|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online January 11, 2008
doi: 10.1242/10.1242/dev.013763
-initiated PI3K activation and migration of somite derivatives leads to spina bifidaDepartment of Molecular Biology, The University of Texas Southwestern Medical Center at Dallas, Dallas, TX 75390, USA.
* Author for correspondence (e-mail: michelle.tallquist{at}utsouthwestern.edu)
Accepted 2 November 2007
| SUMMARY |
|---|
|
|
|---|
results in spina bifida, but the underlying mechanism has not been identified.
To elucidate the cause of this birth defect in PDGFR
mutant embryos, we
examined the developmental processes involved in vertebrae formation. Exposure
of chick embryos to the PDGFR inhibitor imatinib mesylate resulted in spina
bifida in the absence of NTDs. We next examined embryos with a tissue-specific
deletion of the receptor. We found that loss of the receptor from chondrocytes
did not recapitulate the spina bifida phenotype. By contrast, loss of the
receptor from all sclerotome and dermatome derivatives or disruption of
PDGFR
-driven phosphatidyl-inositol 3' kinase (PI3K) activity
resulted in spina bifida. Furthermore, we identified a migration defect in the
sclerotome as the cause of the abnormal vertebral development. We found that
primary cells from these mice exhibited defects in PAK1 activation and
paxillin localization. Taken together, these results indicate that
PDGFR
downstream effectors, especially PI3K, are essential for cell
migration of a somite-derived dorsal mesenchyme and disruption of receptor
signaling in these cells leads to spina bifida.
Key words: Spina bifida, PDGF, PI3 kinase, Cell migration, S6K1, PAK1, Mouse, Chick
| INTRODUCTION |
|---|
|
|
|---|
and PDGF
ligand null and mutant alleles have clearly demonstrated that loss of
PDGFR
signaling results in spina bifida, but the cellular basis
responsible for these defects has remained elusive
(Ding et al., 2004
is broadly expressed in mesenchymal populations during
embryonic development, and complete loss of the receptor affects cells in many
tissues and causes early embryonic lethality. Therefore, the reduced viability
of later gestation embryos prohibits the study of spina bifida in these
mutants.
More recently, analysis of a series of signaling point mutant alleles in
the PDGFR
demonstrated that loss of PI3K signaling downstream of the
receptor also resulted in spina bifida
(Klinghoffer et al., 2002
).
These mice live until birth, providing a means to investigate the cause of
spina bifida in a PDGFR
mutant background. In addition to vertebral
defects, mislocalization of oligodendrocytes and melanocytes hinted that loss
of PI3K activation downstream of PDGFR
may result in aberrant cell
migration. Although stimulation of PDGF receptors can induce cytoskeletal
rearrangements and cell migration in vitro, few studies have demonstrated a
clear requirement for PDGF receptor-driven cell migration in vivo. In
Xenopus embryos, PDGFR
directs mesoderm towards the blastocoel
roof and disruption of this signaling pathway leads to randomized movement of
cells (Nagel et al., 2004
). In
Drosophila, PVR, a receptor tyrosine kinase related to the mammalian
PDGF and VEGF receptors, directs border cell migration to the oocyte
(Duchek et al., 2001
) and
hemocyte migration (Wood et al.,
2006
).
In this report, we demonstrate that normal vertebral arch formation
requires PDGFR
signal transduction. Surprisingly, the cells dependent
on this receptor are not chondrocytes. Using mice defective in
PDGFR
-initiated PI3K (PDGFR
PI3K/PI3K) signaling and
lacking PDGFR
from a broad range of somite cells, we demonstrate that
proliferation and survival of this somite-derived population are unaffected.
Instead, cell migration is defective. We further show that cells derived from
mutant embryos fail to activate pathways implicated in actin reorganization
and migration. PDGFR
PI3K/PI3K mutant cells fail to activate
Pak1, Rac1 and S6K1 in response to PDGF stimulation. These signaling
disruptions result in loss of paxillin localization to focal contacts. These
findings demonstrate that a somite-derived cell population requires
PDGFR
-induced PI3K activity for migration in vivo and that the presence
of other PDGFR
signaling pathways cannot bypass the requirement for
PI3K activation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mice
The mutant and Cre alleles used in these experiments were:
PDGFR
PI3K/PI3K
(Klinghoffer et al., 2002
),
PDGFR
GFP
(Hamilton et al., 2003
),
PDGFR
fl
(Tallquist and Soriano, 2003
),
Twist2Cre (Yu et al.,
2003
), and Col2a1-CreTg
(Ovchinnikov et al., 2000
).
The Twist2Cre line was kindly provided by E. Olson. The
Col2a1-CreTg mice were kindly provided by G. Karsenty.
Embryos possessing a tissue-specific deletion of the PDGFR
were
generated by crossing males (PDGFR
fl/+;
Cre+) to females homozygous for the
PDGFR
fl/fl.
Cell culture
Mesenchymal cells were isolated from the thoracic and lumbar regions of
E13.5 embryos by removing surface ectoderm, neural tube, dorsal root ganglia
and vertebral column components. Remaining tissue was rinsed extensively with
PBS and dispase (Roche, Basel, Switzerland) treated (0.5 mg/ml for 10 minutes
at 37°C) to form a single cell suspension. Single cell suspensions were
rinsed with PBS then plated. Cultures containing PDGFR
GFP
alleles were scored for GFP-expression as a marker of PDGFR
-expression.
Passage 1 cultures were 90% (±3%) GFP+ (n=4).
Passage 4 cultures were 89% (±4%) GFP+ (n=5).
Marker analysis (Twist2 for dermatome and dermis; Col2a1 and scleraxis for
sclerotome and chondrocytes) was performed by RT-PCR to confirm cell culture
identity and purity. Cultures were positive for Twist2, negative for Col2a1
and scleraxis. RNA was extracted by Trizol (Invitrogen, Carlsbad, CA) and cDNA
was generated using PowerScript Reverse Transcriptase (Clontech, Mountain
View, CA).
Migration
Primary cells in single suspension were plated in triplicate at a density
of 4x104 cells per well in a 96-well chemotaxis chamber
(NeuroProbe), on a filter (8 µm pore size, PVP-free) pre-treated for 1 hour
with 10 µg/ml rat tail collagen (Sigma, St Louis, MO). Growth factors were
added to the bottom wells at the indicated concentrations. PDGFAA, PDGFBB and
pTGFβ1 ligands were obtained from R&D Systems; bFGF was from Sigma.
Long-term rapamycin treatment (22 µM, Sigma) was 48 hours before plating
cells in the chemotaxis chamber at 1x104 cells per well. For
short-term rapamycin treatment, cells were plated in the chemotaxis chamber at
2x104 cells per well in rapamycin (44 µM, Sigma) or
vehicle. After addition of cells and growth factors, the migration chamber was
incubated at 37°C for 6 hours. Each experiment was performed at least
twice with independent cell lines, and each condition was assayed in
triplicate.
Histological procedures and skeletal staining
For H&E and Safranin-O staining, embryos were fixed in 4%
paraformaldehyde at 4°C overnight, embedded in paraffin, sectioned at a
thickness of 7 µm, and stained according to standard procedures. Skeletal
preparations were performed according to
(Hogan, 1994
). For green
fluorescent protein (GFP) expression, embryos were fixed in 4% PFA overnight,
saturated in 10% sucrose at 4°C overnight, embedded in OCT and sectioned
at 10 µm. For BrdU analysis, pregnant females were injected with 10 µg
BrdU (Sigma) per gram of body weight 1 hour prior to sacrifice. Embryos were
fixed and sectioned as described above. BrdU was detected by anti-BrdU (Becton
Dickinson, Franklin Lakes, NJ) primary antibody (1:50 dilution in block).
Cell number, proliferation and TUNEL index
Images of high-quality sections through the lumbar region were taken at
40x. For all quantification, the region that was quantified was
demarcated by a box of consistent width that extended below the surface
ectoderm to the perineural plexus) in three sections for each embryo. Cells
were identified by the nuclear hematoxylin-QS counterstain (Vectastain). One
embryo for each genotype at each time point was examined. Cells were counted
in the region dorsal to the neural tube. Proliferation index was calculated by
dividing the number of BrdU-positive cells by the total number of cells within
the boxed area and multiplying by 100. TUNEL index was performed by standard
procedures using biotinylated-14-dATP and detected using the streptavidin-HRP
and DAB (Vectastain) kits. The TUNEL index was calculated by dividing the
number of TUNEL-positive cells by the total number of cells in the demarcated
region. No TUNEL-positive cells were detected in this region although TUNEL
positive cells could be found in other tissues of the embryo. We also
performed the assay on a positive control (DNAse I treated section) to verify
the detection of fragmented DNA.
Micromass culture analysis
Limb buds isolated from E11.5 embryos were rinsed extensively with PBS,
dispase treated (1 U/ml for 30 minutes at 37°C), rinsed and dispersed to
make a single cell suspension. Cells were plated in 25 µl droplets at a
density of 1x107 cells/ml of basal media (DMEM with 2% serum)
and incubated at 37°C for 1 hour. Wells were flooded with basal media.
After 24 hours, conditioned media (1:1) and growth factors (concentrations as
indicated) were added. Growth factor and conditioned media treatments were
performed in triplicate. Conditioned media was harvested from cells cultured
in 10% serum at density of 5x105 cells per well after 24
hours. Micromass cultures were fixed in ethanol after 5 or 7 days of culture,
and chondrocyte nodules were stained with 1% Alcian Blue. Stained cultures
were rinsed with 3% acetic acid to remove excess stain. Alcian Blue was
extracted with 300 µl 4 M guanidine-HCl. Extracted Alcian Blue was measured
by OD600 (Amersham Biosciences GeneQuant pro spectrophotometer).
The 4- to 5-day culture was repeated three times, and the 7-day culture was
repeated twice.
Western blot
For western blot analysis, cells were starved (in DMEM with 0.1% serum) for
48 hours, then stimulated with 10 ng/ml PDGF-AA or 10% serum for 5 minutes.
Whole cell lysates were run on 7.5% SDS-PAGE and transferred to PVD membranes.
Rac1 pull downs were performed as previously described
(del Pozo et al., 2000
). Cells
were plated at 1x106 cells per 10 cm dish and then starved
for 24 hours in 0.1% serum. After starvation, cells were stimulated with
either 10% serum or 25 ng/ml PDGFAA for 2-20 minutes. Following stimulation,
cells were washed with ice cold PBS prior to lysis. Lysis buffer (400 µl)
plus aprotinin (Sigma, A6279-5ML) and PMSF were added. GTP-bound Rac1 was then
isolated using the Rac1 activation kit (Upstate, Billerica, MA, 17-283).
Immunocytochemistry
GFP-expressing cells were plated for 24 hours in 1% FBS in DMEM. Cells were
stimulated for 10 minutes with either 10% serum containing media or 10 ng/ml
PDGFAA. PDGFR
PI3K/PI3K and control cells
were plated overnight and then starved in 0.1% serum for 6 hours. After
starvation cells were stimulated for 10 minutes with either 10%
serum-containing media or 25 ng/ml PDGFAA. Cells were then fixed in 3%
paraformaldehyde, permeablized, blocked and stained for paxillin (BD
Transduction Laboratories, Franklin Lakes, NJ, 51-9002034) at a dilution of
1:400. Secondary antibody was donkey anti-mouse 594 (Molecular Bioprobes,
Carlsbad, CA). Cells were imaged on a Zeiss Axiovert 200 microscope.
Antibodies
Cytoskeletal actin loading control (Novus, Littleton, CO 1:5000),
AKT-p(Ser473) (Cell Signaling, Danvers, MA 1:1000), AKT (Cell Signaling,
1:1,000), FAK (Cell Signaling, 1:1000), FAK-p(Tyr576/577) (Cell Signaling,
1:1000), MAPK-p(P44,42) (Cell Signaling, 1:5000), MAPK (Cell Signaling,
1:2500), PAK1 (Cell Signaling, 1:1000), PAK1-p(Ser199/204) (Cell Signaling,
1:1000), PAK1-p(Thr423) (Cell Signaling, 1:1000), PDGFR
(Santa Cruz,
Santa Cruz, CA 1:333), p70S6K-p(Thr389) (Cell Signaling, 1:1000) and p70S6K
(Cell Signaling, 1:1000).
In situ hybridization
Embryos were fixed in 4% PFA overnight, saturated in 10% sucrose at 4°C
overnight, embedded in OCT, and sectioned at 14 µm. In situ analyses were
performed as previously described
(Wilkinson, 1992
).
RT-PCR primers
Twist2: forwards, CAGAGCGACGAGATGGACAATAAG; reverse
GGTTGGTCTTGTGTTTCCTCAGG. Col2a1: forwards, TATGGAAGCCCTCATCTTGCCG; reverse,
TCTTTTCTCCCTTGTCACCACG. Scleraxis: forwards, TTCTCACCTGGGCAATGTGC; reverse
AGTGTTCGGCTGCTTAGAGTCAAG.
| RESULTS |
|---|
|
|
|---|
spina bifida phenotype
-null embryos
(Soriano, 1997
|
from cartilage does not result in spina bifida
is expressed in the epithelial somite but
becomes restricted to a subset of cells, including the perichondrium, the
condensing mesenchyme surrounding the vertebral arch and the dermis
(Hamilton et al., 2003
signaling. Using a PDGFR
allele that is flanked by loxP sites
(Tallquist and Soriano, 2003
in distinct somitic cell populations. Embryos deficient in
PDGFR
in vertebral cartilage populations were generated using
Col2a1-CreTg mice
(Ovchinnikov et al., 2000
CKO). In these
embryos, Cre is expressed in the sclerotome as early as E9.5 and results in
recombination of loxP-flanked alleles in all cartilage and
perichondrium of the axial skeleton (Day
et al., 2005
TKO). In this mouse line, Cre is
expressed in the sclerotome condensing mesenchyme, the dermatome and
osteoblasts. Finally, we also examined vertebral development in embryos
expressing a PDGFR
that was incapable of signaling through PI3K
(PDGFR
PI3K/PI3K) and had been previously
reported to exhibit spina bifida
(Klinghoffer et al., 2002
that normally binds PI3K, resulting in a loss of this signaling
pathway downstream of the receptor.
Examination of skeletal preparations at E18.5 demonstrated that loss of
PDGFR
in chondrocytes resulted in normal formation and closure of the
vertebrae (Fig. 2B) when
compared with controls (Fig.
2A), although 100% of these mice died at birth from a clefting of
the secondary palate similar to mice with neural crest cell deletion of the
receptor (Tallquist and Soriano,
2003
). This suggests that deletion of PDGFR
occurred in chondrocyte populations, but that loss of the receptor in
vertebral chondrocytes and perichondrium did not affect its development. By
contrast, defects were observed in the dorsal-most sclerotome derivatives in
PDGFR
TKO and
PDGFR
PI3K/PI3K embryos. In the lumbar
region, the progression of the lamina was significantly impeded, and the
spinous process was absent (Fig.
2C,D). This phenotype was specific to the lumbar vertebrae (L1-L6)
and sometimes included the immediate surrounding thoracic (T10-13) and sacral
(S1-2) vertebrae. In all embryos examined, the vertebral bodies, vertebral
arches, pedicles, ribs and appendicular skeleton developed normally
(Fig. 2 and data not shown).
When postnatal day 1 (P1) PDGFR
TKO mice
were recovered, we observed protrusion of the spinal cord through the opening
in the vertebrae (data not shown). This suggested that during the process of
birth, constriction of the embryo caused the spinal cord to emerge between the
open vertebrae, resulting in subcutaneous myelomeningocele (or spina bifida
aperta). Because of the distinct phenotypes of the
PDGFR
CKO and the
PDGFR
TKO embryos, we conclude that the defect in
lamina development does not result from a primary abnormality in perichondrium
or chondrocytes. Instead, the defect was probably caused by a loss of
PDGFR
signaling in a somite cell population other than
chondrocytes.
|
TKO and
PDGFR
PI3K/PI3K embryos throughout
gestation for neural tube closure and found that the neural tube had a normal
morphology and closed at the expected time point
(Fig. 3B and data not shown).
To identify when the defect in vertebral development appeared, we examined the
lumbar region by H&E and Safranin O (cartilage) staining between E14.5 and
E16.5 (Fig. 3A-J and data not
shown). At E14.5, control, PDGFR
PI3K/PI3K
and PDGFR
TKO embryos appeared similar
(Fig. 3A,B), but by E15.5,
defects in vertebral development were observed
(Fig. 3E,F,I-L). In wild-type
embryos, the chondrocytes expanded along the dorsal aspect of the neural tube,
but in mutant embryos small condensations of unstained mesenchyme were
observed (Fig. 3E,F). By E16.5,
mesenchymal condensations could be identified, but the area was dramatically
reduced in size and did not stain with Safranin O
(Fig. 3 I-J). Using collagen
type 2a1 as an earlier marker for chondrocyte progenitors and chondrocytes, we
found that the precursors of the lamina were present, but they failed to
extend towards the dorsal midline (see Fig. S1A in the supplementary
material). Examination of cells dorsal to the neural tube revealed an increase
in cell density between E14.5 to E15.5 in the wild type but not in the mutant
(Fig. 3C,D,G,H; see Table S1 in
the supplementary material). When we examined the lumbar region of E18.5
PDGFR
TKO embryos, we found a similar
result. Although the skin was similar to control sections with regards to
epidermis, dermis and subcutis formation, the lamina and the adjacent dense
mesenchyme were absent (Fig.
3K,L). These data demonstrate that the defect in the vertebral
arch formation in the PDGFR
PI3K/PI3K and
PDGFR
TKO embryos occurred after E14.5 and
specifically affected the lamina of the lumbar vertebrae.
Mesenchymal cell-secreted factors promote chondrogenesis
Previous reports suggest that growth factor secretion from adjacent tissues
may affect the development of the dorsal vertebrae
(Boyd et al., 2004
). To
investigate the possibility that loss of PDGFR
signaling negatively
affected expression of chondrocyte growth factors, we isolated primary cells
from the lumbar region of E13.5 control,
PDGFR
PI3K/PI3K and
PDGFR
TKO embryos (see Materials and
methods) and compared their abilities to promote chondrogenic growth and
differentiation in a limb bud micromass culture system. In this assay,
undifferentiated limb bud mesenchyme is stimulated with conditioned media from
primary cells. Because the limb bud mesenchyme is capable of cartilage
differentiation in vitro, one can determine whether secreted factors, such as
growth factors or extracellular matrix, in conditioned media are capable of
enhancing the chondrocyte differentiation
(Stott and Chuong, 2000
). We
found that conditioned media from both wild-type and PDGFR
mutant cells
(TKO and PI3K/PI3K) were capable of inducing the production of cartilage
proteoglycans, similar to stimulation with TGFβ1, as measured by Alcian
Blue binding (see Fig. S2 in the supplementary material). To determine whether
chondrocyte induction was specific to primary mesenchymal cells, we also
tested conditioned media from mouse embryonic fibroblasts (MEF) and HEK293T
epithelial cell lines. MEF-conditioned media promoted chondrocyte
differentiation, whereas HEK293T conditioned media induction was similar to
control media. These data indicate that disruption of PDGFR
signaling
does not alter the secretion of factors enhancing chondrocyte
differentiation.
Disrupted sclerotome migration in PDGFR
mutant embryos
A major function of the PDGFR
during development is to promote the
proliferation of progenitor cell populations
(Betsholtz, 2003
). To determine
whether a proliferation defect was the cause of the aberrant vertebral
formation, we compared proliferation of control,
PDGFR
TKO and
PDGFR
PI3K/PI3K embryos. All exhibited
similar rates of proliferation in comparable regions of the neural arch, as
well as the loose sclerotome cells adjacent to the developing vertebrae and
the dermis (see Fig. S3 in the supplementary material). We also investigated
the proliferation of primary cells from E13.5 embryos and found that whereas
control and PDGFR
PI3K/PI3K cells
proliferated in response to media containing 10% serum, neither cell type
proliferated in response to PDGFAA stimulation (data not shown). Thus, in
contrast to many other cell populations that rely upon PDGFR
signal
transduction for proliferation, sclerotome is unaffected by loss of the
receptor.
Because we had noted a specific decrease in the cell population dorsal to
the neural tube, we examined the expansion of this cell population in the
lumbar region during vertebral development. Between E14.5 and E15.5 control
embryos demonstrated an expansion in the total number of cells present,
whereas PDGFR
PI3K/PI3K cells showed little
increase (see Table S1 in the supplementary material). To determine whether
the failure in expansion of this cell population was caused by reduced
proliferation or increased apoptosis, we quantified the number of cells
incorporating BrdU and the number staining with TUNEL labeling. We found that
there was no significant difference in the number of TUNEL-positive cells or
in the proliferation index of cells dorsal to the neural tube (see Table S1 in
the supplementary material), suggesting that cell survival and proliferation
in this region are normal in the
PDGFR
PI3K/PI3K embryos.
|
, we examined embryos that expressed GFP from the
PDGFR
locus (PDGFR
GFP)
(Hamilton et al., 2003
-expressing cells in the lumbar region. The most abundant receptor
expression was in the mesenchyme surrounding developing vertebrae and in the
dermis. Receptor expression was also present in the perichondrium, but only a
low expression level was observed in the developing chondrocytes
(Fig. 4A). A similar expression
pattern has been reported previously for PDGFR
transcripts
(Payne et al., 1997
(GFP+) cells had migrated to the dorsal neural
tube. The outer cell population was probably dermis, whereas the cells
adjacent to the neural tube were connective mesenchyme derived from somites
(see Fig. S1D in the supplementary material).
These observations suggested that failure in migration of
PDGFR
-expressing cells might lead to the observed reduction in cells in
the dorsal region of the embryo. Comparison of sections through control
PDGFR
GFP/+ embryos and
PDGFR
mutant embryos further supported this possibility. In
control embryos, the mesenchyme immediately adjacent to the forming arch had
advanced to the extent of the tip of the vertebral arch. By contrast, in
PDGFR
GFP/PI3K embryos GFP+
cells were present lateral to the vertebral arch, but the majority of
GFP+ cells had not advanced even half the distance of the vertebral
arch (Fig. 4B). This effect was
even more pronounced when we examined GFP+ cells in
PDGFR
TKO/GFP embryos
(Fig. 4C). At E16.5, a stage
when vertebral arch development is halted in the mutant animals, we find a
cluster of GFP+ cells dorsal to the developing vertebral arches in
the lumbar region of PDGFR
TKO/GFP embryos
(see Fig. S1D,E in the supplementary material). These results suggest that
PDGFR
signaling is likely to be required for migration of this somite
cell population. Furthermore, because these cells are capable of secreting
chondrogenic factors (as demonstrated in the micromass assay), failure of
these cells to migrate could result in disrupted vertebral development.
To examine the ability of PDGF receptor stimulation to induce migration, we
tested primary cells from embryos whose genotypes were either
PDGFR
PI3K/GFP or
PDGFR
GFP/+ in a modified Boyden chamber
assay. Cells isolated from wild-type embryos migrated towards PDGF ligands and
serum. By contrast, mutant cells had a reduced ability to migrate towards
PDGFAA and PDGFBB (Fig. 4D) but
were still capable of migration induced by other stimuli. These results
indicate that loss of PI3K signals downstream of the PDGFR
lead to a
defect in cell motility.
Normal Ras/MAPK and FAK activation but aberrant Akt and S6K1 phosphorylation in PDGFR
PI3K/PI3K cells
Generation of PtdIns(3,4,5)P3 by PDGFR
-initiated
PI3K activity leads to activation of multiple downstream pathways. We examined
how efficiently these pathways were disrupted in
PDGFR
PI3K/PI3K cells by western blot. Both mutant and
wild-type cells expressed similar levels of PDGFR
(Fig. 5A). However, we found
that phosphorylation of Akt on S473 and p70S6 kinase (S6K1) on T389 was
drastically reduced in the PDGFR
PI3K/PI3K cells in response
to PDGFAA stimulation (Fig.
5B). Loss of phosphorylation of both of these effectors confirmed
that the PI3K pathway was inactive in PDGF stimulated
PDGFR
PI3K/PI3K cells. By contrast, MAPK
phosphorylation of S6K1 (T421/S424) was similar in control and
PDGFR
PI3K/PI3K cells in response to PDGFAA
and 10% serum (data not shown). We then examined the activation status of
other key motility pathways downstream of the PDGFR
. The Ras effectors
ERK1/2 have been associated with establishment of pseudopodia and focal
adhesions during chemotaxis (Brahmbhatt
and Klemke, 2003
; Fincham et
al., 2000
). Therefore, we determined whether ERK1/2 activation was
disrupted in the PDGFR
PI3K/PI3K cells. We
found that phosphorylation of these proteins was comparable in mutant and
control samples (Fig. 5A).
These data are in agreement with previous analysis of MEF cells isolated from
the PDGFR
PI3K/PI3K embryos that suggest
the PI3K mutation does not disrupt other signaling pathways downstream of the
PDGFR
(Klinghoffer et al.,
2002
). Activation of focal adhesion kinase (FAK) in response to
Src phosphorylation has also been demonstrated to be important for migration
(reviewed by Hanks et al.,
2003
; Parsons,
2003
). Similar to ERK1/2 activation, we observed no differences in
FAK phosphorylation between wild-type and
PDGFR
PI3K/PI3K cells
(Fig. 5A). These data support
the idea that disruption of pathways directly downstream of PI3K activity is
the cause of the motility defect and that other downstream pathways, such as
Src and MAPK, remain intact.
|
PI3K/PI3K cells, we next examined the
consequence of disrupting the mTOR pathway during PDGFR
-stimulated
migration. To accomplish this we treated wild-type primary, somite-derived
mesoderm cells with rapamycin and determined their ability to migrate towards
PDGFAA. We observed a loss of motility in response to PDGFAA, bFGF and
TGFβ1 stimulation (see Fig. S4A in the supplementary material). By
contrast, rapamycin had no effect on the migration of these cells towards
serum. Interestingly, migration was inhibited regardless of the treatment
time, either 24 hours prior to migration or during the migration assay (see
Fig. S4B in the supplementary material).
PI3K activity at the cell membrane leads to translocation and activation of
a variety of proteins at the cell surface, including
phosphoinositide-dependent kinase 1 (PDK1), Akt and mTOR. One of the
downstream effectors of these signals is Rac1, which is important for
cytoskeletal organization. We therefore tested the ability of
PDGFR
PI3K/PI3K cells to activate Rac1. We
found that Rac1 activation occurred as early as 1 minute after stimulation and
persisted up to 20 minutes in PDGFAA stimulated wild-type cells
(Fig. 6A). By contrast, the
amount of active Rac1 did not increase above background when we stimulated
PDGFR
PI3K/PI3K cells with PDGFAA
(Fig. 6A), but we were able to
recover activated Rac1 in response to stimulation by serum
(Fig. 6A). We next investigated
a downstream effector of activated Rac1: p21-activated kinase (Pak1). Pak
proteins are serine/threonine kinase effectors of Rho family GTPases
(Dharmawardhane et al., 1997
;
Sells et al., 1997
). Upon Rac1
binding, Pak1 becomes autophosphorylated on S199 and T204. Using a
phosphospecific antibody to these sites, we found that Pak1
autophosphorylation did not occur in
PDGFR
PI3K/PI3K cells stimulated with
PDGFAA (Fig. 5C). Because Pak1
can also be directly phosphorylated on T423 by PDK1 downstream of PI3K
activity, we investigated this event via western blot and observed a lack of
phosphorylation on T423 in response to PDGF stimulation in
PDGFR
PI3K/PI3K cells
(Fig. 5C). By contrast, when
these same cells are stimulated with serum containing media, we observe
phosphorylation of Pak1 at both the autophosphorylation site and the PDK1
site, demonstrating that other signaling pathways could still activate these
pathways. These data demonstrate that PDGFR
association with PI3K leads
to Pak1 phosphorylation, and suggest that failure of this activation may
result in defective migration.
Finally, because we observed profound motility defects in the mutant cells,
we examined the ability of the PDGFR
mutant cells to form focal
contacts and reorganize actin in response to PDGFAA stimulation. Paxillin is a
multidomain protein that localizes to focal contacts and is a docking site for
many regulators of actin dynamics (Brown
and Turner, 2004
). Using cells derived from
PDGFR
TKO that were heterozygous for the
PDGFR
GFP allele, we found that control and
mutant cells localized paxillin to the cellular periphery when stimulated with
media containing 10% serum (Fig.
6B). In cells stimulated with PDGFAA, we found control cells
possessed localized regions of intense paxillin staining, but mutant cells
appeared similar to unstimulated cells. We next examined paxillin localization
in PDGFR
PI3K/PI3K cells. Analogous to what
we observed in the PDGFR
-deficient cells, paxillin localized to
cellular protrusions in control cells upon PDGF stimulation, but failed to
localize in the PDGFR
PI3K/PI3K cells
(Fig. 6B). Taken together,
these data indicate the PDGFR
-mediated migration and cytoskeletal
rearrangement is dependent on PI3K signal transduction.
|
|
| DISCUSSION |
|---|
|
|
|---|
mutant mice was a defect in a non-sclerotome somite
cell population and that neural tube defects did not precede the spina bifida.
The failure of this cell population to migrate towards the dorsal neural tube
halted further development of vertebral elements in the lumbar region. We also
showed that migration of these cells was directed by PI3K signaling downstream
of the PDGFR
. Similar to a requirement for PI3K signaling downstream of
the PDGFRβ (Aoki et al.,
2001
PI3K/PI3K cells resulted in failure
in activation of Akt (this report)
(Klinghoffer et al., 2002
, and signaling through Src and MAPK pathways does not compensate
for loss of PI3K.
Until now, the cause of spina bifida in PDGFR
mutant mice
has been unclear. The difficulty in identifying the etiology of this defect
previously has been the requirement of PDGFR
in many tissues in the
developing embryo. Using chick embryos, as well as conditional and hypomorphic
PDGFR
mouse lines, we have been able to define the cell
population responsible for spina bifida, as well as identifying a potential
cellular function mediated by the receptor. The imatinib-treated chick embryos
most closely resembled spina bifida occulta, whereas defects in the mutant
mouse embryos were similar to spina bifida aperta. We attribute this
difference to the fact that, in the mouse, a genetic lesion exists, whereas,
in the chick, a single treatment of the PDGF receptor inhibitor was the
inducing factor. One surprising outcome of our data is the limited region of
vertebrae affected by disruption of PDGFR
signaling. In both the
imatinib-treated embryos and the genetic disruption of the receptor, defects
were limited to the lumbar region and the immediately adjacent thoracic and
sacral vertebrae. This is in striking contrast to the vertebral defects
reported for PDGFR
-null alleles
(Morrison-Graham et al., 1992
;
Payne et al., 1997
;
Soriano, 1997
). In these mouse
lines, defects occur along the entire length of the vertebral column. One
explanation for the disparity in the phenotypes is that the
PDGFR
-deficient mutants may have mesodermal hypoplasia and
exhibit surface ectoderm detachment
(Morrison-Graham et al., 1992
;
Orr-Urtreger et al., 1992
;
Soriano, 1997
). These
disruptions may cause a more global defect in cell organization, survival and
growth factor production. Therefore, complete loss of PDGFR
signaling
during embryogenesis may affect many cell populations leading to more severe
disruption of somite morphogenesis, vasculature or even neural tube
closure.
Our observations are in agreement with studies in the avian system that
investigated the formation of the dorsal vertebrae. These experiments
suggested that signaling of sonic hedgehog and BMP4 from the dorsal ectoderm
and roof plate of the neural tube directed a superficial somite cell
population to form the dorsal vertebrae
(Monsoro-Burq et al., 1994
;
Monsoro-Burq et al., 1996
;
Monsoro-Burq and Le Douarin,
2000
; Watanabe et al.,
1998
). Although our data support the idea that a somite-derived
dorsal mesenchyme is required for chondrocyte development, the lack of
phenotype in the PDGFR
CKO suggests an
indirect role for PDGFR
signaling in vertebrae development. Chick/quail
chimeras have indicated that both the dorsal chondrocyte and mesenchymal cell
population arise from the ventral half of the somite
(Christ et al., 2004
).
Therefore, the dorsal mesenchyme population is derived from the same area of
the somite as the vertebral derivatives, and is also required in this
signaling paradigm. The ability of soluble factors from non-chondrocyte dorsal
mesenchyme to stimulate chondrogenesis supports the possibility that
coordinated migration of mesenchymal cells alongside the developing vertebral
arches plays a role in the development of the vertebral arch. There are
multiple growth factors that could be involved in regulating the chondrocyte
growth and differentiation. It is clear from a number of studies that normal
bone development often requires a balance of growth factor signals
(Naski and Ornitz, 1998
). In
many circumstances, either an excess or a deficiency in growth factor
signaling can lead to impaired development. The factor(s) secreted by the
mesenchymal cell population could be either a growth factor or a growth factor
inhibitor (Day et al., 2005
;
Hung et al., 2007
). Although
it is possible that the secreted molecule is a growth factor, we cannot rule
out the possibility that these cells may also be depositing extracellular
matrix components such as collagens, matrix proteoglycans and matrix
metalloproteases that also have a demonstrated role in bone growth and
morphogenesis (Blair et al.,
2002
; Lee, 2006
;
Malemud, 2006
).
In vitro, PDGF receptors direct multiple cellular activities including
proliferation, survival, actin reorganization and motility (reviewed by
Heldin and Westermark, 1999
),
and in Xenopus and Drosophila, PDGF receptor homologs are
required for migration of several cell populations
(Cho et al., 2002
;
Duchek et al., 2001
;
McDonald et al., 2003
;
Nagel et al., 2004
). Although
migration signals downstream of PDGF receptors have been implicated in the
mouse (Abramsson et al., 2007
;
Klinghoffer et al., 2002
;
Richarte et al., 2007
), it is
often difficult to separate proliferation from migration defects (reviewed by
Hoch and Soriano, 2003
).
Although the PDGFRβ seems to consistently promote cell motility in
multiple cell types, the ability of PDGFR
to regulate chemotaxis has
proven to be a cell type-dependent phenomenon (reviewed by
Ronnstrand and Heldin, 2001
).
In some cells, such as NIH and Swiss 3T3 cells, PDGFR
stimulation
induces cell motility (Hosang et al.,
1989
; Rosenkranz et al.,
1999
), whereas in endothelial and vascular smooth muscle cells,
PDGFR
activation represses migratory signals from other receptors
(Koyama et al., 1992
;
Yokote et al., 1996
). Our
results suggest a primary role for the PDGFR
in promoting migration of
this somite-derived population. By contrast, cells that are destined to become
dermis that also express PDGFR
migrated appropriately in the
PDGFR
mutants investigated. Therefore, during development PDGF
receptors are likely to play distinct roles in promoting cellular functions,
and each cell type must be examined individually to define the role of the
receptor.
In mammals, PI3K signaling has been linked to many cellular outcomes,
including growth, metabolism, survival and migration
(Fruman et al., 1998
). Loss of
all PI3K p85 regulatory subunits results in embryonic lethality and a
phenotype strikingly similar to complete loss of PDGFR
, and cells from
these p85 mutant embryos failed to form membrane ruffles in response to PDGF
(Brachmann et al., 2005
). Now,
we have shown that the loss of this signaling pathway renders a specific
population of cells incapable of migration during embryogenesis, even though
PDGFR
PI3K/PI3K mutant cells retained the
ability to signal through Src and MAPK. The cellular outcome of PI3K signaling
not only depends on the receptor promoting it, but also depends on the cell
type responding to it. For example, disruption of PI3K activation downstream
of the Kit receptor resulted in a block in differentiation of gametes, and
mast cell and melanocyte migration were unperturbed
(Blume-Jensen et al., 2000
;
Kissel et al., 2000
). In
Drosophila the PDGF-related receptor PVR guides border cell migration
in a PI3K-independent manner, suggesting that PDGF receptors may use different
signals depending on the developmental context
(Bianco et al., 2007
). Mice
deficient in PI3K signaling downstream of the PDGFRβ displayed reduced
interstitial fluid homeostasis but no apparent defect in pericyte migration
(Heuchel et al., 1999
;
Tallquist et al., 2003
). Our
data clearly demonstrate a requirement for PI3K signaling downstream of the
PDGFR
to initiate migration, whereas cell survival and proliferation
are not dependent on this signaling.
The promotion of cell motility requires the coordination of many
intracellular signaling molecules. Although PI3K activation is important for
both Akt and Rac1 activation (Nobes and
Hall, 1995
; Wennstrom et al.,
1994a
), it is not the only pathway that has been implicated in
cytoskeletal reorganization driven by PDGF stimulation. For example,
PLC
and Src signaling have been implicated in actin ruffle formation
and cell motility driven by PDGFRβ stimulation in vitro
(Boyle et al., 2007
;
Kundra et al., 1994
;
Wennstrom et al., 1994b
).
Nonetheless, in our mesenchymal cells, these pathways were not sufficient to
stimulate motility in vivo or in vitro.
The hierarchy of signaling is yet to be established for many of these
interactions. It has been shown that paxillin phosphorylation by PAK1 leads to
increased cell motility (Nayal et al.,
2006
), and paxillin can also modulate Rac1 activity
(Chen et al., 2005
). Finally,
it has also been suggested that S6K1 could be involved in cell motility via
interactions with Rac1 (Berven et al.,
2004
; Liu et al.,
2006
). Thus, loss of PDGFR
-PI3K activation results in a
failure in multiple components associated with focal adhesions and cell
motility. The complex interactions of these proteins suggest multiple levels
of regulation, and it will be interesting to use these cells to further
determine the essential actions of each of these components.
Although Rac1 activation is an important component of cell motility, and
this pathway is clearly disrupted in our cells, it is unlikely that loss of
Rac1 is the only disruption leading to a failure in migration. Recent evidence
in Rac1-null mouse embryonic fibroblasts has shown that these cells
are capable of migrating towards PDGF
(Vidali et al., 2006
). This
suggests that other signaling pathways downstream of PDGF receptors can also
induce migration. Our data suggest that the mTORC1 or potentially mTORC2
complexes are also important in PDGF stimulated chemotaxis. We not only see a
loss of phosphorylation of Akt on the mTORC2 site (S473), but rapamycin also
inhibits migration of cells towards PDGF. This result is in contrast to the
lack of inhibition of migration to serum, suggesting that the rapamycin does
not render cells incapable of migration because of a generalized mechanism.
Studies of neuronal migration in response to HGF stimulation have demonstrated
that rapamycin does not affect migration
(Segarra et al., 2006
). These
results emphasize that different cell types rely on distinct signaling
pathways for induction of cell motility.
The role of cell polarity and cytoskeletal reorganization has been
appreciated in the morphogenesis of the neural tube. Multiple lines of
evidence indicate that defects in these processes can result in neural tube
defects (Harris and Juriloff,
2007
; Wallingford,
2006
). Now, we have shown that spina bifida can be caused by
defects unrelated to neural tube closure. In addition, disrupted cytoskeletal
rearrangement and cell movement are involved in this second etiology. In these
studies, the importance of PDGFR
signaling, especially through PI3K, in
somite-derived tissues suggests that cases of human spina bifida resistant to
folate supplementation may not be directly related to failure in neural tube
closure. Second, because disruption of PDGF receptor signaling has been
proposed for treatment of several human pathologies, concern should be placed
on effects that PDGF receptor inhibition could have on fetuses.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/135/3/589/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abramsson, A., Kurup, S., Busse, M., Yamada, S., Lindblom, P.,
Schallmeiner, E., Stenzel, D., Sauvaget, D., Ledin, J., Ringvall, M. et
al. (2007). Defective N-sulfation of heparan sulfate
proteoglycans limits PDGF-BB binding and pericyte recruitment in vascular
development. Genes Dev.
21,316
-331.
Aoki, M., Blazek, E. and Vogt, P. K. (2001). A
role of the kinase mTOR in cellular transformation induced by the oncoproteins
P3k and Akt. Proc. Natl. Acad. Sci. USA
98,136
-141.
Berven, L. A., Willard, F. S. and Crouch, M. F.
(2004). Role of the p70(S6K) pathway in regulating the actin
cytoskeleton and cell migration. Exp. Cell Res.
296,183
-195.[CrossRef][Medline]
Betsholtz, C. (2003). Biology of
platelet-derived growth factors in development. Birth Defects Res.
C Embryo Today 69,272
-285.[CrossRef][Medline]
Bianco, A., Poukkula, M., Cliffe, A., Mathieu, J., Luque, C. M.,
Fulga, T. A. and Rorth, P. (2007). Two distinct modes of
guidance signalling during collective migration of border cells.
Nature 448,362
-365.[CrossRef][Medline]
Blair, H. C., Zaidi, M. and Schlesinger, P. H.
(2002). Mechanisms balancing skeletal matrix synthesis and
degradation. Biochem. J.
364,329
-341.[CrossRef][Medline]
Blume-Jensen, P., Jiang, G., Hyman, R., Lee, K. F., O'Gorman, S.
and Hunter, T. (2000). Kit/stem cell factor receptor-induced
activation of phosphatidylinositol 3'-kinase is essential for male
fertility. Nat. Genet.
24,157
-162.[CrossRef][Medline]
Boyd, L. M., Chen, J., Kraus, V. B. and Setton, L. A.
(2004). Conditioned medium differentially regulates matrix
protein gene expression in cells of the intervertebral disc.
Spine 29,2217
-2222.[CrossRef][Medline]
Boyle, S. N., Michaud, G. A., Schweitzer, B., Predki, P. F. and
Koleske, A. J. (2007). A critical role for cortactin
phosphorylation by Abl-family kinases in PDGF-induced dorsal-wave formation.
Curr. Biol. 17,445
-451.[CrossRef][Medline]
Brachmann, S. M., Yballe, C. M., Innocenti, M., Deane, J. A.,
Fruman, D. A., Thomas, S. M. and Cantley, L. C. (2005). Role
of phosphoinositide 3-kinase regulatory isoforms in development and actin
rearrangement. Mol. Cell. Biol.
25,2593
-2606.
Brahmbhatt, A. A. and Klemke, R. L. (2003). ERK
and RhoA differentially regulate pseudopodia growth and retraction during
chemotaxis. J. Biol. Chem.
278,13016
-13025.
Brown, M. C. and Turner, C. E. (2004).
Paxillin: adapting to change. Physiol. Rev.
84,1315
-1339.
Buchdunger, E., O'Reilly, T. and Wood, J.
(2002). Pharmacology of imatinib (STI571). Eur. J.
Cancer 38 Suppl. 5,S28
-S36.[Medline]
Chen, G. C., Turano, B., Ruest, P. J., Hagel, M., Settleman, J.
and Thomas, S. M. (2005). Regulation of Rho and Rac signaling
to the actin cytoskeleton by paxillin during Drosophila development.
Mol. Cell. Biol. 25,979
-987.
Cho, N. K., Keyes, L., Johnson, E., Heller, J., Ryner, L.,
Karim, F. and Krasnow, M. A. (2002). Developmental control of
blood cell migration by the Drosophila VEGF pathway.
Cell 108,865
-876.[CrossRef][Medline]
Christ, B., Huang, R. and Scaal, M. (2004).
Formation and differentiation of the avian sclerotome. Anat.
Embryol. 208,333
-350.[Medline]
Day, T. F., Guo, X., Garrett-Beal, L. and Yang, Y.
(2005). Wnt/beta-catenin signaling in mesenchymal progenitors
controls osteoblast and chondrocyte differentiation during vertebrate
skeletogenesis. Dev. Cell
8, 739-750.[CrossRef][Medline]
del Pozo, M. A., Price, L. S., Alderson, N. B., Ren, X. D. and
Schwartz, M. A. (2000). Adhesion to the extracellular matrix
regulates the coupling of the small GTPase Rac to its effector PAK.
EMBO J. 19,2008
-2014.[CrossRef][Medline]
Dharmawardhane, S., Sanders, L. C., Martin, S. S., Daniels, R.
H. and Bokoch, G. M. (1997). Localization of p21-activated
kinase 1 (PAK1) to pinocytic vesicles and cortical actin structures in
stimulated cells. J. Cell Biol.
138,1265
-1278.
Ding, H., Wu, X., Bostrom, H., Kim, I., Wong, N., Tsoi, B.,
O'Rourke, M., Koh, G. Y., Soriano, P., Betsholtz, C. et al.
(2004). A specific requirement for PDGF-C in palate formation and
PDGFR-alpha signaling. Nat. Genet.
36,1111
-1116.[CrossRef][Medline]
Duchek, P., Somogyi, K., Jekely, G., Beccari, S. and Rorth,
P. (2001). Guidance of cell migration by the Drosophila
PDGF/VEGF receptor. Cell
107, 17-26.[CrossRef][Medline]
Fincham, V. J., James, M., Frame, M. C. and Winder, S. J.
(2000). Active ERK/MAP kinase is targeted to newly forming
cell-matrix adhesions by integrin engagement and v-Src. EMBO
J. 19,2911
-2923.[CrossRef][Medline]
Franke, T. F., Yang, S. I., Chan, T. O., Datta, K., Kazlauskas,
A., Morrison, D. K., Kaplan, D. R. and Tsichlis, P. N.
(1995). The protein kinase encoded by the Akt proto-oncogene is a
target of the PDGF-activated phosphatidylinositol 3-kinase.
Cell 81,727
-736.[CrossRef][Medline]
Fruman, D. A., Meyers, R. E. and Cantley, L. C.
(1998). Phosphoinositide kinases. Annu. Rev.
Biochem. 67,481
-507.[CrossRef][Medline]
Hamilton, T. G., Klinghoffer, R. A., Corrin, P. D. and Soriano,
P. (2003). Evolutionary divergence of platelet-derived growth
factor alpha receptor signaling mechanisms. Mol. Cell.
Biol. 23,4013
-4025.
Hanks, S. K., Ryzhova, L., Shin, N. Y. and Brabek, J.
(2003). Focal adhesion kinase signaling activities and their
implications in the control of cell survival and motility. Front.
Biosci. 8,d982
-d996.[Medline]
Harris, M. J. and Juriloff, D. M. (2007). Mouse
mutants with neural tube closure defects and their role in understanding human
neural tube defects. Birth Defects Res. A Clin. Mol.
Teratol. 79,187
-210.[CrossRef][Medline]
Heldin, C. H. and Westermark, B. (1999).
Mechanism of action and in vivo role of platelet-derived growth factor.
Physiol. Rev. 79,1283
-1316.
Helwig, U., Imai, K., Schmahl, W., Thomas, B. E., Varnum, D. S.,
Nadeau, J. H. and Balling, R. (1995). Interaction between
undulated and Patch leads to an extreme form of spina bifida in double-mutant
mice. Nat. Genet. 11,60
-63.[CrossRef][Medline]
Heuchel, R., Berg, A., Tallquist, M., Ahlen, K., Reed, R. K.,
Rubin, K., Claesson-Welsh, L., Heldin, C. H. and Soriano, P.
(1999). Platelet-derived growth factor beta receptor regulates
interstitial fluid homeostasis through phosphatidylinositol-3' kinase
signaling. Proc. Natl. Acad. Sci. USA
96,11410
-11415.
Hoch, R. V. and Soriano, P. (2003). Roles of
PDGF in animal development. Development
130,4769
-4784.
Hogan, B. L. (1994). Manipulating the
Mouse Embryo. Cold Spring Harbor, NY: Cold Spring Harbor
Press.
Hosang, M., Rouge, M., Wipf, B., Eggimann, B., Kaufmann, F. and
Hunziker, W. (1989). Both homodimeric isoforms of PDGF (AA
and BB) have mitogenic and chemotactic activity and stimulate phosphoinositol
turnover. J. Cell. Physiol.
140,558
-564.[CrossRef][Medline]
Hung, I. H., Yu, K., Lavine, K. J. and Ornitz, D. M.
(2007). FGF9 regulates early hypertrophic chondrocyte
differentiation and skeletal vascularization in the developing stylopod.
Dev. Biol. 307,300
-313.[CrossRef][Medline]
Juriloff, D. M. and Harris, M. J. (2000). Mouse
models for neural tube closure defects. Hum. Mol.
Genet. 9,993
-1000.
Kissel, H., Timokhina, I., Hardy, M. P., Rothschild, G., Tajima,
Y., Soares, V., Angeles, M., Whitlow, S. R., Manova, K. and Besmer, P.
(2000). Point mutation in kit receptor tyrosine kinase reveals
essential roles for kit signaling in spermatogenesis and oogenesis without
affecting other kit responses. EMBO J.
19,1312
-1326.[CrossRef][Medline]
Klinghoffer, R. A., Hamilton, T. G., Hoch, R. and Soriano,
P. (2002). An allelic series at the PDGFalphaR locus
indicates unequal contributions of distinct signaling pathways during
development. Dev. Cell
2, 103-113.[CrossRef][Medline]
Koyama, N., Morisaki, N., Saito, Y. and Yoshida, S.
(1992). Regulatory effects of platelet-derived growth factor-AA
homodimer on migration of vascular smooth muscle cells. J. Biol.
Chem. 267,22806
-22812.
Kundra, V., Escobedo, J. A., Kazlauskas, A., Kim, H. K., Rhee,
S. G., Williams, L. T. and Zetter, B. R. (1994). Regulation
of chemotaxis by the platelet-derived growth factor receptor-beta.
Nature 367,474
-476.[CrossRef][Medline]
Lee, E. R. (2006). Proteolytic enzymes in
skeletal development: histochemical methods adapted to the study of matrix
lysis during the transformation of a "cartilage model" into bone.
Front. Biosci. 11,2538
-2553.[Medline]
Liu, L., Li, F., Cardelli, J. A., Martin, K. A., Blenis, J. and
Huang, S. (2006). Rapamycin inhibits cell motility by
suppression of mTOR-mediated S6K1 and 4E-BP1 pathways.
Oncogene 25,7029
-7040.[CrossRef][Medline]
Malemud, C. J. (2006). Matrix
metalloproteinases: role in skeletal development and growth plate disorders.
Front. Biosci. 11,1702
-1715.[CrossRef][Medline]
McDonald, J. A., Pinheiro, E. M. and Montell, D. J.
(2003). PVF1, a PDGF/VEGF homolog, is sufficient to guide border
cells and interacts genetically with Taiman.
Development 130,3469
-3478.
Monsoro-Burq, A. H. and Le Douarin, N. (2000).
Duality of molecular signaling involved in vertebral chondrogenesis.
Curr. Top. Dev. Biol.
48, 43-75.[Medline]
Monsoro-Burq, A. H., Bontoux, M., Teillet, M. A. and Le Douarin,
N. M. (1994). Heterogeneity in the development of the
vertebra. Proc. Natl. Acad. Sci. USA
91,10435
-10439.
Monsoro-Burq, A. H., Duprez, D., Watanabe, Y., Bontoux, M.,
Vincent, C., Brickell, P. and Le Douarin, N. (1996). The role
of bone morphogenetic proteins in vertebral development.
Development 122,3607
-3616.[Abstract]
Morrison-Graham, K., Schatteman, G. C., Bork, T., Bowen-Pope, D.
F. and Weston, J. A. (1992). A PDGF receptor mutation in the
mouse (Patch) perturbs the development of a non-neuronal subset of neural
crest-derived cells. Development
115,133
-142.[Abstract]
Nagel, M., Tahinci, E., Symes, K. and Winklbauer, R.
(2004). Guidance of mesoderm cell migration in the Xenopus
gastrula requires PDGF signaling. Development
131,2727
-2736.
Naski, M. C. and Ornitz, D. M. (1998). FGF
signaling in skeletal development. Front. Biosci.
3,d781
-d794.[Medline]
Nayal, A., Webb, D. J., Brown, C. M., Schaefer, E. M.,
Vicente-Manzanares, M. and Horwitz, A. R. (2006). Paxillin
phosphorylation at Ser273 localizes a GIT1-PIX-PAK complex and regulates
adhesion and protrusion dynamics. J. Cell Biol.
173,587
-589.
Nobes, C. D. and Hall, A. (1995). Rho, rac, and
cdc42 GTPases regulate the assembly of multimolecular focal complexes
associated with actin stress fibers, lamellipodia, and filopodia.
Cell 81,53
-62.[CrossRef][Medline]
Orr-Urtreger, A. and Lonai, P. (1992).
Platelet-derived growth factor-A and its receptor are expressed in separate,
but adjacent cell layers of the mouse embryo.
Development 115,1045
-1058.[Abstract]
Orr-Urtreger, A., Bedford, M. T., Do, M. S., Eisenbach, L. and
Lonai, P. (1992). Developmental expression of the alpha
receptor for platelet-derived growth factor, which is deleted in the embryonic
lethal Patch mutation. Development
115,289
-303.[Abstract]
Ovchinnikov, D. A., Deng, J. M., Ogunrinu, G. and Behringer, R.
R. (2000). Col2a1-directed expression of Cre recombinase in
differentiating chondrocytes in transgenic mice.
Genesis 26,145
-146.[CrossRef][Medline]
Parsons, J. T. (2003). Focal adhesion kinase:
the first ten years. J. Cell Sci.
116,1409
-1416.
Payne, J., Shibasaki, F. and Mercola, M.
(1997). Spina bifida occulta in homozygous Patch mouse embryos.
Dev. Dyn. 209,105
-116.[CrossRef][Medline]
Richarte, A. M., Mead, H. B. and Tallquist, M. D.
(2007). Cooperation between the PDGF receptors in cardiac neural
crest cell migration. Dev. Biol.
306,785
-796.[CrossRef][Medline]
Romanoff, A. (1960). The Avian
Embryo: Structural and Functional Development. New York:
Macmillan Co.
Ronnstrand, L. and Heldin, C. H. (2001).
Mechanisms of platelet-derived growth factor-induced chemotaxis.
Int. J. Cancer 91,757
-762.[CrossRef][Medline]
Rosenkranz, S., DeMali, K. A., Gelderloos, J. A., Bazenet, C.
and Kazlauskas, A. (1999). Identification of the
receptor-associated signaling enzymes that are required for platelet-derived
growth factor-AA-dependent chemotaxis and DNA synthesis. J. Biol.
Chem. 274,28335
-28343.
Sabatini, D. M. (2006). mTOR and cancer:
insights into a complex relationship. Nat. Rev. Cancer
6, 729-734.[CrossRef][Medline]
Sarbassov, D. D., Ali, S. M., Sengupta, S., Sheen, J. H., Hsu,
P. P., Bagley, A. F., Markhard, A. L. and Sabatini, D. M.
(2006). Prolonged rapamycin treatment inhibits mTORC2 assembly
and Akt/PKB. Mol. Cell
22,159
-168.[CrossRef][Medline]
Segarra, J., Balenci, L., Drenth, T., Maina, F. and Lamballe,
F. (2006). Combined signaling through ERK, PI3K/AKT, and
RAC1/p38 is required for met-triggered cortical neuron migration.
J. Biol. Chem. 281,4771
-4778.
Sells, M. A., Knaus, U. G., Bagrodia, S., Ambrose, D. M.,
Bokoch, G. M. and Chernoff, J. (1997). Human p21-activated
kinase (Pak1) regulates actin organization in mammalian cells.
Curr. Biol. 7,202
-210.[CrossRef][Medline]
Soriano, P. (1997). The PDGF alpha receptor is
required for neural crest cell development and for normal patterning of the
somites. Development
124,2691
-2700.[Abstract]
Stedman, T. L. (2000). Stedman's
Medical Dictionary. Philadelphia: Lippincott Williams &
Wlikins.
Stott, N. S. and Chuong, C. M. (2000).
Retroviral gene transduction in limb bud micromass cultures.
Methods Mol. Biol. 135,509
-513.[Medline]
Takahashi, Y., Monsoro-Burq, A. H., Bontoux, M. and Le Douarin,
N. M. (1992). A role for Quox-8 in the establishment of the
dorsoventral pattern during vertebrate development. Proc. Natl.
Acad. Sci. USA 89,10237
-10241.
Takakura, N., Yoshida, H., Ogura, Y., Kataoka, H., Nishikawa, S.
and Nishikawa, S. (1997). PDGFR alpha expression during mouse
embryogenesis: immunolocalization analyzed by whole-mount immunohistostaining
using the monoclonal anti-mouse PDGFR alpha antibody APA5. J.
Histochem. Cytochem. 45,883
-893.
Tallquist, M. D. and Soriano, P. (2003). Cell
autonomous requirement for PDGFRalpha in populations of cranial and cardiac
neural crest cells. Development
130,507
-518.
Tallquist, M. D., French, W. J. and Soriano, P.
(2003). Additive effects of PDGF receptor beta signaling pathways
in vascular smooth muscle cell development. PLoS Biol.
1, E52.[Medline]
Vidali, L., Chen, F., Cicchetti, G., Ohta, Y. and Kwiatkowski,
D. J. (2006). Rac1-null mouse embryonic fibroblasts are
motile and respond to platelet-derived growth factor. Mol. Biol.
Cell 17,2377
-2390.
Wallingford, J. B. (2006). Planar cell
polarity, ciliogenesis and neural tube defects. Hum. Mol.
Genet. 15 Suppl. 2,R227
-R234.
Watanabe, Y., Duprez, D., Monsoro-Burq, A. H., Vincent, C. and
Le Douarin, N. M. (1998). Two domains in vertebral
development: antagonistic regulation by SHH and BMP4 proteins.
Development 125,2631
-2639.[Abstract]
Wennstrom, S., Hawkins, P., Cooke, F., Hara, K., Yonezawa, K.,
Kasuga, M., Jackson, T., Claesson-Welsh, L. and Stephens, L.
(1994a). Activation of phosphoinositide 3-kinase is required for
PDGF-stimulated membrane ruffling. Curr. Biol.
4, 385-393.[CrossRef][Medline]
Wennstrom, S., Siegbahn, A., Yokote, K., Arvidsson, A. K.,
Heldin, C. H., Mori, S. and Claesson-Welsh, L. (1994b).
Membrane ruffling and chemotaxis transduced by the PDGF beta-receptor require
the binding site for phosphatidylinositol 3' kinase.
Oncogene 9,651
-660.[Medline]
Wilkinson, D. G. (1992). Whole mount in
situ hybridization to vertebrate embryos. Oxford: IRL
Press.
Wood, W., Faria, C. and Jacinto, A. (2006).
Distinct mechanisms regulate hemocyte chemotaxis during development and wound
healing in Drosophila melanogaster. J. Cell Biol.
173,405
-416.
Yokote, K., Mori, S., Siegbahn, A., Ronnstrand, L., Wernstedt,
C., Heldin, C. H. and Claesson-Welsh, L. (1996). Structural
determinants in the platelet-derived growth factor alpha-receptor implicated
in modulation of chemotaxis. J. Biol. Chem.
271,5101
-5111.
Yoon, B. S., Ovchinnikov, D. A., Yoshii, I., Mishina, Y.,
Behringer, R. R. and Lyons, K. M. (2005). Bmpr1a and Bmpr1b
have overlapping functions and are essential for chondrogenesis in vivo.
Proc. Natl. Acad. Sci. USA
102,5062
-5067.
Yu, K., Xu, J., Liu, Z., Sosic, D., Shao, J., Olson, E. N.,
Towler, D. A. and Ornitz, D. M. (2003). Conditional
inactivation of FGF receptor 2 reveals an essential role for FGF signaling in
the regulation of osteoblast function and bone growth.
Development 130,3063
-3074.
Zeng, Z., Sarbassov, D. D., Samudio, I. J., Yee, K. W. L.,
Munsell, M. F., Jackson, C. E., Giles, F. J., Sabatini, D. M., Andreeff, M.
and Konopleva, M. (2007). Rapamycin derivatives reduce mTORC2
signaling and inhibit AKT activation in AML. Blood
109,3509
-3512
This article has been cited by other articles:
![]() |
X. Yang, H. Chrisman, and C. J. Weijer PDGF signalling controls the migration of mesoderm cells during chick gastrulation by regulating N-cadherin expression Development, November 1, 2008; 135(21): 3521 - 3530. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Clouthier, J. Gray, and K. B. Artinger Micromanaging Palate Development Speech Science and Orofacial Disorders, October 1, 2008; 18(2): 62 - 72. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||