains an enigma. A developmental basis for this major evolutionary event may
shed light onto how major key innovations evolve.
Various theories have been proposed to explain the evolutionary origin of
holometaboly (Berlese, 1913;
Heslop-Harrison, 1958;
Hinton, 1963;
Truman and Riddiford, 1999;
Erezyilmaz, 2006). One current
theory based on a proposal by Berlese
(Berlese, 1913) and on present
knowledge of the endocrine regulation of embryonic development is that the
holometabolous larva corresponds to the hemimetabolous embryonic stage called
the pronymph (Truman and Riddiford,
1999). According to this theory, in holometabolous insect embryos,
juvenile hormone (JH), which is secreted earlier than in hemimetabolous
embryos, truncates patterning cascades and promotes precocious
differentiation, thereby resulting in a novel larval form. Only when JH
declines in the final larval instar does extensive morphogenesis resume and
lead to differentiation of the pupa
(Truman and Riddiford,
2007).
Although a shift in JH titers may explain the origin of larval form, this
theory implies that the holometabolous pupa and the hemimetabolous nymph are
homologous developmental stages. A change in the embryonic JH titer alone
cannot explain the formation of the pupal morph, which, with its immobile and
compact morphology, shares little resemblance to the mobile feeding nymphs.
This implies that a second major developmental reorganization must have
occurred during the evolution of the pupa. This paper examines the
developmental regulation of pupal morphology in beetles (Coleoptera), which
diverged nearly 300 million years ago from other higher insects, such as
Diptera and Lepidoptera (Kristensen,
1999).
A major gene involved in specifying pupal development is the BTB/POZ
(Bric-a-brac, Tramtrack, Broad-complex/POx virus Zinc finger) domain
transcription factor broad (br), which has been shown to
specify pupal fates in Drosophila melanogaster (Meigen)
(Zhou and Riddiford, 2002) and
whose expression correlates with the timing of pupal commitment in the tobacco
hornworm, Manduca sexta (Linnaeus)
(Zhou et al., 1998;
Zhou and Riddiford, 2001). The
Drosophila and Manduca br genes encode four different
alternatively spliced isoforms of zinc-finger transcription factors, which
share a common BTB core domain (DiBello et
al., 1991; Bayer et al.,
1996a). During the last larval instar, each of the isoforms is
expressed in a spatiotemporo-specific manner that coordinates the onset of
major metamorphic changes during pupal development
(Emery et al., 1994;
Bayer et al., 1996a).
Functional analyses have confirmed the role of br in specifying pupal
fates: misexpression of the br isoform Br-Z1 during both larval and
adult development in Drosophila leads to the appearance of
pupal-specific products during the respective molts
(Zhou and Riddiford,
2002).
In Drosophila and Manduca, the high expression of
br is confined to the time of metamorphosis to the pupa, and is
regulated by hormonal inputs. Ecdysone [used as a general term here; see
Riddiford et al. (Riddiford et al.,
2000)] and JH play an important role in coordinating the
expression of br. br is one of the early ecdysone response genes
whose expression activates the tissue-specific late ecdysone response genes
during prepupal development (Karim et al.,
1993; Bayer et al.,
1996b). In Manduca, the initial expression of br
is prevented in the presence of JH (Zhou
et al., 1998; Zhou and
Riddiford, 2001). During the pupal stage, br expression
declines to undetectable levels; but application of JH before the onset of the
adult molt leads to the upregulation of br and the subsequent
formation of a second pupal cuticle in Manduca and in the abdomen of
Drosophila (Zhou and Riddiford,
2002). Thus, prior to the initial onset of br expression,
JH must decline; once br is expressed, JH can maintain its expression
in response to ecdysone.
In the hemimetabolous insect Oncopeltus fasciatus (Dallas),
br is expressed throughout nymphal development and is involved in the
morphogenetic changes that occur between the different nymphal instars
(Erezyilmaz et al., 2006).
br only disappears when ecdysone rises in the absence of JH in the
final instar. A considerable evolutionary gap exists between the highly
derived Lepidoptera/Diptera and the hemimetabolous insects. Thus, in order to
understand the evolution of metamorphosis, we chose to examine the role of
br in a more basal holometabolous insect, the flour beetle
Tribolium castaneum (Herbst). We find that removal of br by
injection of dsRNA has no apparent effect on the gross morphology of the final
larval molt. But this removal disrupts the normal larval-pupal transformation,
resulting in the formation of an individual with larval and adult
characteristics.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Hormonal application
The JH analog (JHA) 95% S-hydroprene (SDS Biotech, Tokyo, Japan) was
diluted in acetone. Diluted solution (0.5 µl) containing different
concentrations of hydroprene was applied topically onto the dorsal side of
mid-sixth instar larvae or to pupae less than 4 hours after ecdysis. The same
amount of acetone was applied to control larvae or pupae.
Amplification of cDNA
Using the Tribolium Genome Base
(http://www.bioinformatics.ksu.edu/BeetleBase/),
primers were designed to amplify regions of interest. For the br core
region, a 250 bp fragment downstream of the BTB domain was amplified using the
forward primer TCGGCAACAACAACAATAAC and the reverse primer CATCGGT
TCGCTCTTCAC. For the isoform-specific fragments, the following primer
combinations were used: TGTGGACGAGTTCCGATG (Z1 forward) and
TCCTATGGTAAATGCTCTTGTG (Z1 reverse); GTCGCCCA AGAAGGTGT (Z2 forward) and
CGACTTGTGGTAAGTGTAGATGTG (Z2 reverse); CGCACCTTCTCCTGCTACT (Z3 forward) and
GCGTCGTGAGCGAGTTTT (Z3 reverse); TTGAGTCTTCCACTTC CACTGA (Z4 forward) and
GCGATGGTAAATACTGCGATG (Z4 reverse); and ACGGTTTTGGTCCCTCCA (Z5 forward) and
CTCCGATGGCTGACAAGC (Z5 reverse).
mRNA isolation
Larvae from penultimate and final instars, first day pupae and pharate
adults were flash-frozen in liquid nitrogen and stored at -80°C until use.
Larvae and pupae were dissected in phosphate-buffered saline [PBS; 0.0038M
NaH2PO4, 0.0162 M Na2HPO4, 0.15 M
NaCl (pH 7.4)], and the fat body and gut were removed. After Trizol
(Invitrogen, Carlsbad, CA, USA) and chloroform extraction, RNA was
DNAse-treated and precipitated in isopropanol. cDNA was synthesized from 1
µg of total RNA using the cDNA Synthesis Kit (Fermentas, Hanover, MD),
according to the manufacturer's instructions, and stored at -20°C until
use.
RT-PCR
RT-PCR reactions to examine the expression profiles of br isoforms
were conducted using the forward primer from the br core region and
each of the isoform-specific reverse primers (same as those given above for
br-Z1, br-Z2, br-Z3 and br-Z5; GCCTTTTCAGAGTGAGTTTGGT for
br-Z4), under the following PCR cycle conditions: 30 seconds at
94°C, 30 seconds at 55°C and 1.5 minutes at 72°C. Cycle numbers
used were: 38 cycles for br-Z1; 40 for br-Z2; 34 for
br-Z3; 32 for br-Z4; and 35 for br-Z5. In addition,
37 cycles were used for ribosomal protein subunit3 (rps3)
(Mahroof et al., 2005), a
control for the variation in the amount of cDNA loaded. For all PCR reactions,
the mixture was held at 94°C for 5 minutes before starting the PCR cycles,
and then held at 72°C for 5 minutes before being cooled to 4°C.
The samples for each treatment were run on the same gel and visualized under UV light. Pictures were taken with a Polaroid camera (Polaroid, Waltham, MA, USA), and levels were adjusted for the entire gel picture using Adobe Photoshop (Adobe Systems, San Jose, CA, USA).
dsRNA synthesis and injection
For double-stranded RNA (dsRNA)-mediated silencing of br, dsRNA
was created as follows. cDNA amplified with the primers listed above was
cloned using either the Topo TA vector (Invitrogen) or the PGEM vector
(Promega, Madison, WI, USA). Sequencing confirmed the identity of clones with
the following insertions: 251 bp, 177 bp, 184 bp, 121 bp, 196 bp and 120 bp
fragments for the core region, br-Z1, br-Z2, br-Z3, br-Z4 and
br-Z5 isoforms, respectively. Each of the strands of the dsRNA was
synthesized using the MEGAscript Kit (Ambion, Austin, TX); strands were
annealed as described (Hughes and Kaufman,
2002).
Because Tribolium larvae have variable number of instars, we collected both penultimate and final instars for dsRNA injection. Approximately 1 µg (0.5 µl) of dsRNA was injected into either day 2 penultimate or final instar larvae using a 10 µl glass capillary needle connected to a syringe. Controls received the same volume of either DEPC water or dsRNA of the bacterial ampicillin-resistance gene (ampr) (plasmid obtained from Dr Takashi Koyama, our laboratory). Larvae were then kept at 30°C until processed. Pupal phenotypes were examined one day after pupal ecdysis, and adult phenotypes were examined once the adult cuticle became completely tanned.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and
Drosophila br genes (DiBello et
al., 1991) (Fig.
1). There were five zinc-finger domains, four of which share high
amino acid sequence similarity with the Drosophila br zinc-finger
isoforms: Br-Z1 (85%), Br-Z2 (85%), Br-Z3 (97%) and Br-Z4 (90%). The
Tribolium Br-Z2, Br-Z3 and Br-Z4 isoforms also shared high sequence
similarity with Manduca Br-Z2 (93%), Br-Z3 (98%) and Br-Z4 (82%)
isoforms, respectively. The fifth isoform was found to contain two zinc
fingers that had low sequence similarity to the br isoforms in
Drosophila (39%, 36%, 43% and 35% for Br-Z1, Br-Z2, Br-Z3 and Br-Z4,
respectively), Manduca (39%, 43% and 35% for Br-Z2, Br-Z3 and Br-Z4,
respectively) and Bombyx (43%, 39%, 43% and 35% for Br-Z1, Br-Z2,
Br-Z3 and Br-Z4, respectively) and will be called Br-Z5 in the current paper.
The Br-Z5 isoform was also different from the other br isoforms in
that the lysine (K) in the predicted amino acid sequence (LKRH) within the
5' zinc-finger domain in the other isoforms has been replaced by
glutamine (Q).
|
Effect of hydroprene application in Tribolium
Application of 1.5 nmoles of the JHA hydroprene to mid-sixth instar larvae
caused supernumerary molts (extra larval molts after the eighth instar) in
five out of 14 larvae (Table
1). Two others formed larval/pupal intermediates, with one showing
mostly larval characteristics, and one with enlarged wings and intermediate
larval/pupal appendages (see Fig. S1 in the supplementary material). After
higher JHA doses, more became supernumerary larvae
(Table 1). Most of the
hydroprene-treated animals eventually died without forming a pupa. The few
that subsequently molted to pupae then either died as pupae or eclosed as
adults with secondary pupal cuticle (data not shown). All but one of the
acetone-treated control larvae formed perfect pupae, with 3/13 molting once to
a seventh (final) larval instar, then to a pupa
(Table 1). The remainder molted
to eighth instar larvae, then to pupae. All of these controls formed normal
adults.
|
Expression of br isoforms in normal and JH-treated larvae
All br isoforms were detected at low levels by RT-PCR during the
sixth instar and until around day 4 of the final seventh instar
(Fig. 3A; although the signal
for the Z1/Z4 and Z4 isoforms is not visible in
Fig. 3A, an increase of two
RT-PCR cycles revealed a band). On day 4 of the final instar, major increases
in the amounts of mRNA were observed (Fig.
3A), and the expression remained high for the remainder of the
instar. This rise in expression occurs around 1 to 2 days before the larvae
enter the stationary crooked posture stage that signals the onset of visible
metamorphosis (Quennedey and Quennedey,
1999). It should be noted that different numbers of cycles were
used for each isoform, and, based on the number of cycles alone,
br-Z4 mRNA appears to be most abundantly expressed, whereas
br-Z2 mRNA is expressed least abundantly.
When larvae were treated with 15 nmoles hydroprene on day 2 of the sixth instar, they molted to seventh instar larvae that expressed all br isoforms in patterns similar to those seen in the untreated sixth instar (Fig. 3B). By contrast, those sixth instar larvae given only acetone showed br isoform expression profiles typical of untreated final (seventh) instars, with all isoforms dramatically increasing on day 4 (Fig. 3B).
|
|
The abdomen of the `pupae' formed after injection of the br core-dsRNA was larval-like (Fig. 4A), with a reduced number of short setae and short adult-specific spines; it lacked the pupal-specific gin traps, and occasional brown spots were observed at their sites (Fig. 4C). The urogomphi (terminal appendages on the abdomen) were intermediate between larval and pupal in their shape and width, but showed a larval-like pigmentation (Fig. 4B,D). The dorsal abdomen had a larval-like pigmentation pattern, although it was not as dark as in the larva (Fig. 4A), and the ventral side had grooves that run anteroposterior along the lateral sides; these are conspicuous in the larva (data not shown). The sternites, however, were narrower anterioposteriorly and wider laterally, assuming a more pupal/adult-like morphology (Fig. 4A).
The appendages of the br core dsRNA-treated individuals had a more adult-like morphology with pronounced segmentation, and differentiation of adult type claws on the legs (Fig. 4E-I). Neither of these traits was seen in the ampr dsRNA- or water-injected control pupae, whose appendages tended to be relatively smooth, showing only the beginnings of segmentation and no differentiation of the claws (Fig. 4E-G). The maxillae and mandibles in the br dsRNA-treated individuals also assumed a more adult-like morphology (Fig. 4H,I). In particular, the maxilla of br dsRNA-treated individuals had segmented palps, and well-defined lacinia and galea, both of which are not well developed in the larvae.
|
Some of the individuals exposed to br core dsRNA (11/29, 38%) died as prepupae or during the process of ecdysis. When their old cuticle (exuviae) was removed, the animals were phenotypically similar to those that had successfully ecdysed. These larval-adult intermediates formed from larvae given br core dsRNA typically died within a few days. Some of them, however, underwent a molt, but not ecdysis. When we manually removed the old cuticle, the phenotype of these molted individuals was identical to that obtained after the first molt (Fig. 4A). Thus, the external morphology of these individuals was a repeat of the previous larval-adult intermediate.
Effect of isoform-specific RNA interference Effect of a mixture of dsRNAs for all br isoforms
To assess which of the br isoforms was responsible for the
observed phenotype, dsRNA for each of the isoforms was synthesized and
injected into either the penultimate or final instar larvae. To determine
whether suppression of all isoforms could mimic the effect of the loss of the
br core expression, we injected larvae with a mixture of dsRNAs of
all five isoforms. The resulting animals resembled the individuals obtained
after giving br core dsRNA (compare
Fig. 5B with 5C). The only
difference was that the gin traps were not completely eliminated, as in those
receiving the br core dsRNA, but they were substantially reduced in
size, and tiny brown bumps were visible
(Fig. 5C; arrowheads).
Effects of reductions of single isoforms
Larvae treated with either br-Z2 or br-Z3 dsRNA formed
pupae that looked normal except for shortened wings and a minor modification
of the legs, with the beginning of segmentation and weak forked claw formation
(Fig. 5D,E,J,K). The overall
body sizes of these pupae were not different from those of the water-injected
control pupae, but the wing lengths were substantially shorter
(Fig. 5D,E,J). Pupae formed
after br-Z2 dsRNA injection survived to produce a normal adult
cuticle and to initiate adult ecdysis. Most, however, failed to complete
ecdysis, such that the pupal cuticle remained on the tips of the wings,
leading to wings that were not fully expanded. The treated adults that eclosed
properly (2 out of 11) had shorter wings than those seen in normal adults,
which was particularly obvious for the forewings (compare
Fig. 5M with 5N). Adults from
larvae given br-Z3 dsRNA exhibited similar defects in adult
eclosion.
|
The effect of br-Z1 dsRNA was comparatively weak. The br-Z1 dsRNA-injected pupae formed claws that were similar to those formed following exposure to br-Z4 dsRNA, but the wings looked more or less normal (Fig. 5H,K). Many normal-looking adults were formed after larval exposure to br-Z1 dsRNA. A few had the stripe of untanned cuticle on the pronotum, as seen in the br-Z4 dsRNA-treated adults, but all had proper tanning on the abdominal sternites (Fig. 5P).
|
Effects of pair-wise knock-downs
Because individuals formed after exposure to br-Z2 or
br-Z4 dsRNA displayed features that were most similar to those seen
after exposure to br core dsRNA, a mixture of br-Z2 and
br-Z4 dsRNA was injected (Fig.
6A). The resulting individuals were essentially identical to the
individuals that had all five isoforms reduced. Thus, a reduction of both
Br-Z2 and Br-Z4 was sufficient to produce the phenotype seen after removal of
all isoforms.
To assess the effect of other combination of the isoforms, pair-wise injections of br-Z1, br-Z2, br-Z3 and br-Z4 isoform dsRNA were performed. Injection of br-Z1 and br-Z2, br-Z1 and br-Z3, and br-Z3 and br-Z4 dsRNA all resulted in individuals that resembled the complete br knockdown phenotypes, except that the degrees of pigmentation and segmentation were weaker (Fig. 6A). Furthermore, the urogomphi were more pupal-like in character. Thus, these combinations produced weaker effects than those caused by giving both br-Z2 and br-Z4 dsRNA.
When both br-Z2 and br-Z3 dsRNA was injected into the same larva, a pupa with shorter wings was formed (Fig. 5F,J). The degree of shortening showed an additive effect over that caused by each of the two isoforms alone (Fig. 5J). In these animals, the relative shortening was greater for the forewing than for the hind wing.
When both br-Z1 and br-Z4 dsRNA was injected, the resulting pupae resembled the individuals given only br-Z4 dsRNA, but with slightly shorter ballooning wings (compare Z1/Z4 in Fig. 6A and Z4 in Fig. 5G). These pupae subsequently molted to form adults with large patches of pupal-like cuticle on the abdomen and the pronotum (Fig. 6C,D). Only a small patch of adult cuticle was present at the very tip of the terminal abdominal segment (Fig. 6D, arrowhead). In addition, reduced gin traps were present on the adult abdomen (inset, Fig. 6C). In normal animals, gin traps are only seen on the pupal abdomen. The pronotum had mostly pupal-like cuticle, except at the margin where a small patch of adult cuticle was present (Fig. 6C). The forewings also showed patches of white pupal-like cuticle (Fig. 6D; arrowhead). In most animals, the ventral thorax and the head developed normally, but occasionally small patches of pupal-like cuticle were found. This phenotype was similar to that of the adults that were produced from animals that were treated with hydroprene during early pupal development (Fig. 6E).
Adding br-Z5 dsRNA to either br-Z2 or br-Z4 dsRNA had no effect on the phenotype. The resulting animals resembled the br-Z2 and br-Z4 dsRNA-treated pupae, respectively (data not shown).
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
We also found that the br isoforms interact epistatically, so that
elimination of certain pairs of isoforms is necessary for the disruption of
pupal development.
Evolution of br
All four br isoforms found in the more derived Lepidoptera
(Zhou et al., 1998;
Ijiro et al., 2004) (T. Koyama
and L.M.R., unpublished), Diptera (DiBello
et al., 1991; Chen et al.,
2004) and Hymenoptera (Spokony
and Restifo, 2007) are also found in Tribolium. The
chromosomal isoform order of br-Z1, br-Z4, br-Z2 and br-Z3
is conserved among Tribolium, Bombyx and Drosophila. The
pattern of splicing in Tribolium was also found to be similar to that
observed in Drosophila, Manduca and Bombyx, with all
isoforms alternatively splicing to the core region
(DiBello et al., 1991;
Bayer et al., 1996a;
Zhou et al., 1998;
Reza et al., 2004). We also
identified a fifth isoform that had low amino acid similarity to br
isoforms found in other insects. Because our dsRNA-mediated removal of this
isoform by itself or in combination with either br-Z2 or
br-Z4 dsRNA had no apparent effect on the larval-pupal transition,
either its function is completely redundant or it has a novel function
unrelated to morphogenesis.
We found that the expression patterns of Tribolium br isoforms
were similar to those of Drosophila and Manduca
(Bayer et al., 1996a;
Zhou et al., 1998;
Zhou and Riddiford, 2002);
they were expressed at high levels in the last larval instar but not in
JH-treated supernumerary larvae. The expression of these isoforms during the
prepupal period appears to correspond to the time when the ecdysteroid titer
rises prior to pupation in Tribolium and Tenebrio molitor
(Hirashima et al., 1995;
Quennedey and Quennedey,
1999). As in Bombyx penultimate stage larvae
(Ijiro et al., 2004;
Nishita and Takiya, 2004), low
levels of br are present earlier in Tribolium larvae, and
even the embryos (Konopova and Jindra,
2008), but no disruption of larval development has been noted
after br dsRNA treatment in the penultimate (our study) or earlier
(Konopova and Jindra, 2008)
stages. Apparently, expression of br isoforms during larval life does
not play a major role in external larval development of Holometabola, as it
does in the hemimetabolous Oncopeltus
(Erezyilmaz et al., 2006). In
both Drosophila and Manduca, br is expressed in certain
classes of larval neurons (B. Zhou, PhD thesis, University of Washington,
2000; B. Zhou, D. Williams, J. Altman, L.M.R. and J.W.T., unpublished). This
neuronal expression may represent the persistence of an ancestral nymphal
function of br that is related to neuronal plasticity during the
growth of the immature larva. Further study of these differences is
warranted.
In the hemimetabolous Oncopeltus, br is expressed in all the
nymphal stages during both the intermolt and the molt, except during most of
the final nymphal stage and the molt to the adult
(Erezyilmaz et al., 2006). Its
removal by dsRNA results in a stationary molt and prevents anisomorphic growth
of the wing pads. In Tribolium, we found that the removal of
br, especially br-Z2 and br-Z3, resulted in pupae
with shortened wings, a phenotype also seen in Oncopeltus adults
(Erezyilmaz et al., 2006).
Thus, at least the role of br in wing development appears to be
conserved.
Tribolium lacking all Br isoforms, and those lacking only Br-Z2
and Br-Z4 isoforms, failed to make pupal structures but instead had a mix of
larval and adult traits. Only when the removal of br was not complete
or when br was removed much later during the prepupal period did we
see some pupal traits, such as gin traps (Y.S., L.M.R. and J.W.T.,
unpublished). In addition, during the molt to the larval-adult intermediates,
two cuticle genes were expressed that are normally expressed during the
larval-larval and pupal-adult molts but not during the larval-pupal molt
(Y.S., L.M.R. and J.W.T., unpublished). br, with Br-Z2 and Br-Z4
isoforms playing key roles, therefore, acts as a pupal specifier in
Tribolium, as in Manduca and Drosophila
(Zhou and Riddiford, 2002),
leading to a specialized pupal morphology and preventing adult
morphogenesis.
The effect of removal of br isoforms, however, differs between
Tribolium and Drosophila. In Drosophila, br mutants
exhibit developmental arrest at different stages of development
(Kiss et al., 1988), rather
than showing precocious adult development as in Tribolium. Removal of
br from the silkworm Bombyx mori also results in disruption
of metamorphosis and developmental arrest without progression into the adult
morphology (Uhlirova et al.,
2003). In Bombyx, removal of br results in adult
legs that do not undergo proper leg morphogenesis and therefore have fewer
tarsal segments. Thus, the more-derived Holometabola may have less flexibility
in the sequence of life cycle stages.
Epistasis and evolutionary conservation of partial functional redundancy of br isoforms within holometabolous insects
Our study showed that we needed to remove pairs of br isoforms for
the complete disruption of pupal development. Notably, removal of certain
pairs of isoforms results in phenotypes that are not purely additive, which
suggests an epistatic interaction between these isoforms.
The effects of the loss of isoform-specific br mRNA in
Tribolium suggest that there is partial redundancy in the functions
of the isoforms. Removal of either Br-Z2 or Br-Z3 reduces wing length, and
pupal development is disrupted in a similar fashion when either of these
isoforms is removed with either Br-Z1 or Br-Z4, suggesting that Br-Z2 and
Br-Z3 have partially overlapping functions. Similarly, the pupal phenotypes
resulting from the loss of Br-Z1 or Br-Z4 indicate that these two isoforms are
likely to have similar functions. In Drosophila, Bayer et al.
(Bayer et al., 1997) have found
that Br-Z2 and Br-Z3, as well as Br-Z1 and Br-Z4, have partially overlapping
functions during metamorphosis. Thus, these patterns of isoform overlap appear
to be preserved between beetles and flies.
Based on sequence comparisons, it has been suggested that the different
isoforms of br arose through a series of duplication events
(Spokony and Restifo, 2007),
with Br-Z1 and Br-Z4 having evolved most recently
(Bayer et al., 1996b;
Bayer et al., 2003;
Spokony and Restifo, 2007).
Furthermore, Manduca Br-Z4 has been shown to partially rescue
Drosophila Br-Z1 functions (Bayer
et al., 2003). Thus, the chromosomal arrangement, as well as the
partial redundancy in the function, of these two isoforms has been maintained
throughout the 300 million years that separate beetles and flies. The Br-Z1
and Br-Z4 isoforms, therefore, might have been maintained within the
holometabolous insects through duplication followed by subfunctionalization
(Hughes, 1994; Force et al.,
1998; Spokony and Restifo,
2007) and/or functional diversification
(Ohno, 1970).
Role of br during metamorphosis
In animals given br dsRNA, the larval tissues begin the
transformation to adult tissues directly, but this transformation is never
complete. Significant growth normally occurs during the pupal-adult
transition, but these animals did not have the benefit of this extra molting
period. Hence differentiation was incomplete.
We also observed that the loss of all isoforms of br results in
the redirection of the pupal molt to form a larva-adult intermediate and that
the latter then sometimes molted again to an identical larval-adult
intermediate. This second molt is notable because the adult molt is typically
a terminal one but the larval-adult intermediates clearly have retained an
`immature' neuroendocrine system. This `status quo' molt is typically
associated with JH (Riddiford,
1994). Thus, one possible outcome of br RNAi is that the
prothoracic glands do not degenerate (Zhou
et al., 2004) and that the corpora allata do not fully shut down
as they normally do during the larval-pupal transition. Notably, the gene for
Drosophila allatostatin, which may inhibit JH release, has several
br isoform binding sites (Bowser
and Tobe, 2007). Our preliminary experiments show that the larval
nervous system does not remodel properly in animals given br dsRNAi.
As a result, the animal might maintain an elevated larval-like JH titer in the
larval-adult intermediate that induces a `status quo' molt.
When br-Z1 and br-Z4 were removed in the final larval
stage, the larvae first molted to fairly normal pupae
(Fig. 6), presumably because
br-Z2 and br-Z3 are still functional. They then molted to
adults with patches of pupal cuticle. The reformation of pupal cuticle during
a pupal-adult molt is indicative of JH action in many holometabolous insects
(for a review, see Riddiford,
1994). It also suggests a failure to shut down the JH system if
the proper br isoforms are not expressed.
Possible role of br in the evolution of the holometabolous pupa
The compact form of the homolometabolous pupa is thought to have evolved
from a mobile nymph-like pupa that is seen in more basal holometabolous
insects, such as snakeflies (Grimaldi and
Engel, 2005). It is of interest that the pupae of snakeflies have
larva-like abdomens and adult-like appendages, similar to the phenotypes of
Tribolium `pupae' obtained from the loss of all br, or of
selected br, isoforms. We hypothesize that the removal of br
during the prepupal period in Tribolium recapitulates the ancestral
holometabolous pupal morphology. Given the phenotypes found in the absence of
all isoforms of Br at the onset of metamorphosis described here, we suggest
that the evolution of the time of br expression (heterochrony) or
tissue targets (heterotopy) of the br isoforms may have played an
important role in the evolution of the holometabolous pupa. The evolution of
Br isoform expression during the last larval stage would have led to a
convergence in the development of the abdomen and the development of the
imaginal primordia, leading to a specialized pupal morphology that was
ecologically adaptive.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/3/569/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bayer, C., von Kalm, L. and Fristrom, J. W. (1996a). Gene regulation in imaginal disc and salivary gland development during Drosophila metamorphosis. In Metamorphosis: Postembryonic Reprogramming of Gene Expression in Amphibian and Insect Cells (ed. L. I. Gilbert, B. G. Atkinson and J. R. Tata), pp. 321-361. San Diego: Academic Press.
Bayer, C. A., Holley, B. and Fristrom, J. W. (1996b). A switch in Broad-Complex zinc-finger isoform expression is regulated posttranscriptionally during the metamorphosis of Drosophila imaginal discs. Dev. Biol. 177, 1-14.[CrossRef][Medline]
Bayer, C. A., von Kalm, L. and Fristrom, J. W. (1997). Relationships between protein isoforms and genetic functions demonstrate functional redundancy at the Broad-Complex during Drosophila metamorphosis. Dev. Biol. 187,267 -282.[CrossRef][Medline]
Bayer, C. A., Zhou, X., Zhou, B., Riddiford, L. M. and von Kalm, L. (2003). Evolution of the Drosophila broad locus: The Manduca sexta broad Z4 isoform has biological activity in Drosophila. Dev. Genes Evol. 213,471 -476.[CrossRef][Medline]
Berlese, A. (1913). Intorno alle metamorfosi degli insetti. Redia 9,121 -136.
Bowser, P. R. F. and Tobe, S. S. (2007). Comparative genomic analysis of allatostatin-encoding (Ast) genes in Drosophila species and prediction of regulatory elements by phylogenetic footprinting. Peptides 28, 83-93.[CrossRef][Medline]
Chen, L., Zhu, J., Sun, G. and Raikhel, A. S.
(2004). The early gene Broad is involved in the ecdysteroid
hierarchy governing vitellogenesis of the mosquito Aedes aegypti.
J. Mol. Endocrinol. 33,743
-761.
DiBello, P., Withers, D., Bayer, C. A., Fristrom, J. W. and Guild, G. M. (1991). The Drosophila broad-complex encodes a family of related proteins containing zinc fingers. Genetics 129,358 -397.
Emery, I. F., Bedian, V. and Guild, G. M. (1994). Differential expression of Broad-Complex transcription factors may forecast tissue-specific developmental fates during Drosophila metamorphosis. Development 120,3275 -3287.[Abstract]
Erezyilmaz, D. F. (2006). Imperfect eggs and
oviform nymphs: a history of ideas about the origins of insect metamorphosis.
Integr. Comp. Biol. 46,795
-807.
Erezyilmaz, D. F., Riddiford, L. M. and Truman, J. W.
(2006). The pupal specifier broad directs progressive
morphogenesis in a direct-developing insect. Proc. Natl. Acad. Sci.
USA 103,6925
-6930.
Force, A., Lynch, M., Pickett, F. B., Amores, A., Yan, Y. L. and
Postlethwait, J. (1999). Preservation of duplicate genes by
complementary, degenerative mutations. Genetics
151,1531
-1545.
Grimaldi, D. and Engel, M. S. (2005). Evolution of the Insects. Cambridge: Cambridge University Press.
Heslop-Harrison, G. (1958). On the origin and function of the pupal stadia in holometabolous Insecta. Proc. Univ. Durham. Philos. Soc. Ser. A 13,59 -79.
Hinton, H. E. (1963). The origin and function of the pupal stage. Proc. R. Entomol. Soc. Lond. 38, 77-85.
Hirashima, A., Takeya, R., Taniguchi, E. and Eto, M. (1995). Metamorphosis, activity of juvenile-hormone esterase and alteration of ecdysteroid titers: effects of larval density and various stress on the red flour beetle, Tribolium freemani Hinton (Coleoptera: Tenebrionidae). J. Insect Physiol. 41,383 -388.[CrossRef]
Hughes, A. L. (1994). The evolution of functionally novel proteins after gene duplication. Proc. R. Soc. Lond. B Biol. Sci. 256,119 -124.[Medline]
Hughes, C. L. and Kaufman, T. C. (2002).
Exploring the myriapod body plan: expression patterns of the ten Hox genes in
a centipede. Development
129,1225
-1238.
Ijiro, T., Urakawa, H., Yasukochi, Y., Takeda, M. and Fujiwara, Y. (2004). cDNA cloning, gene structure, and expression of Broad-Complex (BR-C) genes in the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 34,963 -969.[CrossRef][Medline]
Karim, F. D., Guild, G. M. and Thummel, C. S. (1993). The Drosophila Broad-Complex plays a key role in controlling ecdysone-regulated gene expression at the onset of metamorphosis. Development 118,977 -988.[Abstract]
Kiss, I., Beaton, A. H., Tardiff, J., Fristrom, D. and Fristrom,
J. W. (1988). Interactions and developmental effects of
mutations in the Broad-Complex of Drosophila melanogaster.
Genetics 118,247
-259.
Konopova, B. and Jindra, M. (2008).
Broad-Complex acts downstream of Met in juvenile hormone signaling to
coordinate primitive holometabolan metamorphosis.
Development 135,559
-568.
Kristensen, N. P. (1999). Phylogeny of endopterygote insects, the most successful lineage of living organisms. Eur. J. Entomol. 96,237 -253.
Mahroof, R., Yan Zhu, K., Neven, L., Subramanyam, B. and Bai, J. (2005). Expression patterns of three heat shock protein 70 genes among developmental stages of the red flour beetle, Tribolium castaneum (Coleoptera: Tenebrionidae). Comp. Biochem. Physiol. 141A,247 -256.
Mayr, E. (1963). Animal Species and Evolution. Cambridge, MA: Harvard University Press.
Nishita, Y. and Takiya, S. (2004). Structure and expression of the gene encoding a Broad-Complex homolog in the silkworm, Bombyx mori. Gene 339,161 -172.[CrossRef][Medline]
Ohno, S. (1970). Evolution by Gene Duplication. Berlin: Springer-Verlag.
Quennedey, A. and Quennedey, B. (1999). Development of the wing discs of Zophobas atratus under natural and experimental conditions: occurrence of a gradual larval-pupal commitment in the epidermis of tenebrionid beetles. Cell Tissue Res. 296,619 -634.[CrossRef][Medline]
Reza, A. M., Kanamori, Y., Shinoda, T., Shimura, S., Mita, K., Nakahara, Y., Kiuchi, M. and Kamimura, M. (2004). Hormonal control of a metamorphosis-specific transcriptional factor Broad-Complex in silkworm. Comp. Biochem. Physiol. 139B,753 -761.[CrossRef][Medline]
Riddiford, L. M. (1994). Cellular and molecular actions of juvenile hormone I. General considerations and premetamorphic actions. Adv. Insect Physiol. 24,213 -274.
Riddiford, L. M., Truman, J. W. and Cherbas, P. (2000). Ecdysone receptors and their biological actions. Vitam. Horm. 60,1 -73.[Medline]
Spokony, R. F. and Restifo, L. L. (2007). Anciently duplicated Broad Complex exons have distinct temporal functions during tissue morphogenesis. Dev. Genes Evol. 217,499 -513.[CrossRef][Medline]
Truman, J. W. and Riddiford, L. M. (1999). The origins of insect metamorphosis. Nature 410,447 -452.
Truman, J. W. and Riddiford, L. M. (2007). The morphostatic actions of juvenile hormone. Insect Biochem. Mol. Biol. 37,761 -770.[CrossRef][Medline]
Uhlirova, M., Foy, B. D., Beaty, B. J., Olson, K. E., Riddiford,
L. M. and Jindra, M. (2003). Use of Sindbis virus-mediated
RNAi to demonstrate a conserved role of Broad-Complex in insect metamophosis.
Proc. Natl. Acad. Sci. USA
100,15607
-15612.
Yang, A. S. (2001). Modularity, evolvability, and adaptive radiations: a comparison of the hemi- and holometabolous insects. Evol. Dev. 3,59 -72.[CrossRef][Medline]
Zhou, B. and Riddiford, L. M. (2001). Hormonal regulation and patterning of the Broad Complex in the epidermis and wing discs of the tobacco hornworm, Manduca sexta. Dev. Biol. 231,125 -137.[CrossRef][Medline]
Zhou, B., Hiruma, K., Shinoda, T. and Riddiford, L. M. (1998). Juvenile hormone prevents ecdysteroid-induced expression of Broad Complex RNAs in the epidermis of the tobacco hornworm, Manduca sexta. Dev. Biol. 203,233 -244.[CrossRef][Medline]
Zhou, X. and Riddiford, L. M. (2002).
Broad-Complex specifies pupal development and mediates the prevention of the
pupal-adult transformation by juvenile hormone in Drosophila and
Manduca. Development
129,2259
-2269.
Zhou, X., Zhou, B., Truman, J. W. and Riddiford, L. M.
(2004). Overexpression of broad: a new insight into its
role in the Drosophila prothoracic gland cells. J. Exp.
Biol. 207,1151
-1161.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Liu, Z. Sheng, H. Liu, D. Wen, Q. He, S. Wang, W. Shao, R.-J. Jiang, S. An, Y. Sun, et al. Juvenile hormone counteracts the bHLH-PAS transcription factors MET and GCE to prevent caspase-dependent programmed cell death in Drosophila Development, June 15, 2009; 136(12): 2015 - 2025. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Konopova and M. Jindra Broad-Complex acts downstream of Met in juvenile hormone signaling to coordinate primitive holometabolan metamorphosis Development, February 1, 2008; 135(3): 559 - 568. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
